ID: 1144824608

View in Genome Browser
Species Human (GRCh38)
Location 17:18098773-18098795
Sequence ATCATCAGTGATGAGTGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144824605_1144824608 12 Left 1144824605 17:18098738-18098760 CCCATGGTGAAACAATTTATTTG 0: 1
1: 0
2: 1
3: 23
4: 232
Right 1144824608 17:18098773-18098795 ATCATCAGTGATGAGTGTTGTGG 0: 1
1: 0
2: 1
3: 10
4: 170
1144824604_1144824608 21 Left 1144824604 17:18098729-18098751 CCTTAAGTTCCCATGGTGAAACA 0: 1
1: 0
2: 2
3: 5
4: 147
Right 1144824608 17:18098773-18098795 ATCATCAGTGATGAGTGTTGTGG 0: 1
1: 0
2: 1
3: 10
4: 170
1144824606_1144824608 11 Left 1144824606 17:18098739-18098761 CCATGGTGAAACAATTTATTTGT 0: 1
1: 0
2: 2
3: 22
4: 279
Right 1144824608 17:18098773-18098795 ATCATCAGTGATGAGTGTTGTGG 0: 1
1: 0
2: 1
3: 10
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144824608 Original CRISPR ATCATCAGTGATGAGTGTTG TGG Intronic
902065133 1:13679284-13679306 AGCTTCATTGATGAGTTTTGGGG + Intergenic
905368558 1:37469976-37469998 ATCACCAGTGATAAGTCTAGTGG - Intergenic
907851280 1:58257566-58257588 ATCATTTATGATGTGTGTTGGGG + Intronic
908163045 1:61430578-61430600 ATCATCTGTAATGATTGGTGGGG + Intronic
913187803 1:116385805-116385827 ATCTTCTGTGTTGATTGTTGGGG + Intronic
920107369 1:203563497-203563519 GTCATCAGTGATGAATATTCTGG + Intergenic
923446769 1:234078486-234078508 ATCAACAGGGCTGACTGTTGCGG - Intronic
924427952 1:243970960-243970982 ATCATTTGTGTTGAGTGCTGTGG - Intergenic
1064845930 10:19653089-19653111 ATCAGCAGTCTTGAGTGTTTTGG + Intronic
1068786982 10:60987457-60987479 ATCATTGGTTATGTGTGTTGTGG - Intronic
1073371180 10:102990661-102990683 GTGGTCAGTGATGAGTGTTCTGG - Intronic
1074402393 10:113152796-113152818 CTCAGCAGTGATCAGTGGTGTGG + Intronic
1074945713 10:118278693-118278715 ATAATCAGGGATGAGGGTGGAGG + Intergenic
1077062572 11:624353-624375 ATCATCAGTGGTCAGTGCTGAGG + Intronic
1079138245 11:17788624-17788646 ATGAGCAGTCATGAGTTTTGTGG - Intronic
1080324764 11:31057850-31057872 ATCACCAGGGAGGAGTGTTCAGG + Intronic
1080988174 11:37496381-37496403 GTCATCAGTTATGTGTGTTATGG - Intergenic
1081729302 11:45357831-45357853 AGCAGTAATGATGAGTGTTGTGG - Intergenic
1089442184 11:118527019-118527041 TTCATCAGTGATGTATGTTCAGG + Intergenic
1090338738 11:125996056-125996078 ATACTCAGTGCTTAGTGTTGTGG - Intronic
1092509771 12:9143097-9143119 TTCATCAGGGGTGAGGGTTGAGG + Intergenic
1092901501 12:13064063-13064085 CCCATCAGTCATGAGTTTTGAGG + Intronic
1095900853 12:47326433-47326455 ATTAGCACTGATGTGTGTTGGGG - Intergenic
1097494044 12:60307546-60307568 ATCAGCTGAGCTGAGTGTTGTGG - Intergenic
1099852940 12:88126215-88126237 ATCATCAGTGCCTAGTGTAGCGG - Intronic
1105786072 13:23750556-23750578 AGCATCAGTGATGCGTCATGTGG - Intronic
1108463407 13:50690718-50690740 ATCCTCAATGCTGAGTGTTTTGG - Intronic
1108994438 13:56709788-56709810 ATCATCAGGGATGAAACTTGAGG + Intergenic
1112157071 13:96829739-96829761 ATCATCATTGATGAGCATTTAGG + Intronic
1113695069 13:112339639-112339661 CTCTTCAGTGAAGAGAGTTGTGG + Intergenic
1116402782 14:44529244-44529266 ATCATCAGAGAGCAGTGTTTGGG - Intergenic
1117946910 14:61036765-61036787 AACATTAGTGAGGAGTGATGAGG - Intronic
1118284201 14:64456470-64456492 ATTATCAGTGACCAGTGTTTAGG + Intronic
1119685570 14:76628277-76628299 ATAAACATTGATGAGTGATGGGG - Intergenic
1121877872 14:97470538-97470560 ATCACCAGTGAGGAGTCATGTGG - Intergenic
1202903770 14_GL000194v1_random:57183-57205 AGCAGCAGTGATGACTCTTGAGG - Intergenic
1125074570 15:35598668-35598690 ATCATAAGTGTTCTGTGTTGAGG - Intergenic
1129316799 15:74750076-74750098 GCCATCAGTGATGAGGGTGGAGG - Exonic
1130723207 15:86410360-86410382 TTCATCAGTGATGATTGTGGTGG + Intronic
1130874593 15:88002417-88002439 GTCATCAGGGATGAGGGCTGGGG - Intronic
1131397955 15:92101733-92101755 ATAGTCAGTGATGAGTGTCTTGG + Intronic
1133733125 16:8592942-8592964 ATTATCAGTGATGATGGTTTTGG - Intergenic
1133764776 16:8830203-8830225 ATCACCAGTGAGGGGGGTTGGGG + Intronic
1134213837 16:12300382-12300404 ATCATCAGTGATCAGCTTGGTGG + Intronic
1135489943 16:22900456-22900478 ATCATGAGTGAAGAGAGCTGTGG + Intronic
1136682254 16:31975264-31975286 TTCATCAGGGATCAGTGGTGTGG - Intergenic
1139118499 16:63986484-63986506 ATCATCTGAGATCAGTGATGTGG + Intergenic
1139163446 16:64538451-64538473 AGCAACAGTGTTGAGAGTTGGGG + Intergenic
1141573220 16:84947391-84947413 ATAATGAGAGATGAGTGTGGGGG - Intergenic
1144824608 17:18098773-18098795 ATCATCAGTGATGAGTGTTGTGG + Intronic
1146631003 17:34469259-34469281 CTCTTCATTGCTGAGTGTTGTGG + Intergenic
1147978208 17:44259828-44259850 GTCTCCAGTGAGGAGTGTTGGGG + Exonic
1151192579 17:72409143-72409165 ATCTTCTGTGTTGATTGTTGTGG - Intergenic
1152659052 17:81534110-81534132 CTGATCAGTGATGAGTGTGAGGG + Intronic
1153266920 18:3280235-3280257 ATTATTTGTGAAGAGTGTTGTGG + Intergenic
1154191735 18:12236054-12236076 GTCATCAGTGGTGAGTGCTGTGG + Intergenic
1156698809 18:39799320-39799342 ATAAACAGTGATGGTTGTTGCGG + Intergenic
1157783687 18:50463118-50463140 GGCATAAGTGATGAGTGTGGGGG + Intergenic
1158226895 18:55210771-55210793 AGCATCAGGGGTGACTGTTGGGG + Intergenic
1159650044 18:70967610-70967632 AGCATCAGCCATGAGTGATGGGG - Intergenic
1164058806 19:21646911-21646933 ATCATCAGGGCTGGGTGTGGTGG - Intergenic
1165338593 19:35193600-35193622 ATCAGAAGTGTTGAGTGCTGAGG - Intergenic
1167862176 19:52294003-52294025 ATCAACAGTGATGAACATTGAGG - Exonic
927059916 2:19407399-19407421 AGTCTCCGTGATGAGTGTTGGGG + Intergenic
927602597 2:24457135-24457157 ATCATCAGTGATGCATCTTGGGG + Intergenic
930559202 2:52938982-52939004 ATCTTCAGTGTTGATTGATGTGG + Intergenic
931224172 2:60315380-60315402 ATCATAAGTGATGATTATTGAGG - Intergenic
931881053 2:66571395-66571417 ATCATCACTGTTGGGTGGTGAGG - Exonic
933120513 2:78530899-78530921 GACAGCAGTGATGAGTGTTTGGG + Intergenic
935527630 2:104190575-104190597 ATCCTCTGTGATGAGTGCTAAGG - Intergenic
936001559 2:108836065-108836087 AACATCAGTGTTGAGAGGTGAGG - Intronic
937279578 2:120708179-120708201 ATCATCTGTGGTCAGTATTGTGG + Intergenic
937815965 2:126251215-126251237 ATCATCACTGATGACTGTTGTGG - Intergenic
939410453 2:141818118-141818140 TTTAGCAGTTATGAGTGTTGTGG - Intronic
939575253 2:143887506-143887528 GTCATCTGTGGTGATTGTTGTGG + Intergenic
940049043 2:149441429-149441451 ATTATCAGTGATGGCTGTTCTGG - Intronic
945535733 2:211015807-211015829 ATCTTAAGTTATGAGTATTGGGG + Intergenic
947170013 2:227301379-227301401 CTCATCAGTGATGCGTAATGAGG + Intronic
1168859855 20:1038237-1038259 ATCCCCAGTGGTAAGTGTTGGGG + Intergenic
1173841735 20:46161747-46161769 GTCATCAGTGATGACTTTGGGGG - Intergenic
1175138038 20:56839698-56839720 ATCTGCAGTGGTGGGTGTTGGGG - Intergenic
1176623135 21:9071951-9071973 AGCAGCAGTGATGACTCTTGAGG - Intergenic
1177422672 21:20881580-20881602 TATATCAGTGATGAGTGTTGAGG - Intergenic
1177749119 21:25257520-25257542 ATTGTCAAGGATGAGTGTTGAGG - Intergenic
1183148339 22:36016393-36016415 ATCATGAGGGATGGGTGGTGTGG - Intronic
1183560378 22:38568552-38568574 ATGATAAGTGATCACTGTTGGGG - Intronic
1183863024 22:40683100-40683122 GTCATCAGTGATGAGTCCTCAGG + Intergenic
949419624 3:3851963-3851985 TTCATCACTGATAAGTGATGAGG + Intronic
950722444 3:14892930-14892952 ATCATCTTTCCTGAGTGTTGAGG + Intronic
950762377 3:15243476-15243498 ATCACCTGTGAAGAGAGTTGTGG + Intronic
952671771 3:35977026-35977048 ATCATTAGAGATGAATGGTGTGG + Intergenic
953533349 3:43757694-43757716 AACATCAGTGATGAGGGCAGTGG - Intergenic
955107024 3:55908308-55908330 ATCATGAATGATCAGTTTTGAGG + Intronic
955330735 3:58044941-58044963 ATCAGCACTGATTAGTGTTTGGG - Intronic
956257995 3:67304766-67304788 ATCTTCAGACTTGAGTGTTGGGG + Intergenic
958788509 3:98624704-98624726 AAGATCAGTTATGTGTGTTGGGG + Intergenic
959289885 3:104460283-104460305 ATCATCTTTGATGAGAGTTCTGG + Intergenic
961564462 3:127753870-127753892 ATCACCAAGGAAGAGTGTTGGGG - Intronic
961959965 3:130844606-130844628 ACCATCTGTGCTAAGTGTTGGGG + Intergenic
963958247 3:151279587-151279609 AGCATCAGTGAGGACTATTGGGG - Intronic
965523108 3:169688599-169688621 ATCATCAGCCAAGAGTGGTGGGG - Intergenic
965702687 3:171474108-171474130 ATCATTAGTGATAAGTCATGTGG + Intergenic
966229064 3:177630886-177630908 ATCATCAGTGATGGGCTGTGAGG - Intergenic
967195518 3:187022283-187022305 ATCTTCTGTGTTGATTGTTGTGG + Intronic
968171774 3:196516369-196516391 ATTATCAGAGAAGAGTGTTAAGG + Intergenic
970457237 4:16237017-16237039 ATCAACACTGATGAATTTTGTGG + Intergenic
971827528 4:31645649-31645671 ATCATCAAATATGTGTGTTGTGG + Intergenic
976853831 4:89579959-89579981 ATCAGCTGTGATGAGTCATGTGG - Intergenic
978288323 4:107105911-107105933 ATCATCATTTATGAGTTATGTGG - Intronic
979135246 4:117103348-117103370 ATCATCACTGATAAGTCATGTGG + Intergenic
979837999 4:125397817-125397839 TCCATCAGTGATGAGTGATAAGG - Intronic
980647919 4:135668359-135668381 ATTATCAGTAATTATTGTTGTGG - Intergenic
981526853 4:145715316-145715338 ATTATCAGAGCTGAGTGGTGAGG - Intronic
984746857 4:183229551-183229573 ATCACCAGGGATGAGTCATGTGG + Intronic
986222065 5:5776724-5776746 ATCATCAGTCAGCAGTGCTGAGG + Intergenic
986545989 5:8897566-8897588 ACGATCAGTGAAGTGTGTTGAGG - Intergenic
986976676 5:13402678-13402700 ATCATCAGTGATAAGTCATTTGG + Intergenic
987169220 5:15236500-15236522 AACATCAGTAATGTGTTTTGTGG + Intergenic
987457859 5:18169423-18169445 AGAATCAGTGATGAGTGAAGGGG - Intergenic
988668643 5:33357502-33357524 AGCATCAGTGATAACTGGTGGGG + Intergenic
991284650 5:64958869-64958891 ATAATCAGTGTTCAGTGTTGAGG + Intronic
993677849 5:90839068-90839090 ATCATTATTCATGAGTGTTCTGG - Intronic
994577391 5:101595496-101595518 ATCTTCAGTGTTTAGTGCTGTGG - Intergenic
994988055 5:106963025-106963047 ATCATCAGTGATGAGAGCAATGG + Intergenic
995436269 5:112139499-112139521 ATCACCAGTGATAAGTCATGTGG + Intergenic
995850563 5:116541124-116541146 ATCAGCGGTGATGGGTGTTGGGG + Intronic
996312817 5:122126104-122126126 TGCATCAGTGAAGAGTCTTGAGG + Intergenic
996542221 5:124642469-124642491 ATCATCAGTGTTCATGGTTGGGG - Intronic
1000169389 5:158687133-158687155 AAACTCAGTGGTGAGTGTTGAGG - Intergenic
1000835663 5:166150664-166150686 ATCAACAGTGCTGAATGCTGTGG + Intergenic
1001430862 5:171660854-171660876 AACCTCAAAGATGAGTGTTGGGG + Intergenic
1003323241 6:5071504-5071526 ATCATGAGTGCTGAGTTTTCTGG - Intergenic
1004699708 6:18067431-18067453 ATCTTCAGTGTTGATTTTTGTGG + Intergenic
1005273024 6:24186663-24186685 ATGATCAGTGATGAGTAGAGCGG - Intronic
1005276717 6:24227456-24227478 ATCTTCTGAGATGAATGTTGAGG + Intronic
1008762068 6:54863045-54863067 CTCAGCAGTGAGGTGTGTTGTGG - Intronic
1010811512 6:80305734-80305756 GTCATCAGTGCTGTGTGTTTTGG - Intronic
1010850421 6:80768990-80769012 ATGAACAGTGCTGAGTGTGGAGG + Intergenic
1013257750 6:108406283-108406305 AAAATAAGTGATAAGTGTTGGGG - Intronic
1014122353 6:117740001-117740023 GTCCTCAGTGGTGAGAGTTGAGG - Intergenic
1014827893 6:126066781-126066803 CTTATCAGTGATGAGGCTTGGGG + Intergenic
1015499245 6:133914794-133914816 ATCATCAGTGTTAAGAGGTGAGG + Intergenic
1017118503 6:151001820-151001842 GTCAACAGTGATGAGTTCTGGGG - Intronic
1017198278 6:151725285-151725307 AACATCATTGATGTGTTTTGAGG + Intronic
1018054778 6:160042333-160042355 ATCACCACTGATGAGTCATGGGG + Intronic
1018551462 6:165002904-165002926 ATCAGCAGTGATGAGTCACGTGG - Intergenic
1019747079 7:2706808-2706830 ATTGACAGTGATGATTGTTGTGG - Intronic
1021267179 7:18539184-18539206 ATCACCAGTGATAAGTCATGTGG + Intronic
1023083519 7:36547345-36547367 ATAATCAGTGAAGTGTGTTCAGG - Intronic
1024829881 7:53438365-53438387 ACCAACAGTGATGAGTCATGTGG - Intergenic
1024850126 7:53703581-53703603 AACATCAGTGAAGAGTACTGAGG + Intergenic
1026568821 7:71511786-71511808 AGCATCAGAGATGTCTGTTGTGG - Intronic
1028362844 7:89989745-89989767 ATGATCAGTGATGTCTGATGAGG - Intergenic
1028614769 7:92754031-92754053 ATTGTCAGTGATGAATGTTAGGG - Intronic
1029050336 7:97680173-97680195 ATCTTCTGTGTTGATTGTTGTGG + Intergenic
1030377483 7:108770423-108770445 ATCATCAGTGAAGACTGAAGAGG + Intergenic
1030615392 7:111733230-111733252 ATCATCTGTGGTCACTGTTGTGG - Intronic
1032741071 7:134739927-134739949 ATTATCAGTGAAGAATGTAGTGG - Intergenic
1033048708 7:137984977-137984999 ATTATCAGCAATGAGTTTTGCGG + Intronic
1036020539 8:4840182-4840204 ATGATCAGGGATGAGTGGAGGGG - Intronic
1038131354 8:24735299-24735321 ATCATCAGTTAATAGTATTGGGG - Intergenic
1038915505 8:32017344-32017366 GTCATCTGTGTTGATTGTTGTGG - Intronic
1041104340 8:54426633-54426655 ACCAACACTGATGAGTGTTGCGG + Intergenic
1045642986 8:104272408-104272430 ATCATGATTGATGAGTGGTCTGG + Intergenic
1045991609 8:108314901-108314923 GTCATCTGTGTTGATTGTTGTGG + Intronic
1047843030 8:128774982-128775004 ATCATCAGTGAAGCTTTTTGAGG + Intergenic
1048522985 8:135174130-135174152 TTCATCAGATATGAGGGTTGAGG + Intergenic
1048800548 8:138190210-138190232 ATCTACAGTGGTGAGGGTTGTGG - Intronic
1052261259 9:26519075-26519097 ACCACCAGTTATGAGTATTGTGG - Intergenic
1052315239 9:27109712-27109734 ATCAGCACTGATGAGATTTGGGG - Intronic
1052695098 9:31868652-31868674 AGCATCAGTGATGTTTGTTAGGG + Intergenic
1055774816 9:79755815-79755837 ATCATCAGTGACAAATGGTGTGG + Intergenic
1057426419 9:94953772-94953794 ATCAACACTGAGGAGTGTTGAGG - Intronic
1059677427 9:116552778-116552800 ATCACCAGGGATGAGGTTTGGGG + Intronic
1059848169 9:118304530-118304552 TTCATAACTGATGAGTGTGGAGG - Intergenic
1203746325 Un_GL000218v1:42378-42400 AGCAGCAGTGATGACTCTTGAGG - Intergenic
1185936408 X:4261973-4261995 ATCTTCTGTGTTGATTGTTGTGG - Intergenic
1187592594 X:20734754-20734776 ATCAATAATGTTGAGTGTTGTGG - Intergenic
1187734757 X:22292302-22292324 AGCACCACTGAAGAGTGTTGGGG - Intergenic
1190720250 X:53142021-53142043 GTCATCAGGGCTGAGTGTTCTGG - Intergenic
1199323267 X:146466601-146466623 AGCATCAGTGAAGATTGTGGGGG + Intergenic
1201159654 Y:11157392-11157414 AGCAGCAGTGATGACTCTTGAGG - Intergenic