ID: 1144825421

View in Genome Browser
Species Human (GRCh38)
Location 17:18103101-18103123
Sequence CAGCAGGAGGAGAGGACCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 863
Summary {0: 1, 1: 0, 2: 5, 3: 76, 4: 781}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144825421_1144825427 -4 Left 1144825421 17:18103101-18103123 CCTCAGGTCCTCTCCTCCTGCTG 0: 1
1: 0
2: 5
3: 76
4: 781
Right 1144825427 17:18103120-18103142 GCTGTGTCCCAGGCCTTTGAGGG 0: 1
1: 0
2: 0
3: 20
4: 251
1144825421_1144825426 -5 Left 1144825421 17:18103101-18103123 CCTCAGGTCCTCTCCTCCTGCTG 0: 1
1: 0
2: 5
3: 76
4: 781
Right 1144825426 17:18103119-18103141 TGCTGTGTCCCAGGCCTTTGAGG 0: 1
1: 0
2: 1
3: 38
4: 328
1144825421_1144825432 11 Left 1144825421 17:18103101-18103123 CCTCAGGTCCTCTCCTCCTGCTG 0: 1
1: 0
2: 5
3: 76
4: 781
Right 1144825432 17:18103135-18103157 TTTGAGGGGCTGCCATCCTCAGG 0: 1
1: 1
2: 1
3: 12
4: 180
1144825421_1144825433 12 Left 1144825421 17:18103101-18103123 CCTCAGGTCCTCTCCTCCTGCTG 0: 1
1: 0
2: 5
3: 76
4: 781
Right 1144825433 17:18103136-18103158 TTGAGGGGCTGCCATCCTCAGGG 0: 1
1: 0
2: 0
3: 12
4: 196
1144825421_1144825428 -3 Left 1144825421 17:18103101-18103123 CCTCAGGTCCTCTCCTCCTGCTG 0: 1
1: 0
2: 5
3: 76
4: 781
Right 1144825428 17:18103121-18103143 CTGTGTCCCAGGCCTTTGAGGGG 0: 1
1: 0
2: 3
3: 69
4: 664

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144825421 Original CRISPR CAGCAGGAGGAGAGGACCTG AGG (reversed) Intronic
900097328 1:945261-945283 CAGCAGGTGGAGAGGAGCCCTGG + Intronic
900294773 1:1943388-1943410 CAGCAGGAGGACAGGCGCCGCGG + Intronic
900631932 1:3641155-3641177 CAGCAGGAAGAAAGGACCAGAGG + Intronic
900939156 1:5786740-5786762 CAGCAGGTGCAAAGGCCCTGAGG + Intergenic
901252939 1:7795569-7795591 CAGCAGGCGCAGAGGCCCTGGGG + Intronic
901432369 1:9224867-9224889 CAGCAGGTGCAAAGGCCCTGAGG - Intergenic
901661374 1:10799875-10799897 CAGCAGGTGCAGAGGCCCTGAGG - Intergenic
902130060 1:14252491-14252513 CAACATGAGGAAAGGTCCTGGGG - Intergenic
902837645 1:19057540-19057562 CAGCCTGAGCAGAGGCCCTGGGG + Intergenic
903386148 1:22928225-22928247 CAGCAGGAGCAAAGGCCCTGAGG + Intergenic
903789089 1:25880593-25880615 CAGCAGGAGTACAGGACATCGGG + Intergenic
904036868 1:27563739-27563761 CACCAGGAGGGGAGGTGCTGTGG + Intronic
904402794 1:30267689-30267711 CAGCAGAAGCAAAGGTCCTGAGG + Intergenic
904799929 1:33085456-33085478 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
904810007 1:33157320-33157342 CAGCAAGTGCAAAGGACCTGAGG - Intronic
905014040 1:34764932-34764954 TAGCAGGAGGAGAAGGCCTTGGG - Intronic
905249285 1:36637762-36637784 AAGCAGGAGGAGTGGGGCTGGGG + Intergenic
905328676 1:37176499-37176521 CAGAAGGAGGAGTGGATGTGGGG + Intergenic
905365864 1:37451229-37451251 CAGCAGCAGGAGAGGGTGTGGGG + Intergenic
905483007 1:38274606-38274628 CAGGAGGTGGTGAGGAGCTGGGG + Intergenic
905898468 1:41564859-41564881 CAGGAGGCAGAGAGGACCTCCGG + Intronic
906087983 1:43152332-43152354 CAGCAAGAGCAAAGGTCCTGAGG - Intronic
906612790 1:47214818-47214840 CAGTATGAGGAAGGGACCTGTGG - Intergenic
906680121 1:47720502-47720524 CTGCAGGAGGAGTGGCCCAGTGG - Intergenic
906708595 1:47912883-47912905 CAGTGGGAAGAAAGGACCTGTGG + Intronic
906793232 1:48676931-48676953 CACAAGGAGAAGAGGACCAGTGG + Intronic
906965755 1:50454884-50454906 CAGCAGTATGCTAGGACCTGGGG - Intronic
907400539 1:54222338-54222360 CAGCAGGAACAAAGGCCCTGGGG + Intronic
907715474 1:56922237-56922259 CAGCAGGTGCAAAGGTCCTGAGG - Intergenic
907733049 1:57086399-57086421 CTGCTGGAGGAGAGGGTCTGAGG + Intronic
907902114 1:58750585-58750607 GAGCAGGAGGACAAGACCGGGGG - Intergenic
907978703 1:59459703-59459725 CAGCAGGGAGAAAGGACCTTAGG + Intronic
908673516 1:66575425-66575447 CAGCAGGTAGAGAGGATTTGGGG - Intronic
908735371 1:67270896-67270918 CAGCAGGAGCAAAGACCCTGGGG - Intergenic
909367604 1:74846008-74846030 CAGCAGGAGTGCAGGCCCTGAGG - Intergenic
911761172 1:101619155-101619177 CAGCAGGAGGTGAGCAGCAGGGG - Intergenic
912457609 1:109808347-109808369 CAGCAGGGGGTCAGGGCCTGGGG + Intergenic
912497055 1:110098464-110098486 AGGCTGGGGGAGAGGACCTGGGG - Intergenic
913207828 1:116557389-116557411 AAGCAAGATGGGAGGACCTGCGG + Intronic
913535888 1:119771720-119771742 CAGAAAGAGGGGAGCACCTGTGG - Intergenic
913965952 1:143377628-143377650 AAGCACGAGGAGAGCAGCTGGGG + Intergenic
914060326 1:144203236-144203258 AAGCACGAGGAGAGCAGCTGGGG + Intergenic
914118824 1:144763133-144763155 AAGCACGAGGAGAGCAGCTGGGG - Intergenic
914460364 1:147878096-147878118 CACCAGGAAGAGAGGACTTCAGG + Intergenic
915101983 1:153507361-153507383 CAGCAGGAGGGGAGTAGGTGGGG - Intergenic
915580859 1:156812464-156812486 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
915590216 1:156866432-156866454 GAGGAGGAGGAGGGGAGCTGAGG + Intronic
915729783 1:158045080-158045102 CAGCAGAGGCAGAGGTCCTGAGG + Intronic
916168036 1:161980829-161980851 CTGTGGGAGGAAAGGACCTGAGG + Intergenic
916486747 1:165266332-165266354 TAGCAGGAGCAGAAGCCCTGAGG + Intronic
917131370 1:171745287-171745309 AAGCAAGAAGAAAGGACCTGGGG + Intergenic
917199453 1:172499678-172499700 CTGCAGGAGGTGAGGAAGTGAGG + Intergenic
917496886 1:175548597-175548619 CAGCAGAAAGAGGGGCCCTGAGG - Intronic
917979225 1:180259131-180259153 GAGCAGGAGCAGAGGAGCAGAGG + Intronic
918084562 1:181234825-181234847 CAGCAGGTGCAAAGGCCCTGAGG - Intergenic
918249251 1:182686801-182686823 CAGCAAGAGAAGAGGGGCTGAGG + Intergenic
918279214 1:182986845-182986867 GAGCAGAAGGAGATCACCTGTGG - Intergenic
919516576 1:198532765-198532787 CAGCAAGTGCAGAGGCCCTGAGG + Intronic
919613329 1:199774027-199774049 CAGCAGGAGCAAAGGCTCTGAGG + Intergenic
919675354 1:200376826-200376848 CAGCATGAGCAAAGGCCCTGAGG - Intergenic
919821235 1:201473502-201473524 CAGCAGGTGCAAAGGCCCTGAGG - Intergenic
920377679 1:205518012-205518034 CAGCAGGGGCAAAGGTCCTGAGG - Intronic
920501028 1:206485494-206485516 CAGGAGGAGAAAAGGATCTGGGG + Intronic
920541194 1:206779311-206779333 AAGCAGGTGGTGAGGACGTGGGG - Intergenic
920843598 1:209575509-209575531 CAGGAGGAGGAGAGTTTCTGAGG - Intergenic
920904925 1:210154307-210154329 CAGCAGGAGGTGAGCAGCAGTGG + Intronic
922192758 1:223333778-223333800 CAGCCAGGAGAGAGGACCTGGGG - Intronic
922458233 1:225794336-225794358 CAGCAGGAAGAGAGGACTCTGGG - Intergenic
922459086 1:225800969-225800991 AAGCAGGTGGTGAGGACATGAGG + Intergenic
922547355 1:226467922-226467944 GAGCAGGAGGAGAAGACCCAAGG + Intergenic
922574566 1:226653327-226653349 CAGCAGGATGAGGGGACAAGAGG + Intronic
922588477 1:226753873-226753895 CAGCCAGAGTAGAGGCCCTGAGG + Intergenic
922663774 1:227451915-227451937 CAGCAGGTGGAGGGGAGCCGAGG + Intergenic
922891182 1:229062839-229062861 CATCAAGAGGGGAGGAGCTGGGG + Intergenic
923534648 1:234839775-234839797 CAGCAGGAGGTGAGCAGCAGGGG + Intergenic
923838006 1:237635870-237635892 TAGCAGGTGCAGAGGCCCTGAGG - Intronic
924592648 1:245418212-245418234 AAGCCGGAGGAGAGGCTCTGCGG + Intronic
1062843077 10:686299-686321 CCGCAGGTGGAGAGGCCGTGAGG - Intronic
1064001153 10:11664663-11664685 CTGGAGGAGGAGAAGACCTCAGG + Intergenic
1064283289 10:13970318-13970340 AAGCAGGAGCAGGGGTCCTGCGG + Intronic
1065164769 10:22964405-22964427 AGGCAGGAAGAGAGGAACTGTGG - Intronic
1065711973 10:28527085-28527107 CAGCAAGAGCAAAGGTCCTGAGG - Intergenic
1065970682 10:30803841-30803863 CAGCAGGAGGGCAGCCCCTGAGG + Intergenic
1066067366 10:31772155-31772177 CAGGAGGAGGAGAGGAACATGGG - Intergenic
1066352405 10:34648671-34648693 CAGCAGGAGGTGAGCAGCAGGGG - Intronic
1067051274 10:43022784-43022806 CAGCAAGAGCACAGGCCCTGAGG + Intergenic
1067107092 10:43373703-43373725 CTGCAGGGGGAGAGGCACTGGGG - Exonic
1067794818 10:49313309-49313331 CACCATGAGCAGAGGCCCTGAGG + Intronic
1069567585 10:69474106-69474128 CAGCAGGAGCCGAGGATGTGAGG - Intronic
1069891189 10:71653361-71653383 GAGCAGAGGGAGAGGCCCTGTGG - Intronic
1069941050 10:71955555-71955577 AAGCAGGTGGTGAGGACATGCGG - Intergenic
1069941734 10:71961377-71961399 CAGCAGGAAGAGAGGACTCTGGG + Intergenic
1069953507 10:72035748-72035770 CAGCAGCCTGAGAGGACCTAGGG + Intergenic
1069993712 10:72329926-72329948 CAGCATGAGCAGAGGCCCGGAGG - Intergenic
1070277257 10:75018768-75018790 AAGCACCAGTAGAGGACCTGGGG + Intronic
1070277605 10:75022489-75022511 CTGCAGGAGTAGAGTAACTGAGG + Intronic
1070612138 10:77940669-77940691 CCTCTGGAGGAGAGGACCTCGGG - Intergenic
1070655324 10:78267221-78267243 CAGCTGGGGAAGAGGAGCTGTGG + Intergenic
1070767113 10:79063161-79063183 CAGAAGGAGGAGAGATGCTGAGG + Intergenic
1070963728 10:80516762-80516784 AGACAGGAGGAGAGGTCCTGGGG - Intronic
1071500825 10:86203265-86203287 CAGTGGGAGGAGGGGCCCTGAGG + Intronic
1071598727 10:86945758-86945780 CGGCAGGAGGCGAGGACCGGTGG - Intronic
1072015688 10:91344175-91344197 CAGCAGGAGATGAGGAGCGGTGG - Intergenic
1072407505 10:95168759-95168781 CAGCAGGAGGAGTGGGGCAGGGG + Intergenic
1073332791 10:102681613-102681635 CAGGAGGAGGAGAGGAACGTGGG + Intronic
1073839284 10:107479974-107479996 CAGCAGGAGGTGAGCAGCTAAGG - Intergenic
1074863718 10:117532754-117532776 GAGCTGGGGCAGAGGACCTGCGG + Intergenic
1075208227 10:120465349-120465371 GAGGAGGCTGAGAGGACCTGGGG + Intronic
1075654180 10:124150614-124150636 CAGCACGTGCAAAGGACCTGAGG + Intergenic
1075838889 10:125480140-125480162 CAGGAGGTGGAGAGAACCTATGG + Intergenic
1076223015 10:128749827-128749849 CTGCAGGAGCAGAGCAGCTGTGG - Intergenic
1076461008 10:130647442-130647464 CAGGAGCAGGAGTGGCCCTGTGG - Intergenic
1076569153 10:131421040-131421062 CAACAGGAGGGCAGGGCCTGAGG - Intergenic
1076651645 10:131993484-131993506 CAGCAGCAGGAGAGTGCCAGTGG + Intergenic
1076684018 10:132188566-132188588 CAGGAGGAGGAGAGGTGCAGCGG + Intronic
1076820848 10:132938857-132938879 CATCTGCTGGAGAGGACCTGAGG - Intronic
1076940965 10:133608201-133608223 CACCAGGAAGAGAGGACCCTGGG + Intergenic
1076941130 10:133609771-133609793 AAGCAGGTGGTGAGGACGTGCGG - Intergenic
1077366148 11:2162131-2162153 CAGAAGGAGGGCATGACCTGGGG + Intergenic
1077644029 11:3907766-3907788 GAGCAGGTGGAGAGGAAATGAGG - Intronic
1078068456 11:8093271-8093293 CAGCAGGAGCAAGGGCCCTGTGG + Intronic
1078131383 11:8616936-8616958 AAGCAGGAGGAGAGGCCCAGAGG + Exonic
1078458804 11:11497076-11497098 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
1078462147 11:11522187-11522209 CAGAATGAGGAGAGGTCATGTGG - Intronic
1079007618 11:16803063-16803085 GAACAGGTGGAGAGGGCCTGGGG + Intronic
1079129413 11:17738611-17738633 CAGTGGGAGGAGAGGGCCAGGGG - Intronic
1079141387 11:17812339-17812361 CAGCAGGAGGGGAGGCCCATGGG - Intronic
1080504120 11:32895247-32895269 AAGCAGGGGGAGAGGGCATGAGG - Intronic
1080684760 11:34505757-34505779 CAACAGCAGGAGAGGTCGTGAGG + Intronic
1080745553 11:35105491-35105513 CAGCAGCCAGAGAGGACCTGAGG - Intergenic
1080897112 11:36456007-36456029 CAGCAGGGGGAGAGAGGCTGAGG + Intronic
1080946179 11:36978109-36978131 CAGGAGGAGGAGAAGAGTTGCGG + Intergenic
1080974856 11:37326572-37326594 CAGCAGGTGCAAGGGACCTGAGG - Intergenic
1081634813 11:44714076-44714098 CAGCAGGTGCAAAGGCCCTGGGG + Intergenic
1081706373 11:45184148-45184170 CAGCAAGAGCAAAGGCCCTGTGG + Intronic
1081796043 11:45820650-45820672 CAGCAGGTGCAAAGGCCCTGGGG + Intergenic
1081890928 11:46542077-46542099 CCGCAGGAGGAGAGGACTGTGGG - Exonic
1083209421 11:61173771-61173793 CAAAAGGAGGAGAGGACGGGTGG - Intergenic
1083226988 11:61291440-61291462 CTGCTGGAGGAGAAGACTTGGGG + Intronic
1083865004 11:65448929-65448951 CAGCAGGAGGAGGGAAGATGGGG - Intergenic
1084038989 11:66530783-66530805 GAGTAGGAGGAGGGGACATGAGG + Intronic
1084039297 11:66532100-66532122 CTGCATGAGGAGTGGGCCTGGGG - Exonic
1084193588 11:67510401-67510423 CAGTAGGAGCAGAAGACCTTGGG - Intergenic
1084368615 11:68721286-68721308 CAGCAGGTGCAAAGGCCCTGTGG - Intronic
1084371924 11:68750725-68750747 CAGCCAGAGGAGAGGACGAGGGG + Intronic
1084671400 11:70608660-70608682 AAGCAGGGAGAGAGGCCCTGAGG - Intronic
1084684921 11:70687851-70687873 CAGCAGCAGAGGAGGGCCTGGGG - Intronic
1084981217 11:72829801-72829823 CAGCAGGAAGAAAGGCCCTGAGG + Intronic
1085117105 11:73939061-73939083 AAGCAGGTGGTGAGGACGTGAGG + Intergenic
1085117963 11:73947025-73947047 AAGCAGGTGGTGAGGACGTGAGG + Intergenic
1085265616 11:75236333-75236355 AAGCAAGAGGAGAGAAGCTGGGG + Intergenic
1085282986 11:75342795-75342817 CAGCAGGAACAAAGGCCCTGAGG + Intronic
1085392360 11:76188976-76188998 CAGAAGGAGGGGAGCGCCTGGGG + Intronic
1085456519 11:76668549-76668571 CTGCAGGAGCAAAGGCCCTGTGG - Intronic
1085960671 11:81457937-81457959 CAGCAGGAGGAGATGAGGTAGGG - Intergenic
1085985829 11:81786673-81786695 CAGAAGGAGTAGAAGACATGAGG - Intergenic
1086120865 11:83303535-83303557 CAGAAGGAGGAAAGGACCACTGG - Intergenic
1086470950 11:87109514-87109536 CAGCATGAGGAGATGAAGTGAGG + Intronic
1088152439 11:106760863-106760885 CAGAAGGAAGACAGGAACTGAGG + Intronic
1088790619 11:113223136-113223158 CAGAAGGAGGAGATGAGCTCTGG - Intronic
1088806465 11:113357915-113357937 CAACAGCAGCAGAAGACCTGTGG + Intronic
1089067402 11:115672363-115672385 CTGCAGAAGGAGAGGGCTTGGGG + Intergenic
1089342696 11:117770132-117770154 CAGCAGAAAGAGTGGTCCTGCGG + Intronic
1089496040 11:118909190-118909212 CAGCTGGAGGGGAAGGCCTGAGG + Intronic
1089565455 11:119368895-119368917 CAGCTGGAGGGGTGGAGCTGAGG + Intronic
1089608964 11:119658816-119658838 CAGCAGGAGGGGAGGAACCCAGG - Intronic
1089757076 11:120695116-120695138 CAGCAGGAGGAGAGGGCTGGGGG - Intronic
1090325905 11:125886513-125886535 AAGCAAGAGGAGAGGCCCTCAGG - Intronic
1090401478 11:126452382-126452404 CAGCAGGGTGAAAGGAACTGCGG - Intronic
1090493128 11:127183456-127183478 GAGAAGGAGGAGAGGAGGTGAGG + Intergenic
1090561628 11:127938766-127938788 AAGCAGGGGCAGAGGGCCTGGGG - Intergenic
1090959074 11:131539735-131539757 TACCAGCAGGAGAGGAGCTGGGG + Intronic
1091289281 11:134428301-134428323 CAACTGGTGGTGAGGACCTGGGG + Intergenic
1092006630 12:5075706-5075728 CGGATGGAGGAGAGGAACTGAGG - Intergenic
1092106967 12:5928147-5928169 CAGGAGGAGGAGGTGTCCTGAGG + Intronic
1092562975 12:9636133-9636155 CAGCAGGAGCAAAGGGCCTAAGG - Intergenic
1092564682 12:9651542-9651564 CAGGAGGAAGAGAGGAAGTGAGG + Intergenic
1092974992 12:13736193-13736215 CTGGAGGAGCAGAGGAGCTGAGG - Intronic
1093959894 12:25260676-25260698 CAGCAGGTGCAAAGGCCCTGAGG - Intergenic
1096806322 12:54143306-54143328 CCTAAGGAGGAGAGGACATGGGG - Intergenic
1097242301 12:57583809-57583831 CTGCTAGAGGAGAGCACCTGGGG - Intronic
1098500515 12:71187023-71187045 AAGCAGCAGGAGAAGCCCTGTGG + Intronic
1098914245 12:76240726-76240748 AAGCAGGTGGTGAGGACGTGAGG - Intergenic
1099438825 12:82675777-82675799 CAGCAAGTGGAGGGGACCAGGGG - Intergenic
1099847367 12:88044781-88044803 CAGGAAGAGGAGAGGGCATGGGG + Intronic
1100403190 12:94250091-94250113 CAGAGGGAGCAGAGGTCCTGAGG + Intronic
1101413861 12:104491962-104491984 CAGCAGGTGCAAATGACCTGAGG - Intronic
1101490505 12:105205436-105205458 CAGAGGGAGAAGAGGAGCTGTGG - Intronic
1102220117 12:111188567-111188589 CAGCAGGTGCAAAGGTCCTGAGG + Intronic
1102241942 12:111329962-111329984 CGGCAGCAGGAGAGGGGCTGGGG - Intronic
1102466133 12:113131779-113131801 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
1102477455 12:113197876-113197898 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1102587196 12:113931698-113931720 CAGCAGGTGCAAAGGCCCTGTGG - Intronic
1103716771 12:122949666-122949688 CAGCAGGAGGAGAAGACAGAGGG + Intronic
1103830524 12:123775587-123775609 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1103888639 12:124221874-124221896 CAGCAAGTGCAGAGGCCCTGAGG - Intronic
1103937557 12:124484614-124484636 CAGCAGGTGCAAAGGCCCTGGGG - Intronic
1103939984 12:124496269-124496291 CAGCAGGTGGCGTGGAGCTGTGG - Intronic
1104049507 12:125186309-125186331 GAGGAGGAGGAGAGGAGCGGAGG - Intergenic
1104051331 12:125195813-125195835 CAGCAGGTGTAAAGGCCCTGAGG + Intronic
1104072033 12:125354116-125354138 CAGGAGAGGGAGAGGACCAGAGG + Intronic
1104547623 12:129726411-129726433 CAGCAAGAGCAAAGGTCCTGAGG + Intronic
1104657178 12:130581980-130582002 CAGCAGGTGCAAAGGTCCTGAGG - Intronic
1104743654 12:131196395-131196417 CAGCAGGAGCAAAGGCGCTGGGG - Intergenic
1105211215 13:18258236-18258258 CAGCATGTGCAAAGGACCTGAGG + Intergenic
1105212189 13:18263495-18263517 CAAGAGCAGGAGAGTACCTGGGG - Intergenic
1105872627 13:24519044-24519066 AAGCAGGCGGTGAGGACATGGGG + Intergenic
1105913916 13:24894927-24894949 TGGCAGGAGGAAACGACCTGCGG + Intronic
1106237402 13:27875245-27875267 CAGCAGGGGAGGAGGAACTGTGG - Intergenic
1106717945 13:32410265-32410287 CAGAAGGATGACAGGCCCTGCGG - Intronic
1107891546 13:44918813-44918835 TAGCCGGCGGAGAGGAGCTGTGG + Intergenic
1108068991 13:46608034-46608056 AAGCAGGAGGCTGGGACCTGTGG + Intronic
1108564718 13:51684464-51684486 CAGCAGGAGGGCAGAACCTTCGG - Intronic
1108595514 13:51945421-51945443 CAGAAGGTGGAAAGCACCTGTGG - Intronic
1108637637 13:52351545-52351567 CAGCATGTGCAGAGGCCCTGAGG + Intergenic
1108935259 13:55874408-55874430 AAGCAGGCGGTGAGGACGTGGGG - Intergenic
1109369240 13:61399848-61399870 CAGCAGCAGCAGAGAATCTGGGG - Intergenic
1110527307 13:76553750-76553772 GAGCAGGAGGTGATGACCAGAGG - Intergenic
1111832138 13:93342764-93342786 CAGCAGGAAGAGAGGAAATAAGG + Intronic
1112431965 13:99358130-99358152 CAGCAGGAGTAGAGAATGTGAGG + Intronic
1113885866 13:113658113-113658135 CTGCAGGAGAAGAAGACGTGTGG - Exonic
1113910311 13:113838482-113838504 GAGCAGGAGGAGGGGACCCCGGG + Intronic
1113910374 13:113838644-113838666 CAGCAGGAGGAAGGGACCCCGGG + Intronic
1114631768 14:24163875-24163897 CAGGAGGAGGAGGGGGCCAGTGG + Exonic
1117201390 14:53393549-53393571 GAGCAGGAGGAGCAGACTTGTGG - Intergenic
1118400851 14:65378312-65378334 CACCAGGAGCAGAGGGCCAGTGG + Intergenic
1118760705 14:68878972-68878994 ATGCAGGAGGCGAGTACCTGGGG + Exonic
1118878985 14:69810296-69810318 CAGCAGGAGGAGCTGGGCTGAGG - Intergenic
1119730618 14:76948705-76948727 AAGCTGCAGGAGAGGACCAGAGG - Intergenic
1119883889 14:78124055-78124077 CAGCAGGTGCAAAGGTCCTGAGG - Intergenic
1120298550 14:82676701-82676723 CTGCAGGAGGAGAGGCCATGTGG + Intergenic
1120437526 14:84499392-84499414 CAGCACAAGGAAAGGAACTGAGG - Intergenic
1121811380 14:96894150-96894172 AAGCGGGTGGAAAGGACCTGTGG + Intronic
1121960081 14:98251488-98251510 CAGCAGGTGCAAAGGCCCTGTGG + Intergenic
1122440290 14:101727109-101727131 AAGCAGGTGGAGAGAAGCTGTGG - Intergenic
1122643253 14:103174847-103174869 CAGCAGGAAGAGAGGACTCTGGG + Intergenic
1122685895 14:103506148-103506170 CAGCACGGGGAGAGGCCCCGGGG + Intergenic
1122723245 14:103734194-103734216 CAGCTGGGGCAGAGGAGCTGGGG - Exonic
1122781709 14:104146545-104146567 CAGCAGGCACAGAGGATCTGCGG - Intronic
1122823563 14:104359080-104359102 CCCCAGGAGGAGGGGAGCTGGGG - Intergenic
1122883058 14:104698772-104698794 CAGAAGGAGGAGAGCAGCTCCGG + Intronic
1124188935 15:27554604-27554626 CAGAAGGAGAAAAGGATCTGGGG + Intergenic
1124221506 15:27853807-27853829 CAGCAGGAGGAGAGCACCAATGG + Intronic
1124341148 15:28889712-28889734 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
1125029802 15:35064799-35064821 TGCCAGGAGGGGAGGACCTGAGG + Intergenic
1126174692 15:45724645-45724667 CAGCAGCCAGAGAGGAGCTGAGG + Intergenic
1126454272 15:48844208-48844230 GAGGAGGAGGAGATAACCTGAGG - Intronic
1128678770 15:69631064-69631086 CAGAAAGAGGAGAGGAGCAGAGG + Intergenic
1129320809 15:74773650-74773672 AAGCAGGAAAAGAGGCCCTGGGG - Intergenic
1129605246 15:77021777-77021799 CAGCAGGAGCAAAGGCCCAGAGG - Intronic
1129658799 15:77541803-77541825 CGGCAGGAGGAGGGGAGCTGGGG - Intergenic
1130053356 15:80502460-80502482 CAGGAGGAGGAGAGACCCAGAGG + Intronic
1130174167 15:81550233-81550255 CAGCAGCAGGAGGGGGCCTGTGG + Intergenic
1130235169 15:82126639-82126661 CAGAAGGCCCAGAGGACCTGTGG + Intergenic
1130334375 15:82946477-82946499 CAGCAGGTGTAAAGGCCCTGAGG - Intronic
1130486796 15:84402635-84402657 CAGCTGGAGGTGAGGAGCTGGGG - Intergenic
1130584659 15:85171853-85171875 AAGCAGGTGGTGAGGACATGTGG - Intergenic
1130765964 15:86871530-86871552 TAGAAGGAGGAGAGAGCCTGAGG - Intronic
1130829940 15:87589274-87589296 CAGTAGGAGGAGAGGAGGTAGGG - Intergenic
1131047342 15:89324510-89324532 CAGCGGGAGGACAGGACCCAAGG + Intronic
1131067108 15:89441571-89441593 CAGCCTGAGGGGAGCACCTGTGG + Intergenic
1131300548 15:91195904-91195926 CATCAGGATGAGAGAACCTAGGG + Intronic
1132317846 15:100902892-100902914 CAGCAGCCAGGGAGGACCTGCGG + Intronic
1132650725 16:1020458-1020480 CTGCAGGTGGAGAGGGGCTGCGG - Intergenic
1132882420 16:2168273-2168295 CAGGAGAAGAAGAGCACCTGTGG + Intronic
1132884889 16:2178325-2178347 CAGCAGGTGGGGAGGACCCGCGG + Exonic
1133400926 16:5486369-5486391 GAGCAAGAGGAGAGGAGCCGAGG + Intergenic
1133638762 16:7696876-7696898 CAGCAGGTGCAGAGACCCTGTGG + Intronic
1133890715 16:9876402-9876424 AAGCAGGTGGTGAGGACGTGCGG - Intronic
1133989164 16:10691518-10691540 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1134104467 16:11476071-11476093 CAGCAGGTGCAAAGGCCCTGGGG + Intronic
1134830969 16:17322574-17322596 CAGCATGTGCAGAGGTCCTGAGG - Intronic
1134993643 16:18722480-18722502 GAGGAGGAGGAGAGGAGATGGGG + Intergenic
1135226479 16:20663338-20663360 AAGCAGGTGGTGAGGACATGCGG - Intronic
1135464305 16:22672140-22672162 AAGCAGGAGGAAAGGGGCTGAGG - Intergenic
1135641318 16:24122213-24122235 CAGCAGGTGCAAAGGCCCTGGGG + Intronic
1135641452 16:24123254-24123276 CAGCAGGTGCAAAGGCCCTGTGG + Intronic
1135913949 16:26586735-26586757 CAGCAGGGGCAAAGGCCCTGGGG + Intergenic
1135971366 16:27074312-27074334 AAGCAGGAGGAGAGTATCTTGGG + Intergenic
1136061064 16:27726803-27726825 CAGCAGGAGCAAAGGCCCTGCGG + Intronic
1136089963 16:27911624-27911646 CAGCAGGTGCACAGGCCCTGAGG - Intronic
1136173064 16:28499769-28499791 CGGTAGGTGGAGAGGAGCTGGGG + Exonic
1137379669 16:47985773-47985795 GAGCAGGAGGTGAGGAAATGGGG + Intergenic
1137399367 16:48140874-48140896 CAGCAGACTGAGAGGACCTCTGG - Exonic
1137755173 16:50895701-50895723 CGGCAGGAGGAAAAAACCTGAGG + Intergenic
1137934373 16:52620258-52620280 CTGCAGGTGGAGAGGAAATGGGG - Intergenic
1138573697 16:57892744-57892766 CAGCATGTGCAGAGGCCCTGGGG - Intronic
1138590830 16:57998884-57998906 TAGCAACAGGAGAGGAGCTGCGG - Intronic
1138606663 16:58094230-58094252 CAGCATGTGCAGAGGCCCTGGGG - Intergenic
1139264077 16:65623158-65623180 GAGGAGGAGGTGAGGTCCTGGGG + Intergenic
1139653345 16:68373552-68373574 CAGGAGGAGGAGAGGGTGTGGGG - Intronic
1140076235 16:71701031-71701053 CAGCAGCTGGTGAGGAACTGAGG + Intronic
1140412947 16:74752476-74752498 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
1141279350 16:82616896-82616918 CAGCAGGTGCAAAGGTCCTGAGG + Intergenic
1141376439 16:83535183-83535205 CAGCATGTGCAGAGGCCCTGGGG + Intronic
1141440225 16:84025337-84025359 CAGCAGTAGCAAAGGCCCTGAGG - Intronic
1141462107 16:84183710-84183732 CAGCATGGGGAGAGGCCCAGGGG + Exonic
1141661113 16:85442083-85442105 CAGCAGGTGCAAAGGCCCTGAGG - Intergenic
1141674576 16:85510824-85510846 CGGCAGGTGCAGAGGCCCTGAGG - Intergenic
1141894042 16:86947179-86947201 CACCAGGAGGAGGGAACATGGGG - Intergenic
1142075111 16:88113517-88113539 ACGCAGGACGTGAGGACCTGTGG + Intronic
1142338238 16:89504232-89504254 CAGCAGGAGGAGTCGCCGTGGGG + Intronic
1142690670 17:1604726-1604748 CAGCAGGAGGTGAGGGCAGGGGG - Intronic
1142744675 17:1949935-1949957 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1142850547 17:2702599-2702621 CAACAGGCGGACAGGCCCTGGGG + Intronic
1142877541 17:2861076-2861098 CAGCAGGTGCAAAGGGCCTGTGG - Intronic
1142893333 17:2959163-2959185 GAGAAGGAAGAGAGGATCTGAGG - Intronic
1143337926 17:6187418-6187440 CTGCAGGAGGAGAGGCCCTGTGG - Intergenic
1143343489 17:6232399-6232421 CAGCAGAGGGAGAGGGGCTGGGG + Intergenic
1143946804 17:10600260-10600282 CAGCAAGTGCAGAGGCCCTGGGG + Intergenic
1144754004 17:17668581-17668603 CAGCAGGTGTAAAGGTCCTGAGG - Intergenic
1144787828 17:17841649-17841671 CAGCGGGAGGGCAGAACCTGAGG - Intergenic
1144825421 17:18103101-18103123 CAGCAGGAGGAGAGGACCTGAGG - Intronic
1145993020 17:29090518-29090540 CAGGAGAAGGTGAGGACCAGGGG - Exonic
1146393312 17:32442715-32442737 CAGCAGGAGGTGAGCGGCTGGGG + Intergenic
1146588131 17:34100696-34100718 CAGTAGGAGGAGACAACCAGGGG - Intronic
1146595069 17:34161576-34161598 CAGCAGGAGGAGGAGGCCTCAGG - Intronic
1147118332 17:38319625-38319647 CTGCAGGAGCATAGGTCCTGAGG + Intronic
1147150089 17:38509478-38509500 CAGCGGGTGGAGAGGAGGTGGGG + Intronic
1147345237 17:39787950-39787972 CAGCAAGAGCAAAGGCCCTGGGG - Intronic
1147586936 17:41658214-41658236 CAGCAGGAGGGTCGGCCCTGGGG + Intergenic
1147631203 17:41933098-41933120 CAGCAGGAGGAGAATAAGTGGGG - Intronic
1147684247 17:42277136-42277158 CAGCACGTGGAAAGGATCTGGGG - Intergenic
1148105463 17:45116459-45116481 CAGCAGAAGGACAAGACCAGGGG + Intronic
1148683469 17:49487535-49487557 GAGCAGGAGCAGAGGCCATGTGG + Intergenic
1148691333 17:49528524-49528546 CAGGAGGTGGGAAGGACCTGGGG + Intergenic
1148910658 17:50940644-50940666 CAGCAAGTGCAGAGGCCCTGTGG - Intergenic
1149280421 17:55098582-55098604 CAGCAAGTGGAAAGGCCCTGAGG + Intronic
1149565909 17:57640262-57640284 CAGCAGGAGGCAAGGGCTTGCGG - Intronic
1151676607 17:75602030-75602052 CCCCAGGAGGAGAGGAACTGGGG + Intergenic
1152417016 17:80169251-80169273 CAGCAGGTGCAAAGGCCCTGGGG + Intergenic
1152463598 17:80454006-80454028 CAGCAGGTGCAAAGGCCCTGAGG + Intergenic
1152551690 17:81033599-81033621 CAGCCGGAGGAGAGGAGGCGCGG + Intergenic
1152585617 17:81188267-81188289 CAGGAGGAGCTGAGGACCTCAGG - Intergenic
1152675144 17:81636492-81636514 GAGCAGGAGGAGAGAATCAGAGG + Intronic
1152679201 17:81656937-81656959 CAGCAGGTGCAAAGGCCCTGGGG - Intronic
1152813779 17:82394994-82395016 CAGCAAGGGGAGAGGCCGTGGGG - Intronic
1153171471 18:2320836-2320858 CAATAGGTGGAGAGGCCCTGAGG + Intergenic
1153586145 18:6622719-6622741 CATCAGCAGGAGAGGAACTAGGG + Intergenic
1154343260 18:13522257-13522279 TAGCAGGAGGAGAGGTCCTTTGG - Intronic
1155071774 18:22323149-22323171 CAGGAGGAGGAGAGGGCTGGGGG + Intergenic
1155226278 18:23732238-23732260 CAGAGGGAAGAGAGGAGCTGAGG + Intronic
1156192699 18:34738108-34738130 CAGCAGAAGCAAAGGCCCTGAGG + Intronic
1157582712 18:48782677-48782699 CTGCAGGCGGACAGGTCCTGGGG + Intronic
1158330703 18:56358987-56359009 GAGCTGGAGGAGAGGCCCAGTGG + Intergenic
1159768526 18:72520488-72520510 CAGCAGGAGACCAGGACCTCAGG + Intergenic
1159855582 18:73583553-73583575 CAGCAGGAGAAGCCTACCTGTGG + Intergenic
1159922232 18:74236871-74236893 CAGCAGGAGGTTAGGTCCTTTGG - Intergenic
1160694692 19:477856-477878 GAGCAGGACGAGAGGACAGGGGG - Intergenic
1160864593 19:1251151-1251173 CGGCCCGAGGAGAGGCCCTGGGG - Intronic
1161016863 19:1987527-1987549 CAGCAGGTGGAGAGTCGCTGGGG - Exonic
1161795050 19:6381553-6381575 CAGCAGGAGGAGGGGCCCAAGGG - Exonic
1162078584 19:8205438-8205460 CAGCTGGATGGGAGGACCTGGGG - Intronic
1162080378 19:8214445-8214467 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1162085636 19:8247338-8247360 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
1162101883 19:8343638-8343660 CAGCATGTGCAGAGGCCCTGCGG - Intronic
1162252693 19:9459657-9459679 AAGCAGGTGGTGAGGACGTGTGG + Intergenic
1162342451 19:10099670-10099692 CAGCAGGTACAAAGGACCTGAGG - Intronic
1162360710 19:10218535-10218557 CAGCAGGTGCAAAGGCCCTGGGG + Intronic
1162782305 19:13012622-13012644 GCGCAGGAGGAGAGAAACTGAGG - Intronic
1163195374 19:15715948-15715970 TAGCAGGAGGAGAGGAAATGTGG + Intergenic
1163199020 19:15749216-15749238 CAGGAGGAGGAGAGGAGAGGTGG - Intergenic
1163438896 19:17311656-17311678 CAGCAGGTGTAAAGGCCCTGGGG - Intronic
1163463694 19:17454594-17454616 GAGAAGCAGGACAGGACCTGGGG - Intronic
1163520167 19:17787468-17787490 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1163679878 19:18675069-18675091 CAGCAGGAGGCAAGAACCCGTGG - Intergenic
1163717733 19:18881685-18881707 CAGCACGTGCAAAGGACCTGTGG - Intronic
1163772263 19:19198249-19198271 CAGGAGGCTGAGAGGTCCTGGGG - Intronic
1164658156 19:29939774-29939796 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1164872232 19:31655825-31655847 GTGCAGGAGGAGCAGACCTGGGG + Intergenic
1165062238 19:33210612-33210634 CCGCACTGGGAGAGGACCTGGGG + Exonic
1165223657 19:34338655-34338677 CAGCAAGAGCAAAGGTCCTGAGG + Intronic
1165266731 19:34667445-34667467 CAGCAGCAGGGCAGGAGCTGGGG - Intronic
1165309136 19:35020015-35020037 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1165334804 19:35162245-35162267 GAGGAGGAAGAGAGGCCCTGGGG - Intronic
1165392049 19:35544505-35544527 CTGCAGGAAGGGAGGACCTGAGG - Intronic
1165394346 19:35556202-35556224 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1165642874 19:37404612-37404634 CTGCAGGAAGAGAGGAACAGAGG - Intergenic
1165862337 19:38915827-38915849 CAGCAGAAGGTGAGGGGCTGAGG - Exonic
1165949927 19:39468654-39468676 CAACAGAAGGAGAGGACCACAGG - Intronic
1165996616 19:39848469-39848491 CTCCAGGAGGACAGGACCCGGGG - Intergenic
1166008941 19:39927019-39927041 CACCAGGTGGACAGGACCAGGGG + Intronic
1166563697 19:43750293-43750315 CAGCAAGCGCAGAGGCCCTGAGG - Intronic
1166726787 19:45033331-45033353 CAGCAGGTGCAAAGGTCCTGAGG + Intronic
1166995142 19:46716502-46716524 TGGCAGGCGGAGGGGACCTGAGG + Exonic
1167041637 19:47026325-47026347 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1167135479 19:47612962-47612984 GGGCAGGAGGAGAGGGGCTGTGG + Intronic
1167139635 19:47640786-47640808 CAGCAGGTGCAAAGGTCCTGAGG + Intronic
1167297720 19:48661726-48661748 CAGCAGGAGGAGCGCGCCGGAGG - Exonic
1167312912 19:48747367-48747389 CAGTGGGAGGAGAGGACTGGGGG + Intergenic
1167472700 19:49684439-49684461 CAGGAGGAGGAGTGGAGGTGAGG + Intronic
1167479880 19:49723491-49723513 AAGCAGGTGGTGAGGACGTGCGG - Intergenic
1167586247 19:50377323-50377345 AAGCAGGTGGATTGGACCTGAGG + Intronic
1167640060 19:50676429-50676451 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1167726835 19:51220496-51220518 CAGAAGGAGGCGAGGCCATGTGG - Intergenic
1167775249 19:51550402-51550424 AACCTGGAAGAGAGGACCTGGGG - Intergenic
1168000674 19:53443516-53443538 CAGCAGGTGGTGAGGATGTGGGG + Intronic
1168073549 19:53965918-53965940 TAGCAGGCGCAGAGGCCCTGAGG + Intronic
1168285667 19:55331338-55331360 CAGCAGCCGGAGAGGAGCTGAGG - Intronic
1168324070 19:55529451-55529473 CAGCAAGTGCAGAGGCCCTGGGG + Intergenic
1168598290 19:57696556-57696578 CAGAGGGAGCAGAGGGCCTGGGG + Intronic
1168624235 19:57904269-57904291 AAGCAGGTGGAGAGGACGTGCGG - Intronic
1168651537 19:58095559-58095581 GAGCAGGAGGAGAGGGGCTGGGG - Intronic
1202699730 1_KI270712v1_random:155121-155143 AAGCACGAGGAGAGCAGCTGGGG + Intergenic
925027303 2:620190-620212 CCGCAGGAGGAGACGCTCTGCGG + Intergenic
925209185 2:2032551-2032573 CCGCAGGATGAGAGGCACTGGGG - Intronic
925613026 2:5719015-5719037 CAGCAGGTGCAAAGGTCCTGGGG + Intergenic
926121494 2:10243480-10243502 CATCAGGAGGGGAGGGCCCGAGG + Intergenic
926251839 2:11159305-11159327 TGGCAGGAGGAGAGTCCCTGCGG + Intronic
926796475 2:16623523-16623545 CAGTAGGAGGAGAGGTCCTTTGG - Intronic
927926844 2:27019424-27019446 CAGAAAGAGGAGAGGACATGAGG + Intronic
928155625 2:28873793-28873815 GAGCTGGAGGAGATCACCTGTGG - Intergenic
928407328 2:31024493-31024515 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
929555934 2:42925664-42925686 CAGCAGGAGGGGAGCAAATGTGG + Intergenic
930077494 2:47418913-47418935 CAGCAAGCGGGGAGGGCCTGTGG + Intronic
930092102 2:47538428-47538450 CAGCACGAGCAAAGGCCCTGAGG + Intronic
931196388 2:60055874-60055896 CAGCAGGTGTAAAGGCCCTGAGG + Intergenic
931196402 2:60055995-60056017 CAGAAGGAAGACAGAACCTGTGG + Intergenic
932250897 2:70242711-70242733 CAGCAGGAGGTGAGCAGCAGGGG + Intronic
933037609 2:77420155-77420177 CAACAGCTGGAGAGGACCTGAGG - Intronic
933719642 2:85389900-85389922 CAGCAGGTGGAGTAGAGCTGGGG - Intronic
933732577 2:85468692-85468714 GAGCCAGAGGAGAGGGCCTGAGG - Intergenic
933844440 2:86314213-86314235 CAGCAGGATGAGATCAGCTGTGG - Intronic
934165218 2:89288195-89288217 CAGGTGAAGGGGAGGACCTGGGG + Intergenic
934170673 2:89538609-89538631 AAGCAGGAGGAGAGCAGCTGGGG + Intergenic
934202055 2:89894267-89894289 CAGGTGAAGGGGAGGACCTGGGG - Intergenic
934280976 2:91612929-91612951 AAGCAGGAGGAGAGCAGCTGGGG + Intergenic
934769338 2:96898089-96898111 GTGTAGGAGCAGAGGACCTGGGG - Intronic
935089081 2:99876822-99876844 CAGCATGTGCAGAGGACTTGGGG - Intronic
936017793 2:108972770-108972792 CAGAAGGGGGTGAGGACCGGGGG + Intronic
936048797 2:109207055-109207077 CATTTGGAGGAGAGGGCCTGGGG + Intronic
936069548 2:109356545-109356567 AAGGAGGAGGAGGGGGCCTGTGG - Intronic
936250669 2:110866150-110866172 CAGCAGGATGTGGGGGCCTGGGG + Intronic
936525706 2:113240222-113240244 CAGCATGGGGAGAGGGCCTGGGG - Intronic
937072160 2:119072771-119072793 CAGCAGGTGCACAGGCCCTGAGG - Intergenic
938090309 2:128426833-128426855 CAGCAGGAGGAGAGGATGGGGGG + Intergenic
938146008 2:128835437-128835459 CAGCAGCAGGAGAGGGGCTCTGG - Intergenic
938316607 2:130333660-130333682 CAGGAGAAGGAGAGGACACGTGG + Intergenic
938377572 2:130818909-130818931 CAGCAGGTGCAAAGGCCCTGAGG + Intergenic
938739204 2:134214941-134214963 AAGCTGGAAGAGAGGACATGAGG - Intronic
939093820 2:137809618-137809640 GAGCAGGAAGAGAGGAAGTGGGG + Intergenic
939988335 2:148854264-148854286 TATCCGGAGGAGTGGACCTGTGG - Intergenic
939988622 2:148856072-148856094 TATCTGGAGGAGTGGACCTGTGG - Intergenic
940255539 2:151724370-151724392 CAGAAGGAGCAGAGGATCTGTGG + Intronic
942302305 2:174573649-174573671 CAGCAGGTGCAGAGGCCCTGAGG + Intronic
943159011 2:184222320-184222342 AGGAAGCAGGAGAGGACCTGTGG + Intergenic
943811416 2:192194244-192194266 CAGTAGGAGGTGAGGGGCTGAGG + Intronic
946065665 2:216985361-216985383 CTGGAAGAGGAGAGGGCCTGGGG - Intergenic
946146585 2:217735585-217735607 CAGCAGGAGCAAAGGCCCTGAGG - Intronic
946166536 2:217867723-217867745 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
946253200 2:218425930-218425952 GAGCAGGGGGAGGTGACCTGGGG + Intronic
946284430 2:218692481-218692503 CAGCAGGAGTAGGGAACCTAAGG - Intronic
946284626 2:218693717-218693739 CAGCAGGAGTATAGAACCTGAGG - Exonic
947270238 2:228326663-228326685 AAGCAGCAGGAAAAGACCTGTGG + Intergenic
947321362 2:228922769-228922791 CAGCAGGAGGTGAGCCACTGTGG - Intronic
947386228 2:229593328-229593350 CAGCAGGTGCAAAGGGCCTGAGG - Intronic
947804348 2:232954880-232954902 CAGCAGGTGCAAAGGGCCTGTGG + Intronic
947811955 2:233010427-233010449 CAGGAGGAGGAGAAGAACTGGGG - Intronic
947988143 2:234466129-234466151 CAACACGTGCAGAGGACCTGGGG + Intergenic
948034634 2:234848014-234848036 CAGCTGGGGGTGAGGACATGGGG - Intergenic
948157952 2:235799897-235799919 CAGAAGAAGAAGAGGGCCTGTGG - Intronic
948230027 2:236342675-236342697 CTGCAGCAGGAGAGGAGCGGGGG - Intronic
948377970 2:237534538-237534560 CAGCAGAAGGAGAGAAACAGTGG - Intronic
1168908411 20:1425415-1425437 CAGCAAGTGCAGAGGCCCTGGGG - Intergenic
1168948424 20:1780347-1780369 CAGCAGGAGAGAAGGACCTCAGG + Intergenic
1169389418 20:5177585-5177607 CACCATGCTGAGAGGACCTGGGG + Intronic
1169523818 20:6401463-6401485 CAGCAGAGGGTAAGGACCTGAGG + Intergenic
1170271326 20:14530107-14530129 CAGAAGGAGGAAGGGAGCTGGGG + Intronic
1170448170 20:16452106-16452128 CAACAGGAGGAGAGGGGCTCAGG + Intronic
1170456984 20:16542617-16542639 CAGCAGGTGTAAAGGCCCTGAGG + Intronic
1170625131 20:18024634-18024656 GAGGAGGAGGAGAGGAAGTGAGG - Exonic
1170638290 20:18128752-18128774 CAGGAGGAAGAGAGGAAGTGGGG + Intergenic
1170846849 20:19969378-19969400 CAGCAGGTGCAAAGGCCCTGGGG - Intronic
1170885496 20:20337151-20337173 CAGCAGAGGAAGAGGACCAGAGG + Intronic
1171100537 20:22379625-22379647 CTGGAGGATGAGAGGCCCTGGGG - Intergenic
1171226946 20:23449735-23449757 CAGCAGGAGAGGAAGTCCTGAGG - Intergenic
1171457202 20:25278779-25278801 CAGCCGGAGGGGAGGAGCCGTGG - Intronic
1172175827 20:32971186-32971208 GAGCAGGAGGTGAGGGGCTGAGG + Intergenic
1172582006 20:36055718-36055740 CAGCATGTGGAAAGGCCCTGAGG - Intergenic
1172767333 20:37357870-37357892 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1172807416 20:37622453-37622475 CAGCATGAGCAAAGGTCCTGAGG + Intergenic
1173341275 20:42154962-42154984 CATCAGCAGGAGTAGACCTGAGG + Intronic
1173441206 20:43077842-43077864 CAGCATGAGCAAAGGTCCTGAGG - Intronic
1173850367 20:46214121-46214143 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1173928802 20:46801082-46801104 CAGCAGGAGTAGAAGATATGGGG - Intergenic
1173953272 20:47010305-47010327 CAGCAGCATGAGAGGGACTGTGG - Intronic
1174087375 20:48018766-48018788 CAGCAGGTGCACAGGCCCTGGGG - Intergenic
1174102195 20:48136366-48136388 CAGGAGCAGTAGAAGACCTGGGG + Intergenic
1174128913 20:48328204-48328226 CAGCAGGTGCACAGGCCCTGGGG + Intergenic
1174317624 20:49714582-49714604 CAGCAGGTGTAAAGGCCCTGAGG + Intergenic
1174378785 20:50143281-50143303 CAAGAGGAAGAGAGGAACTGAGG + Intronic
1174478025 20:50811059-50811081 CAGCAGGTGCAAAGGCCCTGCGG + Intronic
1174514824 20:51083643-51083665 CAGCAGGTGCAAAGGCCCTGAGG + Intergenic
1174557622 20:51407067-51407089 CAGCAGGTGCAAAGGCCCTGGGG - Intronic
1174615012 20:51828875-51828897 TAACAGGAGGAGAGAAGCTGGGG + Intergenic
1174945838 20:54984269-54984291 CAGCAGAAGCAAAGGTCCTGGGG - Intergenic
1174997177 20:55583328-55583350 CAGCATGTGGGGAGAACCTGAGG - Intergenic
1175335661 20:58194260-58194282 CAACAGGAGGAGTGGAAATGTGG + Intergenic
1175741499 20:61422851-61422873 CAGCAGCAGGAGAAGCACTGAGG - Intronic
1175764038 20:61580914-61580936 CAGCAGGACCCGAGGACCTGAGG + Intronic
1175777583 20:61662970-61662992 GGGGAGGAGGAGAGGCCCTGAGG - Intronic
1175841106 20:62028066-62028088 CTGCAGGAGCAGAGCACGTGTGG - Intronic
1175999325 20:62825036-62825058 CAGCAGCTGGGGAGGAGCTGGGG + Intronic
1176143814 20:63556752-63556774 GAGCAGGAGCAGAAGGCCTGGGG - Intergenic
1176191000 20:63809496-63809518 CAGCAGGTGGAGAGGACTCCGGG + Intronic
1176795942 21:13371416-13371438 GAGCAGTAGGAGGGTACCTGTGG - Intergenic
1177274039 21:18883956-18883978 CAGCAGGAGGTGAGCAGCAGAGG - Intergenic
1177387271 21:20424924-20424946 CAGCAGAAGCAGAGTACCTTTGG - Intergenic
1177529735 21:22343642-22343664 CAGCATGAGGAAATGACATGAGG - Intergenic
1177807151 21:25885571-25885593 CAGCAGCAGGAAATGATCTGAGG + Intronic
1178390411 21:32193175-32193197 CAGCAAGAGGTGAGGGCATGAGG + Intergenic
1178664379 21:34533878-34533900 CAGCAGGTGTGGAGGCCCTGAGG + Intronic
1178889434 21:36508991-36509013 CAGCAGGAAGAAAGGGCCAGCGG - Intronic
1179030971 21:37719111-37719133 CAGGAGGAGGAGAGGGTGTGGGG + Intronic
1179401635 21:41089879-41089901 CAGCAGGAGGTGTGGAGCTGGGG - Intergenic
1179874130 21:44259020-44259042 CAGCTGGGGGAGAGAACTTGAGG + Intronic
1179910006 21:44442520-44442542 GAGCAGGAGGCGGGGACGTGGGG + Exonic
1180006728 21:45026114-45026136 CCGCAGGGAGAGAGGACCTCAGG - Intergenic
1180127568 21:45802682-45802704 CATGGGGAGGAGAGGCCCTGAGG + Intronic
1180184263 21:46131685-46131707 CAGCAGGTGGACAGGGCCTGGGG + Intronic
1180230956 21:46426570-46426592 TGGCAGGAGGAGAGGCCCTGGGG - Intronic
1180609144 22:17084762-17084784 CAGCGGGAGGAGCGCACCTGGGG + Intergenic
1180765021 22:18341201-18341223 CAGCATGTGCAAAGGACCTGAGG - Intergenic
1180814008 22:18778483-18778505 CAGCATGTGCAAAGGACCTGAGG + Intergenic
1181159944 22:20953902-20953924 CACCCAGAGGAGAGCACCTGGGG + Intergenic
1181200193 22:21212818-21212840 CAGCATGTGCAAAGGACCTGAGG + Intronic
1181461394 22:23088254-23088276 CAGCAGGAGGAAACGCACTGGGG - Intronic
1181524000 22:23468285-23468307 CAGCAGGAGGCCAGGACCAGAGG - Intergenic
1181529892 22:23511472-23511494 CAGCAGGAGGAGAGGGCTCTGGG - Intergenic
1181701544 22:24624141-24624163 CAGCATGTGCAAAGGACCTGAGG - Intronic
1181971722 22:26695666-26695688 CAGCAGGAGCAAAGGCCCTGAGG + Intergenic
1182022075 22:27089836-27089858 CAGCAGGTGCAAAGGGCCTGAGG + Intergenic
1182053003 22:27327649-27327671 CAGCAGGTGCAAAGGCCCTGAGG + Intergenic
1182334629 22:29575564-29575586 GAGCAGGAAGAGAGGGCTTGGGG - Intronic
1182356163 22:29723116-29723138 CAACATGAGGGGAGGCCCTGCGG + Intronic
1182610202 22:31541131-31541153 CATCAGGAGGCGAGGAGCTGTGG - Intronic
1182718179 22:32376680-32376702 CAGCAGGAGGACAGGAGCCATGG - Intronic
1183075727 22:35425742-35425764 AAGCAGGACGGGAGGACCTTGGG - Intergenic
1183363326 22:37394306-37394328 CAGAGGGAGGGGAGGACCTTGGG - Intronic
1183587126 22:38759321-38759343 CAGGAGTAGGAGAGGCCTTGGGG - Intronic
1183605140 22:38863661-38863683 CAGCAGAAGCAGACCACCTGTGG + Exonic
1183669546 22:39264451-39264473 CAGCAGGTGCAAAGGCCCTGTGG + Intergenic
1183823474 22:40366141-40366163 AAGCAGGAGGAAAGAAGCTGTGG + Intronic
1183948740 22:41340961-41340983 CAGGAGTAGGAGAGGATGTGTGG + Intronic
1184077525 22:42191858-42191880 CAGCAGGAGTAGGAGACCTGCGG + Intronic
1184176393 22:42791904-42791926 CAGCAGCAGCAGAGTTCCTGAGG - Intergenic
1184380760 22:44143653-44143675 CAGGAGGCAGCGAGGACCTGTGG - Intronic
1184381410 22:44147064-44147086 CAGCAGGAGCAAAGGCTCTGAGG + Intronic
1184406260 22:44302653-44302675 CAGCAGGGGCAAAGGCCCTGGGG + Intronic
1184406274 22:44302693-44302715 CAGCAGGGGCAAAGGCCCTGGGG + Intronic
1184406288 22:44302733-44302755 CAGCAGGGGCAAAGGCCCTGGGG + Intronic
1184406302 22:44302773-44302795 CAGCAGGGGCAAAGGCCCTGGGG + Intronic
1184406316 22:44302813-44302835 CAGCAGGGGCAAAGGCCCTGGGG + Intronic
1184406330 22:44302853-44302875 CAGCAGGGGCAAAGGCCCTGGGG + Intronic
1184406344 22:44302893-44302915 CAGCAGGGGCAAAGGCCCTGGGG + Intronic
1184414815 22:44346135-44346157 CAGGATGATGAGAGGTCCTGAGG + Intergenic
1184539095 22:45107878-45107900 CAGCAGGTGCAAAGGCCCTGGGG - Intergenic
1184741365 22:46430640-46430662 CTGCTGGAGGACAGGACCAGAGG + Intronic
1184855018 22:47142120-47142142 CAGTAGGAAGATGGGACCTGTGG + Intronic
1184901232 22:47447858-47447880 CAGCAGGTGCAAAGGCCCTGTGG + Intergenic
1184926754 22:47647045-47647067 CAGCAGGCAGTGAGGACCTAAGG - Intergenic
1185027645 22:48424833-48424855 CACCAGGAGGAGAGAATCTGAGG + Intergenic
1185281064 22:49970119-49970141 CAGCAGGTGCAAAGGCCCTGAGG + Intergenic
1203226644 22_KI270731v1_random:82106-82128 CAGCATGTGCAAAGGACCTGAGG - Intergenic
1203264107 22_KI270734v1_random:4170-4192 CAGCATGTGCAAAGGACCTGAGG + Intergenic
949529043 3:4935534-4935556 CAGCAGGAGCAAAGGCCCAGAGG - Intergenic
949787953 3:7762249-7762271 CAGCAGAAGGAAAGGGCGTGGGG - Intergenic
950427373 3:12931745-12931767 CAGCAGGTGGATGGGACCCGAGG + Intronic
950566195 3:13771078-13771100 CAGCAGGGGCAAAGGCCCTGAGG - Intergenic
950591038 3:13935818-13935840 CAGGAGGAGGAGAGGAGGAGGGG + Intergenic
950694426 3:14687462-14687484 CAGCACAACTAGAGGACCTGTGG - Intronic
951252093 3:20405676-20405698 GAGCAGATGGAGAGGTCCTGTGG - Intergenic
951505091 3:23436091-23436113 CAGCAGGAGGTGAGCGGCTGGGG - Intronic
951744396 3:25961231-25961253 GGGCCGCAGGAGAGGACCTGGGG + Intergenic
952954515 3:38548904-38548926 CAGCAGCTGAAGAGGTCCTGGGG + Exonic
952967530 3:38630527-38630549 GAGGAGGAGGAGAGGGGCTGAGG + Intronic
953207955 3:40848591-40848613 CACCAGGAGGATTGGATCTGGGG + Intergenic
953409579 3:42682883-42682905 CAGCTGGAGCAAAGGTCCTGAGG - Intergenic
953718433 3:45335336-45335358 GAGCAGGAGCAAAGGCCCTGAGG + Intergenic
953916993 3:46926631-46926653 CGGCAGGGCGAGAGGTCCTGGGG + Intronic
953928876 3:46996265-46996287 CAGCAGGAGGAGAAAGGCTGTGG - Exonic
954199716 3:49017064-49017086 CAGCAGGTGCAGAGGCTCTGGGG - Intronic
954283617 3:49602209-49602231 CAGCAGGTCAAGAGGACCTGAGG - Intronic
954428662 3:50457554-50457576 CAGCTGGACCAGAGCACCTGGGG - Intronic
954632986 3:52056852-52056874 CTGCGGGAAGAGAGGCCCTGGGG + Intergenic
954635628 3:52069333-52069355 CAGCAGGTGCAAAGGCCCTGGGG + Intergenic
954801381 3:53189011-53189033 CAGCAGGAGCTGAGGTGCTGAGG - Intronic
955540741 3:59973419-59973441 CAGCATGTGCAGAGGGCCTGTGG - Intronic
955892839 3:63668367-63668389 AAGAAGGAAGAGAGGAACTGGGG + Intronic
957482049 3:80810855-80810877 CAGCAGGAGGTGAGGAGGTCGGG + Intergenic
958039221 3:88206477-88206499 CAGCATGTGGTGAGGACCTCAGG + Intergenic
958501203 3:94911290-94911312 GAGAAGGAGGAGATGACCTGAGG + Intergenic
958575655 3:95947669-95947691 AAGCAGGTGGTGAGGACATGCGG + Intergenic
959715829 3:109431623-109431645 CAGCAGCAGGAAAAGCCCTGTGG - Intergenic
959814411 3:110658474-110658496 CAGCAGAAGCAGAGAACCTGAGG + Intergenic
959897047 3:111617126-111617148 CAGCAGGTGGAGATGGGCTGAGG + Intronic
960008435 3:112806519-112806541 CACCAGGAGGAGAGGATCACTGG - Intronic
960035057 3:113093982-113094004 CAGCAAGAGCAAAGGTCCTGAGG + Intergenic
960611890 3:119562373-119562395 CAGCAGGAAGAGATGACGAGAGG + Intergenic
961125062 3:124409921-124409943 CAGAAAGAGGAGAGAGCCTGCGG + Intronic
961517329 3:127446086-127446108 CAGCAGGATGCAAGGCCCTGAGG + Intergenic
961675914 3:128566587-128566609 CAGAAGGAAGAAAGGACCAGGGG - Intergenic
961816314 3:129552404-129552426 CAGCTTGTGGAGAGGAACTGAGG + Intergenic
962028230 3:131571606-131571628 CAGCAGCAGGAGAGGTACTGTGG - Intronic
962324844 3:134424260-134424282 CAGCAGGACCTGAGGATCTGGGG - Intergenic
962346279 3:134620961-134620983 AAGCTGGAGGAGAGGTCCTGAGG + Intronic
962740616 3:138360554-138360576 CAGCAGGAGGAGTGGCGATGAGG - Intronic
963987121 3:151609181-151609203 CAGCAATAGCAAAGGACCTGAGG + Intergenic
964159681 3:153632014-153632036 CAGCAGGTAGAGAGGACCAGTGG + Intergenic
964507545 3:157415902-157415924 AAGGAAGAGGAGAGGAGCTGAGG - Intronic
965619561 3:170629354-170629376 CAGCAGGAGCAAAGGCTCTGAGG + Intronic
966943534 3:184761705-184761727 TGGCAGGAGGAGGGGACGTGTGG + Intergenic
967730985 3:192906485-192906507 CAGCAGGTGTAAAGGCCCTGAGG - Intronic
967856304 3:194120033-194120055 CAGCAGGTGCAGAGGCTCTGAGG - Intergenic
968506881 4:974811-974833 AAGCCGGAGCAGAGGCCCTGTGG + Intronic
968620180 4:1600427-1600449 CAGCAGTAGGGGAGGGGCTGAGG - Intergenic
968709346 4:2101843-2101865 GAGCAGGACGAGAGTAGCTGTGG + Intronic
968732061 4:2273861-2273883 CAGGAGGAGGAGGGGAGCTGCGG - Intronic
968917512 4:3503041-3503063 CAGCACGAGGACAGGGCGTGGGG - Intergenic
968968281 4:3780575-3780597 CTGGAGAAGGAGAGGCCCTGTGG + Intergenic
969029121 4:4197269-4197291 AAGCAGGAGGAGAGCAGCTGGGG - Exonic
969317794 4:6392554-6392576 CAGCACGAGCAAAGGCCCTGAGG + Intronic
969511573 4:7620935-7620957 CAGCAGGAGAAGGGCACTTGGGG - Intronic
969568242 4:7992761-7992783 CAGCAGGAGGAGAGGCCCCGGGG - Intronic
969586672 4:8097874-8097896 CTGCAGGAGGAGAGAGCCTGTGG + Intronic
969632412 4:8346358-8346380 CAGCGGGAGGTGAGGAGCCGCGG + Intergenic
969937491 4:10696675-10696697 CAACAGGAGGAGAAGACTTTCGG - Intergenic
973054639 4:45640700-45640722 AAGCAGGTGGTGAGGACATGAGG - Intergenic
973266482 4:48216131-48216153 CAGCAGGTGCAAAGGCCCTGGGG - Intronic
975209298 4:71680243-71680265 CAGCATGAGGAGAGGGCATCAGG + Intergenic
975613772 4:76226236-76226258 AAGCAGGTGGTGAGGACGTGTGG + Intronic
975850324 4:78565409-78565431 GAGCAGGAGCAAAGAACCTGGGG + Intronic
976356399 4:84122671-84122693 CCGCAGGAGGAGAGGCCCTGAGG - Intergenic
977874457 4:102132078-102132100 CAGCAGGTGCAAAGGCCCTGAGG - Intergenic
979389658 4:120113339-120113361 CAGCATGAGGAGATAACCTTAGG - Intergenic
980658028 4:135815324-135815346 CAGGAGGAGGAGAGAGACTGGGG - Intergenic
980875611 4:138659234-138659256 TAGCAGGAGCAGAGACCCTGAGG + Intergenic
981943117 4:150307646-150307668 ACGCAGGAGGAGATCACCTGAGG + Intronic
984758054 4:183342490-183342512 CAGCAGGAGGAAGGGAGCGGAGG - Intergenic
985537756 5:474250-474272 GACCTGGAGGAGAGGAGCTGCGG + Intronic
985537801 5:474453-474475 GACCTGGAGGAGAGGAGCTGCGG + Intronic
985669716 5:1201147-1201169 CAGCGGGAGCAGGGGCCCTGGGG - Intergenic
985679172 5:1246955-1246977 CGGCAGGAAGCCAGGACCTGCGG - Intergenic
985851072 5:2389490-2389512 CAGCAGAAGGAGGGGGCCAGAGG - Intergenic
986278720 5:6304949-6304971 CAGCAGGAGGAGAGATGGTGAGG + Intergenic
987312889 5:16697829-16697851 AAGCAGGAAGAGGAGACCTGGGG + Intronic
988501062 5:31784145-31784167 CTGCAGGAGGTGAGGACGGGAGG - Intronic
988530509 5:32023210-32023232 GAGCAGGAGGGGATGACATGAGG - Intronic
988771921 5:34440877-34440899 CAGCAGGGAGAGAGGAGATGTGG - Intergenic
988893953 5:35651391-35651413 CAGCAGGAGGAGAAGGCCTGGGG + Intronic
990052786 5:51528899-51528921 CAGCAGGAGGTGGGGAGATGGGG + Intergenic
991022013 5:61989166-61989188 AAGAAGGAGGAGAGGTCCTTGGG + Intergenic
991478281 5:67047405-67047427 CAGCAAGAGCAGAGGCCCTGAGG - Intronic
992178916 5:74177805-74177827 CAGCAAGTGCAGAGGCCCTGTGG - Intergenic
992388647 5:76310397-76310419 CAGCAGGTGCAAAGGTCCTGAGG + Intronic
992436421 5:76759759-76759781 CAGCAGCAGGGGAGGGGCTGTGG + Intergenic
992494199 5:77276237-77276259 CAGCAGGCGCAAAGGCCCTGAGG - Intronic
992663508 5:78984597-78984619 CGGCAGGCGGAGCGGTCCTGAGG - Intronic
994754834 5:103780561-103780583 CAGCTGGAGGTGGGGATCTGAGG + Intergenic
997419594 5:133755501-133755523 CAGGGGGAGGAGAGGATGTGAGG - Intergenic
997468801 5:134105173-134105195 CAGCAGGGGGACAGAGCCTGGGG - Intergenic
997919323 5:137963694-137963716 CAGCAGGAGGTGAGCAGCTGGGG + Intronic
997997185 5:138596378-138596400 CAGAAGTAGGAGTGGACCTGAGG + Intergenic
998158439 5:139799437-139799459 CAGCAAGGGGAGAGGGCATGGGG + Intronic
998415498 5:141943401-141943423 GGGCAGGGGGAGATGACCTGAGG - Intergenic
998533918 5:142911377-142911399 GAGCAGGTGGACAGGCCCTGGGG - Intronic
999127846 5:149259501-149259523 CAGCAGGAGCCGAGGACTGGCGG - Exonic
999266178 5:150268352-150268374 CAGCAGGTACAGAGGCCCTGAGG - Intronic
1000110096 5:158099935-158099957 GAGCAGGAGGGGAGGGGCTGAGG + Intergenic
1000427605 5:161111014-161111036 AGGCAGGTTGAGAGGACCTGAGG - Intergenic
1000971875 5:167723664-167723686 CAGCAGCAGCAGAGGTCTTGAGG - Intronic
1000988425 5:167886427-167886449 CAGAAGGATGAGAGGATATGTGG + Intronic
1001086482 5:168703379-168703401 CAGCAGGAGGTGAGCAGATGGGG + Intronic
1001197004 5:169682365-169682387 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1001229520 5:169973983-169974005 CAGCAGGGGGAGAGGTGGTGAGG + Intronic
1001422400 5:171597725-171597747 CAGCAGGTGCAAAGGCCCTGTGG - Intergenic
1001559373 5:172659301-172659323 CAGCCCCAGGAGAGCACCTGCGG - Intronic
1002319945 5:178369046-178369068 CAGCCAGAGGTGAGGACCTTAGG + Intronic
1002390678 5:178909395-178909417 CAGCAGGTGGTGAGGATGTGGGG - Intronic
1002448845 5:179307725-179307747 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
1002536729 5:179879964-179879986 CAGCAGCCAGAGAGGAGCTGAGG - Intronic
1002591414 5:180293323-180293345 AAGCAGGAAGAGAGGCACTGAGG + Intergenic
1003174903 6:3747137-3747159 CGGCAGGAGGAGTTGACATGGGG - Intronic
1004294958 6:14401906-14401928 CATCAGGGGGCAAGGACCTGTGG + Intergenic
1004316150 6:14589636-14589658 AAGTAGGATCAGAGGACCTGGGG - Intergenic
1004798405 6:19115747-19115769 CAGCAGGAATAGATCACCTGAGG - Intergenic
1005451959 6:25982373-25982395 AAGCAGGTGGTGAGGACGTGAGG - Intronic
1005585191 6:27269579-27269601 AAGCAGGGGGAGAGGACCATTGG - Intergenic
1005589624 6:27310767-27310789 CAGCAGGATGAAAGTAGCTGTGG + Exonic
1005767720 6:29030108-29030130 CAGGAGCAGGAGATGACTTGAGG + Intergenic
1005849817 6:29813109-29813131 CTGCAGGTGAAGAGGGCCTGGGG - Intergenic
1005944570 6:30585983-30586005 AAGCAGGCGGTGAGCACCTGAGG + Exonic
1005994760 6:30924402-30924424 GCGCAGGAGAACAGGACCTGAGG - Exonic
1006797360 6:36740319-36740341 CAGCAGGCGCAAAGGCCCTGTGG - Intergenic
1006913303 6:37578304-37578326 CAGCCGGAGCAAAGGCCCTGGGG + Intergenic
1007039655 6:38710213-38710235 AAGCAGGTGGTGAGGACATGTGG - Intergenic
1007167749 6:39840978-39841000 CTCCAGGAGGAGGGGATCTGGGG + Intronic
1007186672 6:39977743-39977765 CTCCAGGAGGAGAAGCCCTGAGG - Intergenic
1007369454 6:41416760-41416782 GAGCCGGAGGAGAGGAGCAGGGG - Intergenic
1007620069 6:43206566-43206588 GAGGAAGAGGAGAGGACCTTTGG + Intronic
1007752924 6:44081044-44081066 CAGGAGGAGGAGGGCACCGGTGG + Intergenic
1007764924 6:44154669-44154691 CTGAAGGAGGAGAGGAAATGGGG - Intronic
1007768176 6:44173407-44173429 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
1011463468 6:87630793-87630815 AAGCAGGTAGAAAGGACCTGAGG + Intronic
1011554918 6:88564147-88564169 CAGCCGGAGCAAAGGCCCTGAGG - Intergenic
1011697455 6:89925033-89925055 CAGCAAGAGGTGAGCAGCTGGGG - Intergenic
1011715056 6:90096759-90096781 CAGCAGGAGAAGAGGGCCAAGGG - Intronic
1012291061 6:97456248-97456270 CGGGAGGAGCAGAGGAGCTGTGG + Intergenic
1012291208 6:97458045-97458067 GAACAGAAGCAGAGGACCTGAGG - Intergenic
1012523970 6:100155302-100155324 CAGCAGTAGGAGGGCGCCTGTGG - Intergenic
1013151604 6:107451703-107451725 AAGCAGGTGGTGAGGACATGAGG - Intronic
1013276925 6:108594466-108594488 CAGCAGGAGGAGAGTTCCCAGGG + Intronic
1013803323 6:113970929-113970951 CAGCAGGAGGAGGAGCCCGGTGG - Exonic
1014279926 6:119430783-119430805 CAGGAGGAGGTGAGGATCTGAGG - Intergenic
1014307278 6:119758202-119758224 GAGCAGGAGGAAAGTAGCTGAGG - Intergenic
1015547315 6:134374666-134374688 CAGCAGGAGCAATGGCCCTGAGG - Intergenic
1015579155 6:134704588-134704610 CAGCAGGGGGAGAGGCCATGAGG + Intergenic
1015773478 6:136792049-136792071 CTGCAGGAGGGGAGGAGCGGCGG - Exonic
1015952103 6:138563795-138563817 CTGGAGAAGGAGAGCACCTGAGG + Intronic
1016370239 6:143366157-143366179 AAGAAGGAGGAGAGTCCCTGAGG - Intergenic
1017044774 6:150337277-150337299 CAGCATGAGGAAAGGCCCTGTGG + Intergenic
1017209418 6:151838337-151838359 CAGCAGGAAGAGAGGAGGTGGGG + Intronic
1017558949 6:155606347-155606369 GAGCAAGAGCAGAGGCCCTGAGG + Intergenic
1017718700 6:157229879-157229901 CAGCAGGTGCAGAGGCCCCGCGG + Intergenic
1017878241 6:158541465-158541487 CAGCAGGTGGAGACACCCTGGGG + Intronic
1017899002 6:158704516-158704538 TAGCAGGAGGAGACGAGGTGGGG + Intronic
1019619691 7:1985597-1985619 CAGAGGGAGGAGAGAACATGAGG - Intronic
1019892108 7:3955095-3955117 CAGCAGGAGCAGGGCACATGTGG - Intronic
1021510141 7:21426189-21426211 TGGGAGGAGGAGGGGACCTGAGG + Intergenic
1022001239 7:26228446-26228468 CAGCAGGAGGTGAGCAGCAGGGG + Intergenic
1022530386 7:31063287-31063309 CAGCAGGAGGAGAGCAGCCAGGG - Exonic
1022536254 7:31100458-31100480 CAGCAGCAGCAGAGAACATGGGG - Intronic
1022619827 7:31971726-31971748 GCTCAGGAGGAGAGGAGCTGAGG + Intronic
1023037335 7:36143630-36143652 CAGAAGCAGGAGAGGAAGTGAGG - Intergenic
1023860283 7:44214163-44214185 CAACAGGAGCAGGGGATCTGTGG - Exonic
1025205858 7:56993036-56993058 CCGCAGGAGCAGAGATCCTGAGG + Intergenic
1025227894 7:57179855-57179877 CTGCAGGAGGTGAGGACTCGGGG - Intergenic
1025666082 7:63583902-63583924 CCGCAGGAGCAGAGATCCTGAGG - Intergenic
1026444123 7:70469426-70469448 CAGCAAGAGCAAAGGCCCTGAGG + Intronic
1027162649 7:75813758-75813780 GTGCAGGAGGAAAGGACCTAGGG + Exonic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1027846953 7:83392211-83392233 CAGCTGGTAGAGAGGACATGGGG + Intronic
1029137836 7:98387198-98387220 CAGGCGGAGGAGAGGGGCTGCGG + Intronic
1029598244 7:101548975-101548997 CAGCCGGTGGAGAGGACCCTGGG + Intronic
1029659734 7:101952061-101952083 CAGCAGCATCACAGGACCTGGGG + Intronic
1029715605 7:102323801-102323823 CATCAGGAGGAAAGGACAGGAGG - Intergenic
1030423742 7:109344702-109344724 CAGATCAAGGAGAGGACCTGAGG - Intergenic
1030435996 7:109521420-109521442 CAGGAGCAGGAGAAGACTTGAGG - Intergenic
1032096034 7:128938946-128938968 CAGCAGGAGGAGAGGTCCAGAGG + Intronic
1032429119 7:131846559-131846581 CAGCAGGAAGATGGGACATGAGG + Intergenic
1032803862 7:135337422-135337444 CAGCATGAGGAGTGGACAGGAGG + Intergenic
1034256823 7:149729271-149729293 CAGCTGGAGGTGAACACCTGTGG - Exonic
1034462126 7:151203825-151203847 CATCAGAATGACAGGACCTGGGG + Intronic
1035518750 8:259149-259171 CTGCAGGGGTGGAGGACCTGAGG + Intergenic
1035694480 8:1584664-1584686 GGGCATGAGGTGAGGACCTGGGG + Intronic
1035702687 8:1648684-1648706 CAGCCAGAGAAGGGGACCTGCGG - Intronic
1035746968 8:1968065-1968087 CAGCAGCAGGAGGTGGCCTGTGG - Intergenic
1035889979 8:3332783-3332805 CAGCAGGAGGTGAGGGCATCAGG - Intronic
1036479874 8:9130188-9130210 CAGGGAGAGGAGAGGAGCTGTGG + Intergenic
1036629272 8:10499218-10499240 GGGCAGGAGGAGAGTATCTGAGG + Intergenic
1036751342 8:11445334-11445356 CTGCTGGAGGACAGGACCTGTGG - Intronic
1036796360 8:11759095-11759117 CAGCAGGGGGAAGGCACCTGGGG - Exonic
1037860113 8:22399018-22399040 CAGCAGGAAGAGCTGGCCTGGGG + Intronic
1037883006 8:22581952-22581974 CAGCTGGAAGTGAGGACTTGGGG + Intronic
1038310339 8:26441389-26441411 CAGCAGAAGGAGACGATCTCAGG - Intronic
1038372658 8:27009583-27009605 CAGCAGGAGGTGAGTGGCTGCGG + Intergenic
1038417710 8:27409375-27409397 CACCAGGAGGAAAGGACAAGGGG + Intronic
1038493522 8:27986177-27986199 CAGGCGGAGGAGAAGGCCTGGGG - Intronic
1039167992 8:34708007-34708029 CAGGAGCAAGAGAGAACCTGAGG + Intergenic
1039892984 8:41697054-41697076 CAGCAGGTGCAGCGGGCCTGGGG - Intronic
1039923390 8:41908394-41908416 CAGCAGGTGCAAAGGCCCTGAGG - Intergenic
1040481360 8:47831080-47831102 CAGCCGGAGGGCAGGACCTTGGG - Intronic
1040640345 8:49327083-49327105 CAGCAGGAGGAGAAAGTCTGAGG + Intergenic
1040701350 8:50069853-50069875 CTGCAGGAGGAGAGCAGCTTGGG - Intronic
1041566896 8:59288858-59288880 CAGCAGAAGGAGAGGCAATGTGG - Intergenic
1041671251 8:60493871-60493893 AAGCAGGTGGTGAGGACATGTGG - Intergenic
1042690992 8:71498681-71498703 CAGCAGCAGAAGAGGTCCTGAGG - Intronic
1043553546 8:81403087-81403109 CAGGAGGATGAAAGGACCTGGGG - Intergenic
1044095380 8:88057443-88057465 CCCCAGGAGAAGAGGACTTGGGG - Intronic
1044702787 8:94979310-94979332 CACCTGGAGGTGAGGACCTGGGG + Intronic
1045231229 8:100309559-100309581 CACCAGGAGGACAGGGCTTGGGG + Intronic
1045310281 8:100994998-100995020 AAGAAGGAGGATAGAACCTGGGG + Intergenic
1045426242 8:102068427-102068449 CAGCAGGTGCAGAGGCCGTGAGG - Intronic
1045752691 8:105504291-105504313 CAGCAGGAGCAGAGGAGAAGTGG + Intronic
1046616387 8:116482157-116482179 CAGCAGCAGGAGAGGGCAGGAGG - Intergenic
1046885870 8:119366382-119366404 CAGAAGGAGTAGAGGAGATGTGG - Intergenic
1047038105 8:120962093-120962115 GAGCTGGAGGAGAGGAGATGGGG - Intergenic
1047779823 8:128101911-128101933 CAGCAGGTGCAGAGAACCTGAGG - Intergenic
1048280940 8:133105332-133105354 CAGCAGTAGGGGTGGACCGGAGG + Intronic
1048335284 8:133497947-133497969 CAGCAGGTGCAAAGGCCCTGGGG - Intronic
1048455046 8:134570113-134570135 CAGCAGGTGCAGAGGCCCGGAGG - Intronic
1048610515 8:136017143-136017165 AAGCTGTAGGAGAGGACTTGTGG + Intergenic
1048635470 8:136290764-136290786 CAGTAGTGGGAGGGGACCTGGGG + Intergenic
1048973357 8:139657437-139657459 CAGGAGCCGGGGAGGACCTGTGG + Intronic
1049034318 8:140062462-140062484 CAGCTGGAGTAAAGGCCCTGGGG - Intronic
1049092942 8:140530406-140530428 CAGCAGGAAGAGGGGACCTACGG + Intergenic
1049097542 8:140557862-140557884 CAGAAGGACGAGAGGGCCTGTGG - Intronic
1049198773 8:141329744-141329766 CGGCAGGAGGCGAGGGCCTCTGG + Intergenic
1049317741 8:141978236-141978258 CAGACGGAGGAGAGGACCCGGGG - Intergenic
1049365902 8:142236745-142236767 CAACATGAGGAGAGGGACTGGGG - Intronic
1049479971 8:142817954-142817976 CAGGAGGAGGGTAGGACCTGTGG + Intergenic
1049741096 8:144241389-144241411 AAGCAGCAGGCGAGGCCCTGGGG - Exonic
1051838828 9:21371577-21371599 GAGCAGGAGGAGAGAAGCAGGGG + Intergenic
1051844418 9:21435259-21435281 GAGCAGGAGGAGAGAAGCAGGGG - Intronic
1052857908 9:33418408-33418430 CAGCAGGAAGAGGGGGCTTGAGG + Intergenic
1053107690 9:35426212-35426234 CAGGAGGAGAAGAGGAATTGGGG - Intergenic
1053107781 9:35427101-35427123 CACCAGGAGAAGAGGAATTGGGG - Intergenic
1053136684 9:35655289-35655311 CAGCAGGAGGTGAGCAGCGGAGG - Intergenic
1053293764 9:36899024-36899046 AGGCAGGAGGAGAGGGCATGAGG - Intronic
1053463063 9:38285435-38285457 CAGCAGGTGCAAAGGCCCTGGGG - Intergenic
1054783363 9:69186747-69186769 CAGCTGGAGGAAGGGACCCGTGG + Intronic
1056239964 9:84635276-84635298 CAGATGGAGGAGAGGAGATGGGG + Intergenic
1056664911 9:88573652-88573674 GAGCAGGAGGAGGGGAAATGGGG + Intronic
1056666587 9:88585915-88585937 AAGCTGGAGGACAGGACCTCCGG - Intergenic
1056676887 9:88683456-88683478 CCGCGGGAGGAGAGGCTCTGCGG - Intergenic
1056759953 9:89407305-89407327 CAGCAGGAAGAGAAGGACTGAGG - Intronic
1057517014 9:95730153-95730175 CAGCAGGAAGAAAGAAACTGCGG + Intergenic
1057942542 9:99297600-99297622 AAGAGGGAGGACAGGACCTGTGG - Intergenic
1058110208 9:101024220-101024242 AAGTAGGATGAGAGGACCAGGGG - Intergenic
1058117052 9:101096222-101096244 CAGCATCAGGAAAGGGCCTGGGG + Intronic
1058427218 9:104885395-104885417 CAGATGGAGGAGAGTACCAGAGG - Intronic
1058836378 9:108861809-108861831 CAGCAGGTGCAGAGGACTGGAGG - Intergenic
1059959042 9:119547231-119547253 CAGTAGGTGAAGAGGACTTGGGG - Intergenic
1060119415 9:120974229-120974251 CAGCAGTAGCAAAGGACATGGGG + Intronic
1060488659 9:124065655-124065677 CAGCAGGAAGAGATGGTCTGGGG + Intergenic
1060787250 9:126460465-126460487 CAGCAGAAGCAGAGCATCTGGGG - Intronic
1060962837 9:127693354-127693376 CAGCAGGAGCAGAGGAGGAGAGG - Intronic
1060993255 9:127860984-127861006 CAGCAGGTGCAAAGGCCCTGGGG - Intergenic
1061011782 9:127960237-127960259 CAGCAAGTGCAGAGGCCCTGAGG + Intronic
1061178714 9:129011915-129011937 CAGGAGGTGGAGGGGCCCTGGGG + Intronic
1061237672 9:129351976-129351998 GAGAGGAAGGAGAGGACCTGGGG - Intergenic
1061247812 9:129410071-129410093 CAGAAGGATGGGAGGACCGGAGG + Intergenic
1061370365 9:130194291-130194313 GAGCTGGAGTAGAGGAGCTGGGG + Intronic
1061372829 9:130207406-130207428 CAGCAGGGGCAGAGGCTCTGAGG - Intronic
1061475418 9:130862527-130862549 CAGCAGGTACAGAGGCCCTGAGG + Intronic
1061579121 9:131526057-131526079 CAGCAGGAGGGGCGGCCCTGGGG + Intronic
1061944156 9:133899225-133899247 GCCCAGGAGGAGACGACCTGAGG + Intronic
1185793479 X:2945266-2945288 CAGCAGGTGGGGAGGACAAGGGG + Intronic
1185839184 X:3372867-3372889 CAGCAGGTGCAAAGGACCTGGGG - Intergenic
1187013386 X:15302565-15302587 CAGGAGGAGGAGAGGCAGTGAGG + Intronic
1187272630 X:17792714-17792736 CATGGGGAGGAGAGGAGCTGGGG + Intergenic
1187827965 X:23351922-23351944 CAGAAGGTGGAAAGGACATGGGG + Intronic
1188405044 X:29797471-29797493 CAGAAGGATGAGGGGGCCTGAGG - Intronic
1188537254 X:31211180-31211202 CAGGAGGACGGGAGGACGTGAGG + Intronic
1188914592 X:35894559-35894581 CCTCATGAGGAGAGGAACTGTGG - Intergenic
1189642124 X:43084612-43084634 CAGCAGGAGGTTAGCAGCTGGGG - Intergenic
1190221475 X:48515031-48515053 CAGCAGGTGCAAAGGTCCTGAGG + Intronic
1190321813 X:49184269-49184291 CAGCAGGAGGATAGGACGCTGGG + Intronic
1191846421 X:65550863-65550885 CCGCAGGAGGAGGGCAACTGGGG - Intergenic
1192193287 X:69010487-69010509 CAGCAGCCAGAGAGGAACTGAGG - Intergenic
1193797760 X:85897605-85897627 CAGCAGGTTGAGAGGAGCAGGGG + Intronic
1195163985 X:102199107-102199129 CAACAGCAGTAGAGTACCTGTGG + Intergenic
1195194876 X:102487988-102488010 CAACAGCAGTAGAGTACCTGTGG - Intergenic
1195513372 X:105743405-105743427 CAGCAAGTGCAAAGGACCTGAGG - Intronic
1195795355 X:108641717-108641739 AAGCAGCAGGAAAGGCCCTGGGG + Intronic
1197711730 X:129676477-129676499 CAGGAGGAGGAGTGGGTCTGGGG - Intergenic
1198115994 X:133545122-133545144 CAGTAGAAGAAGAGGAGCTGAGG + Intronic
1198286265 X:135194772-135194794 AAGCAGGAGGCGAGTCCCTGAGG - Intergenic
1200244449 X:154515767-154515789 CAGCAGGAGAAGTGGACATGAGG - Exonic
1200886939 Y:8280179-8280201 CTGCAGGAGGGGGCGACCTGGGG + Intergenic
1201652563 Y:16306640-16306662 CTGCAGGAGGAGAGCTCATGTGG + Intergenic
1202369326 Y:24186495-24186517 CAGCTGGAGGTGAGGAGCTGGGG - Intergenic
1202501459 Y:25483622-25483644 CAGCTGGAGGTGAGGAGCTGGGG + Intergenic