ID: 1144825748

View in Genome Browser
Species Human (GRCh38)
Location 17:18104825-18104847
Sequence GGTGCTGCAGACGCAGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 367}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144825748_1144825757 21 Left 1144825748 17:18104825-18104847 CCTGGGGCTGCGTCTGCAGCACC 0: 1
1: 0
2: 0
3: 40
4: 367
Right 1144825757 17:18104869-18104891 GCTCTGACCTCTACTGTGAGGGG 0: 1
1: 0
2: 0
3: 14
4: 162
1144825748_1144825755 19 Left 1144825748 17:18104825-18104847 CCTGGGGCTGCGTCTGCAGCACC 0: 1
1: 0
2: 0
3: 40
4: 367
Right 1144825755 17:18104867-18104889 AGGCTCTGACCTCTACTGTGAGG 0: 1
1: 0
2: 0
3: 20
4: 139
1144825748_1144825759 23 Left 1144825748 17:18104825-18104847 CCTGGGGCTGCGTCTGCAGCACC 0: 1
1: 0
2: 0
3: 40
4: 367
Right 1144825759 17:18104871-18104893 TCTGACCTCTACTGTGAGGGGGG 0: 1
1: 0
2: 1
3: 9
4: 149
1144825748_1144825758 22 Left 1144825748 17:18104825-18104847 CCTGGGGCTGCGTCTGCAGCACC 0: 1
1: 0
2: 0
3: 40
4: 367
Right 1144825758 17:18104870-18104892 CTCTGACCTCTACTGTGAGGGGG 0: 1
1: 0
2: 0
3: 15
4: 151
1144825748_1144825751 -1 Left 1144825748 17:18104825-18104847 CCTGGGGCTGCGTCTGCAGCACC 0: 1
1: 0
2: 0
3: 40
4: 367
Right 1144825751 17:18104847-18104869 CCCTTCTTAGCCATGTGCCGAGG 0: 1
1: 0
2: 0
3: 11
4: 177
1144825748_1144825756 20 Left 1144825748 17:18104825-18104847 CCTGGGGCTGCGTCTGCAGCACC 0: 1
1: 0
2: 0
3: 40
4: 367
Right 1144825756 17:18104868-18104890 GGCTCTGACCTCTACTGTGAGGG 0: 1
1: 0
2: 1
3: 14
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144825748 Original CRISPR GGTGCTGCAGACGCAGCCCC AGG (reversed) Intronic
900001094 1:15244-15266 GGTGCTGCACACCCTGGCCCTGG - Intergenic
900020809 1:185765-185787 GGTGCTGCACACCCTGGCCCTGG - Intergenic
900129517 1:1081483-1081505 GGGGCTGCAGACACGGGCCCCGG - Intergenic
900156607 1:1205747-1205769 GGTCCTGCAGGGGCAGCTCCTGG - Intronic
900357643 1:2272444-2272466 GGAGCTGCAGACGCTGGGCCAGG - Intronic
900411973 1:2516622-2516644 GGGGCTGGAGAAGCAGCCTCTGG + Intronic
900435549 1:2629066-2629088 GGAGCTGCAGAAGCAGCGCGCGG + Intronic
900994049 1:6110730-6110752 GGTGCACCAGACACAGCCCCGGG + Intronic
901075761 1:6554045-6554067 AGGGCTGGAGAGGCAGCCCCGGG - Intronic
901187734 1:7385995-7386017 GGTGCTGCAGAAGCCCACCCTGG + Intronic
901496931 1:9627685-9627707 TGTGCAGGAGACTCAGCCCCTGG - Intergenic
901802970 1:11719796-11719818 GAGGCTGCAGACTCAGGCCCAGG + Exonic
901952912 1:12762752-12762774 GGTGCTGCAGCTGGAGGCCCTGG + Exonic
902582878 1:17419990-17420012 GCTCCTGCAGCCGCAGCGCCTGG - Intronic
902912979 1:19614785-19614807 AGTGCTGCAGACCCAGCTTCTGG + Intronic
903864661 1:26389478-26389500 GGTGTTACAAAAGCAGCCCCAGG - Intergenic
904325360 1:29724403-29724425 GGGGCTGGAGACTCAGCCCAGGG + Intergenic
904339399 1:29824460-29824482 GGAGCAGGAGACGAAGCCCCAGG + Intergenic
905022238 1:34825810-34825832 GGGGCTGCAGAGGCAGGGCCAGG + Intronic
906091451 1:43182989-43183011 GCAGCTGCAGCCACAGCCCCCGG + Intronic
906345322 1:45011010-45011032 GGCGCCGCAGGCCCAGCCCCCGG - Exonic
906380031 1:45326924-45326946 GGTGGTCCAGACGCTGCTCCTGG + Exonic
912563477 1:110566973-110566995 GGTGCTCCAGGCACAGCCCAAGG - Intergenic
914699909 1:150122500-150122522 GGTGCTCCAGGAACAGCCCCAGG - Intronic
915246320 1:154558532-154558554 GATGCAGCAGCCGCAGCCGCAGG - Exonic
920250088 1:204617677-204617699 GAGGCTGCAGAAGCACCCCCAGG + Exonic
920691409 1:208149639-208149661 GGTGCTGCTGAGGCTGACCCTGG + Intronic
922145820 1:222943127-222943149 GGTGCTGCAGGGCCAGCCTCGGG - Exonic
922866583 1:228865984-228866006 GGTGCTGCAGATGCAGGGACAGG + Intergenic
922929937 1:229381223-229381245 TGTGCTGCTGCTGCAGCCCCAGG - Intergenic
924407402 1:243763978-243764000 TGTGCTGCAGAGCCAGCCACTGG - Intronic
924949287 1:248867581-248867603 GGAGCTGCAGAGGCAGGCCTAGG - Intergenic
1064476088 10:15690449-15690471 AGTGCTGCAGTCACAGCCCTTGG + Intronic
1067062733 10:43086257-43086279 GGTGATGCAGATGAAGCGCCCGG + Intronic
1067082030 10:43217396-43217418 GGTGCTGCAGTCCCAGGCGCTGG + Intronic
1067705840 10:48605901-48605923 GGAGCTGTAGACACAGCCCTGGG - Intronic
1067720251 10:48722763-48722785 GGAGCTGCAGGCAAAGCCCCAGG + Intronic
1068589160 10:58836276-58836298 GGAGCTGCAGTAGCAGCCACAGG - Intergenic
1068763089 10:60733668-60733690 GGAGCAGCAGAGGCAGCTCCAGG + Intergenic
1068910524 10:62374420-62374442 GCTGCTGCAGCCGCCGCCTCCGG - Exonic
1069205946 10:65685855-65685877 GGTGCTGCAGTCTCTGCCTCAGG + Intergenic
1070723643 10:78773499-78773521 GGTGCTGTAGACACTGCCCATGG + Intergenic
1070735540 10:78861459-78861481 GGTGCTGCAGCTGGAGCCCAAGG + Intergenic
1070891789 10:79946611-79946633 GGTCCTGCTCACACAGCCCCTGG - Exonic
1071566245 10:86672842-86672864 GCAGCTGCATAAGCAGCCCCAGG + Intronic
1073103491 10:101019185-101019207 GGTGCTGCAGCAGCTGTCCCCGG - Exonic
1073336562 10:102714475-102714497 GGAGCTGCAGAGGCCGCCGCCGG + Intergenic
1073542201 10:104323517-104323539 GATGCTGCAGAGGTACCCCCAGG - Intronic
1074413496 10:113247501-113247523 GGGGCTGCAGAGGCACACCCTGG - Intergenic
1076995374 11:295037-295059 GGTGATGCAGGCTCAGACCCCGG - Exonic
1077117453 11:891570-891592 GGAGCTGCAGAAGCAGCCATCGG - Intronic
1078567529 11:12429343-12429365 GGTGCTGCAAATGCAGGCCTCGG - Intronic
1079098502 11:17526563-17526585 GCTGGTGCAGACACATCCCCAGG - Intronic
1080459259 11:32439079-32439101 GCTGCTACAGCCGCAACCCCAGG + Intergenic
1080873825 11:36259313-36259335 GGTGCTGTAGAGGCACCCCTGGG + Intergenic
1081793372 11:45804366-45804388 GGCGCTGCAGATGCAGCACGGGG + Intronic
1081907579 11:46679409-46679431 GGTCCTCCAGACGCTGCCCGAGG - Exonic
1082810614 11:57476963-57476985 GGGGCCGGAGCCGCAGCCCCGGG - Exonic
1083430967 11:62613299-62613321 GGGGCTGCAGGGGCAGCACCAGG - Exonic
1083474964 11:62909634-62909656 GGGGCTGCATCCTCAGCCCCAGG - Exonic
1083595133 11:63915490-63915512 GGGGCTGCAGGCCAAGCCCCGGG + Intronic
1083794070 11:65004472-65004494 GGTGCTGCAGACAGAGACCTGGG + Intergenic
1083795528 11:65014482-65014504 GGTCCTGCAGGCGCAGCGGCGGG + Intronic
1084173501 11:67411591-67411613 GGTGCAGCAGCCTCAGCCCTGGG + Intronic
1084553978 11:69864993-69865015 GGGACTGCAGAGGCAGCCGCTGG + Intergenic
1084591613 11:70093840-70093862 GGTGGTGGAGACGCAACCTCGGG + Intronic
1084678317 11:70649767-70649789 GATGCTGTACACCCAGCCCCAGG - Intronic
1085597140 11:77820546-77820568 GGTGCTGCAGGCGCCGCCGCCGG - Exonic
1088593095 11:111419983-111420005 GGTGTTGCTGACTCAGCACCAGG + Intronic
1089219221 11:116856816-116856838 AGTGCTGAAAACTCAGCCCCAGG - Intronic
1089656051 11:119947784-119947806 GGCTCTGCAGAAGCAGCCCCAGG + Intergenic
1089679142 11:120109819-120109841 TGTGCAGCAGGTGCAGCCCCTGG + Intergenic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1090979317 11:131703819-131703841 GTTGCTGCAGACCCAACACCAGG + Intronic
1091374183 12:15359-15381 GGTGCTGCACACCCTGGCCCTGG - Intergenic
1093125409 12:15322630-15322652 GGGGCTGCAGCCTCAGACCCTGG - Exonic
1102453365 12:113057110-113057132 GGCGCTGCAGGCGCGGCCCAGGG - Intronic
1103020601 12:117530981-117531003 GGTGCCGGAGACGCCGACCCGGG - Exonic
1104212863 12:126706903-126706925 GGAGTTGCAGACCCAGACCCAGG + Intergenic
1104733585 12:131122416-131122438 GGTGATCCTCACGCAGCCCCGGG - Intronic
1104769825 12:131354439-131354461 GGCGCTGGGGACACAGCCCCAGG + Intergenic
1104791999 12:131488894-131488916 GGGGCTGCAGACTGAGCCCCAGG + Intergenic
1105322793 13:19344760-19344782 GGGGCTGCTGACCGAGCCCCAGG + Intergenic
1105756103 13:23466071-23466093 GATTCGGCAGACGCAGGCCCAGG - Intergenic
1105874820 13:24541955-24541977 GGGGCTGCTGACCGAGCCCCAGG - Intergenic
1106119854 13:26851173-26851195 CTTGCTGCAGAAGCTGCCCCTGG - Intergenic
1106304191 13:28495339-28495361 GGTGCTGGCGACGCGGGCCCGGG + Intergenic
1107276761 13:38687629-38687651 GGTGTTGCAGGTGCAGCCCGGGG + Exonic
1110195272 13:72781673-72781695 GGCCCTGGAGCCGCAGCCCCAGG - Exonic
1111168173 13:84490747-84490769 GATGCTGCAGAAACAGGCCCTGG + Intergenic
1113883847 13:113647113-113647135 GGTGGGGCAGGAGCAGCCCCCGG + Intergenic
1113928258 13:113952886-113952908 GGCGGGGCAGAGGCAGCCCCCGG + Intergenic
1113952937 13:114081826-114081848 GGTGCTGCACAGGAACCCCCAGG + Intronic
1114305514 14:21419719-21419741 GGTGCTGAAGACTGTGCCCCTGG - Intronic
1115424177 14:33236068-33236090 GGTTCTGTACACCCAGCCCCAGG + Intronic
1120996914 14:90424158-90424180 GGTTGTGCAGCCTCAGCCCCAGG - Intergenic
1121636207 14:95455445-95455467 GGTCCTGCAGAGGCTGGCCCAGG - Exonic
1121981795 14:98460904-98460926 GCTGCTGAAGGGGCAGCCCCAGG - Intergenic
1122198564 14:100108138-100108160 TGTGCTGAAGGTGCAGCCCCTGG - Intronic
1122356272 14:101124755-101124777 CATGCTGCAGCCTCAGCCCCTGG + Intergenic
1122541470 14:102499948-102499970 GTGGCAGCAGAGGCAGCCCCAGG + Exonic
1122785689 14:104162406-104162428 TGTGCTGCGGACGCTGCTCCTGG + Intronic
1123051771 14:105547480-105547502 GCTGCTGCACATGCCGCCCCAGG - Intergenic
1123077186 14:105673184-105673206 GCTGCTGCACATGCCGCCCCAGG - Intergenic
1123783084 15:23645897-23645919 GGTGCAGCAGACACAGGCGCTGG - Exonic
1127581612 15:60343825-60343847 GGTCCTGCAGACTCATCCCAGGG + Intergenic
1128178503 15:65579281-65579303 GGTGCTTCTGAGGCAGCCTCAGG + Exonic
1129450141 15:75647153-75647175 GGTGCTGCACCCGCAGCTCTCGG + Intronic
1130062257 15:80578467-80578489 GCTGCTGCAGACACAGCTCAGGG - Intronic
1131119701 15:89814675-89814697 GGAGCTGCAGACCCAGCGCTTGG - Intronic
1131554169 15:93382465-93382487 GTTGCTGCAAACGTTGCCCCAGG - Intergenic
1131585183 15:93684916-93684938 TGTGCTCCACACTCAGCCCCAGG - Intergenic
1132229065 15:100168486-100168508 GGTGCTGCAGACACAGGGCTGGG + Intronic
1132286801 15:100669383-100669405 GGTGCTCCAGCAGCCGCCCCTGG - Intergenic
1132536702 16:485167-485189 TGTGCTGCAGAAGCAGCCAAAGG + Intronic
1132721140 16:1316220-1316242 CCGGCTGCAGACGCAGCCCCGGG - Intronic
1132941166 16:2509041-2509063 CGTGGTGCAGGTGCAGCCCCCGG + Intronic
1134457662 16:14406462-14406484 GGTTCTGCACACGCAGCTCACGG - Intergenic
1135345476 16:21685247-21685269 GCTGGTGCAGACGCTGCTCCAGG - Exonic
1135554527 16:23424896-23424918 GGTGCTGCTGATTCAGACCCTGG - Exonic
1136694685 16:32067030-32067052 GGTCCTGCAGACCCAAGCCCTGG - Intergenic
1136795187 16:33010292-33010314 GGTCCTGCAGACCCAAGCCCTGG - Intergenic
1136874729 16:33844090-33844112 GGTCCTGCAGACCCAAGCCCTGG + Intergenic
1137748525 16:50841364-50841386 GGTGCCGCAGTCGCAGCCGTGGG + Intergenic
1138590987 16:57999912-57999934 GGTGCTGCAGACCAAGCCAGGGG - Intronic
1139459423 16:67110025-67110047 GGTGCTGCTGCCGCTGCCGCCGG + Exonic
1139472443 16:67185360-67185382 GGCGCTGCAGGCGGAGCTCCAGG - Exonic
1139911560 16:70400443-70400465 GGTGCTGCTGACCTAGCCCCTGG + Exonic
1141555856 16:84836449-84836471 GGTCCTCCCCACGCAGCCCCGGG + Intronic
1141753922 16:85978751-85978773 GGTGGTGCAGACGCAGGAGCAGG - Intergenic
1141784424 16:86189146-86189168 GGTGCAGCCACCGCAGCCCCGGG - Intergenic
1141886439 16:86895547-86895569 TGTCCTGCAGGCACAGCCCCTGG - Intergenic
1142006018 16:87689928-87689950 GCTGCTGCGGGCGCAGTCCCCGG - Exonic
1142212644 16:88815820-88815842 GGGGCAGCAGAGGCAGCCGCAGG + Intronic
1142364942 16:89645255-89645277 GGAGCTGCAGACGCACCCGCTGG + Exonic
1142379305 16:89722434-89722456 GGCGCTGCAGGCGCTGCCCTCGG + Intronic
1142382739 16:89742906-89742928 GGTGCTGGGGAGGCAGCCTCAGG + Exonic
1203097440 16_KI270728v1_random:1271952-1271974 GGTCCTGCAGACCCAAGCCCTGG - Intergenic
1142574076 17:894699-894721 AGAGCTGCAGAGGCTGCCCCCGG - Intronic
1142766488 17:2067351-2067373 GGTGCCTCAGACGCCGTCCCAGG - Intronic
1142770773 17:2095167-2095189 GAGGCTGCAGGCTCAGCCCCTGG + Intronic
1143366872 17:6414299-6414321 GGGGTTGCAGACGCTGGCCCTGG + Intronic
1143410031 17:6703177-6703199 GGGGCTGCCCACCCAGCCCCAGG + Intronic
1144207478 17:12989249-12989271 GCTGCTGCAGCCGCCGCCCTGGG - Intronic
1144263445 17:13545610-13545632 GGTGATGCAGCCGCAGCTCCAGG - Intronic
1144684411 17:17216471-17216493 GATGATGCGGACGCAGCCCACGG + Exonic
1144825748 17:18104825-18104847 GGTGCTGCAGACGCAGCCCCAGG - Intronic
1145748922 17:27341434-27341456 AGTGATGCAGATGCAGCCCCTGG + Intergenic
1148633944 17:49132897-49132919 GGTGCTGGGGACGCAGACGCCGG + Intronic
1148863694 17:50617908-50617930 GGTGATGCAGGCCCTGCCCCAGG + Exonic
1151536484 17:74741828-74741850 GCTGCTGCAGATGTAGCCTCAGG + Intronic
1151755824 17:76074796-76074818 GTTGCAGCGGCCGCAGCCCCGGG + Exonic
1152450312 17:80374454-80374476 GGTGGTCCTGCCGCAGCCCCTGG - Exonic
1152846616 17:82604036-82604058 GGTGCTGCAGCTCCAGCACCAGG - Exonic
1153031025 18:712762-712784 GGAGCTGCAGTCCCAGCTCCGGG + Intergenic
1153805901 18:8707527-8707549 GGTGCTGCAGACGGGGTTCCCGG + Intronic
1154267357 18:12890790-12890812 TCTGCTACAGACGCACCCCCAGG - Intronic
1156630767 18:38965627-38965649 GGTGCTGAAGCTGCAGCCACTGG - Intergenic
1157718403 18:49905225-49905247 GATGATGGAGACACAGCCCCTGG - Intronic
1158530531 18:58256201-58256223 GGTGCTGGATGCGCAGGCCCGGG - Intronic
1160232060 18:77056140-77056162 GCCTCTGCAGACCCAGCCCCGGG - Intronic
1160559660 18:79748341-79748363 GGTGCAGCATTCGCAGCACCAGG + Intronic
1160701068 19:507668-507690 GGTGCTGGAGGCGCGGCCCGAGG + Exonic
1160808576 19:1003195-1003217 GGTGCTGCAGGCGCACGCCTGGG + Exonic
1160906971 19:1456132-1456154 AGTGCAGCAGACGGAGCCCCAGG + Exonic
1161069454 19:2252991-2253013 GTCGCTGCAGACGCCGTCCCTGG - Exonic
1161307690 19:3577037-3577059 GGCGCTGCAGCAGCAGCTCCAGG + Exonic
1161589646 19:5123541-5123563 GGTGCTGCAGTCCTAGCCCCCGG - Intronic
1161768821 19:6220651-6220673 CGTGCTGCACACCCAGCCCCAGG + Intronic
1162125749 19:8498754-8498776 GCTGCTGCAGCCGGAGCGCCGGG - Exonic
1162140033 19:8580305-8580327 GGTGCTACAGACCCTGCCCTGGG - Exonic
1162311989 19:9913403-9913425 GCTGCCGCCGCCGCAGCCCCCGG - Intronic
1162453611 19:10769308-10769330 GGTGCTGGAGCCGCAGGTCCTGG + Intronic
1162458098 19:10797969-10797991 GGTGCTGCAGATGAAGCCTGGGG + Intronic
1162534036 19:11252820-11252842 GGAGCTGCTGCTGCAGCCCCGGG - Exonic
1164686646 19:30170615-30170637 GGTGCTGCAGATGCAGTGTCTGG - Intergenic
1164908527 19:31986796-31986818 GGAGCTTCAGAGCCAGCCCCTGG - Intergenic
1166375147 19:42323816-42323838 GGAGCTGCTGGCGCCGCCCCTGG + Intronic
1166851948 19:45765446-45765468 GGTGCTGAAGACGCAGGGACAGG - Exonic
1166996590 19:46722496-46722518 GGTTCTGCACAAGCAGCCCCTGG + Intronic
1167353727 19:48991445-48991467 GGTGCTGCAGACGAAGGCGAAGG - Exonic
1167362227 19:49036326-49036348 GGGGCTGCAGTCTCAGACCCGGG - Intronic
1167567618 19:50266912-50266934 GGTGCTGCAGGCACGGGCCCAGG + Exonic
1167964525 19:53132502-53132524 GCAGCTGCAGCCGCAGTCCCGGG - Intronic
1168152251 19:54455499-54455521 GGTGCTGCAGGCGCGGCTGCAGG + Exonic
1168594517 19:57664507-57664529 CGGCCTGCAGCCGCAGCCCCGGG - Intergenic
1168719894 19:58549178-58549200 GTTCCTGCAGGCGCAGTCCCTGG - Exonic
925284817 2:2709035-2709057 GGGGCTGCAGACCCAGCACCTGG - Intergenic
925451337 2:3972359-3972381 GGAGCTGTGGACGCAGCCTCGGG - Intergenic
925713822 2:6767216-6767238 GGTGCTGGGGACGCTGGCCCAGG + Intergenic
925899043 2:8495463-8495485 GCTGCTTCCGACCCAGCCCCAGG + Intergenic
926224964 2:10961065-10961087 GGAGCTGCTGACTGAGCCCCGGG + Intergenic
926487042 2:13474799-13474821 GGTGATGCAGAAGCAATCCCAGG + Intergenic
927488765 2:23506634-23506656 GGGGCTGCAGCCACAGCCACGGG + Intronic
927638963 2:24834885-24834907 GGTCCTGCAGGCGCAGCCTCCGG + Exonic
927970833 2:27305664-27305686 GCTGCTGCAGGCGCTGGCCCGGG + Exonic
934503188 2:94874480-94874502 GGTGCTGCAGAGGGGGCCTCCGG + Intronic
934504035 2:94878123-94878145 GGAGATGCAGACCCAGACCCTGG + Intergenic
935187699 2:100748622-100748644 GGTGCTGCTGAGGCTCCCCCAGG - Intergenic
935290846 2:101609764-101609786 GAAGCCGCAGAAGCAGCCCCAGG - Intergenic
935681007 2:105636955-105636977 GGGGCTGCAGAGGCAGGCCCTGG - Intergenic
936254910 2:110903251-110903273 GCTACTGCAGGCGCAGCCTCTGG - Intronic
936706371 2:115079605-115079627 GGGGCTGGAGAAGCAGCCCATGG + Intronic
937221213 2:120344269-120344291 GGCCCAGCAGACGCAGCCGCTGG + Intergenic
938201355 2:129375332-129375354 GCAGCTGCAGAAGCAGCACCAGG + Intergenic
939999132 2:148949575-148949597 GGAGCTGCAGATGCTTCCCCAGG - Intronic
940098616 2:150007438-150007460 GATGCTGAAGAGGCAGCCCAGGG - Intergenic
942098603 2:172556394-172556416 GGAGCTGCGGCCGCTGCCCCAGG + Intronic
947481475 2:230504377-230504399 GGTTCTGCAAAACCAGCCCCAGG + Intronic
948116068 2:235494806-235494828 GGTGCTGCAGAACCAGATCCGGG + Exonic
948263004 2:236618067-236618089 TGAGCTGCAGAGGAAGCCCCTGG + Intergenic
948456404 2:238106510-238106532 GGAGCTGGAGAGGCAGCCCCGGG - Intronic
948502731 2:238406978-238407000 GCTGCTGCAGATGCTTCCCCAGG + Intergenic
948612131 2:239176458-239176480 GGAGCTGGAGAAGCAGCACCGGG - Exonic
948734295 2:239990023-239990045 GGTGCTGCAGACTCATCCACTGG + Intronic
948757433 2:240167649-240167671 GCTGCTGCAGAGGCCGCCCCAGG - Intergenic
948858573 2:240742084-240742106 GCTGCTGCAGAGCCAGTCCCTGG - Intronic
1170760359 20:19243785-19243807 GGTTCTGAGGACGCAGCCCCAGG + Intronic
1170845246 20:19956783-19956805 GGTCCTGCAGGCCCAGCCTCCGG + Exonic
1171182389 20:23100350-23100372 GGTCCACGAGACGCAGCCCCTGG - Intergenic
1171250523 20:23642675-23642697 GGTGCTGGAGCTGGAGCCCCAGG + Intergenic
1172529209 20:35618636-35618658 GCTGCTGCAGCTGCTGCCCCTGG - Exonic
1172619104 20:36307685-36307707 GGGGCTGCAGTTCCAGCCCCCGG + Intronic
1172965242 20:38829741-38829763 GGTGCTGCAAACACAGCAGCGGG - Intronic
1173922099 20:46753981-46754003 GATGCTTCAGCCCCAGCCCCAGG + Intergenic
1175648326 20:60695081-60695103 GGAGCAGCAGCAGCAGCCCCTGG + Intergenic
1175807932 20:61841081-61841103 GCTGCTGCAGACCCCGTCCCTGG + Intronic
1175846987 20:62064742-62064764 GGTGGTGCAGGCGGCGCCCCCGG - Exonic
1176021478 20:62964393-62964415 TGTGCTGAAGCTGCAGCCCCAGG - Intronic
1176293459 21:5058587-5058609 GGGGCTGCAGGCACAGGCCCTGG + Intergenic
1178440688 21:32595708-32595730 GTGCCTGCAGACGCTGCCCCTGG + Intronic
1179822254 21:43943699-43943721 GGGGCTGCAGCTGCACCCCCGGG + Intronic
1179863801 21:44205061-44205083 GGGGCTGCAGGCACAGGCCCTGG - Intergenic
1180069224 21:45427785-45427807 AGTCCTGCAGACCCAACCCCAGG - Intronic
1180174809 21:46082362-46082384 GGTCCTGCAGATGCAACCTCGGG + Intergenic
1180706193 22:17811464-17811486 GGGTCTGCAGAGGCAGCCGCTGG + Intronic
1180763152 22:18223836-18223858 GGCCCTGCAGAGGCAGCCCCAGG - Intergenic
1180772493 22:18400711-18400733 GGCCCTGCAGAGGCAGCCCCAGG + Intergenic
1180803873 22:18650327-18650349 GGCCCTGCAGAGGCAGCCCCAGG + Intergenic
1180806890 22:18719122-18719144 GGCCCTGCAGAGGCAGCCCCAGG - Intergenic
1180957727 22:19748387-19748409 GGTGCTGAGGACACAGTCCCGGG - Intergenic
1180971997 22:19820614-19820636 CTGGCTGCAGACGCTGCCCCAGG - Exonic
1181051459 22:20240125-20240147 GGGGCTGCAGAGGGAGCCCTGGG + Intergenic
1181091096 22:20473135-20473157 GGTGCTGGAGGAGGAGCCCCTGG + Intronic
1181217845 22:21344932-21344954 GGCCCTGCAGAGGCAGCCCCAGG - Intergenic
1181401933 22:22654840-22654862 TCTGCTACAGCCGCAGCCCCTGG + Intergenic
1181449370 22:23008195-23008217 AGTGCTGAAGAGGCAGACCCAGG - Intergenic
1181516101 22:23414732-23414754 GGAGCTGCTGGCGCAGCCCAAGG + Intergenic
1181537317 22:23553198-23553220 GGTACTGCAGAGGCAGGGCCAGG - Intergenic
1181703888 22:24635930-24635952 TCTGCTACAGCCGCAGCCCCTGG + Intergenic
1181954440 22:26578282-26578304 GGTGCAGCAGACGAAGCACACGG - Intronic
1182359795 22:29739814-29739836 GGTGCTGTGGCTGCAGCCCCGGG - Intronic
1183708174 22:39487716-39487738 GATGCTGGAGAGGCCGCCCCCGG + Exonic
1183921889 22:41176435-41176457 GGAGCTGCACACGCAGAGCCAGG + Exonic
1184232897 22:43168130-43168152 GGTGATGCAGCCGCAGATCCTGG - Exonic
1184686666 22:46099395-46099417 GACTCTGCAGACGCTGCCCCGGG + Intronic
1184729573 22:46365238-46365260 GGTGCTGTGGACGGCGCCCCTGG + Exonic
1184968448 22:47998027-47998049 GGTACTTCACACGCTGCCCCAGG + Intergenic
1185226740 22:49657750-49657772 GGAGCTCCAGCCGGAGCCCCGGG + Intergenic
1203234333 22_KI270731v1_random:141699-141721 GGCCCTGCAGAGGCAGCCCCAGG + Intergenic
950576776 3:13836901-13836923 GGTGCAGCAGTGGCAGCCCCAGG + Intronic
952884963 3:38006585-38006607 GGTGCTGCTGACGGAGCTGCTGG - Exonic
958636140 3:96750075-96750097 GCTGCTGCAGACCCAAACCCTGG + Intergenic
959071029 3:101702116-101702138 GGAACTGCAGACTCAGCCCGTGG + Intergenic
960736766 3:120789660-120789682 GGTCCTGGAGACACAGCCCTAGG - Intergenic
961443146 3:126964785-126964807 GGTGCTGCAGGCTCATGCCCTGG + Intergenic
962294459 3:134168974-134168996 TGTGCTGCAGATGCAGTCTCTGG + Intronic
965300388 3:166999713-166999735 GGAGCTGCAGAAACAGGCCCTGG - Intergenic
965675458 3:171190769-171190791 GGTGCAGGTGACTCAGCCCCTGG + Exonic
968084904 3:195869894-195869916 CCTGCTGCAGACCCAGCCCGAGG + Intronic
968893840 4:3387229-3387251 TGTGCTGCAGAAGCTGCCCAGGG + Intronic
968915860 4:3496820-3496842 GGAGCGGCAGCCTCAGCCCCAGG + Intronic
969043687 4:4321061-4321083 GATGCAGCAGACACAGCCTCAGG + Exonic
969378290 4:6777729-6777751 GGCAATGCAGAAGCAGCCCCGGG + Intergenic
969526046 4:7704617-7704639 AGTGCTGCAGCCTCAGACCCCGG - Intronic
969611868 4:8232094-8232116 GGTGCTGGAGGGGCAGCTCCTGG + Exonic
970106609 4:12592954-12592976 GGTGCTTCAGAGGAAGCCTCAGG - Intergenic
970433032 4:16006558-16006580 GGTGTTGGAGACACAGCCTCGGG + Exonic
972780137 4:42279992-42280014 TGAGCTGCAGAGGCTGCCCCAGG - Intergenic
979679473 4:123443959-123443981 GGTGCAGCAGAAGTAGCTCCTGG + Intergenic
980033311 4:127855605-127855627 AGTGCTGCATAGGCAGGCCCAGG - Intergenic
981531846 4:145761459-145761481 GGAGCTGGAGACGCACACCCGGG - Exonic
982068498 4:151674922-151674944 GTGTCTGCAGACGCAGACCCAGG - Intronic
982565910 4:156986491-156986513 GATGCTGCAGACCCCACCCCTGG - Intergenic
984466174 4:180101777-180101799 GTTGCTGGAGCTGCAGCCCCTGG + Intergenic
985530212 5:429585-429607 GGCGCTGCAGGCCCAGGCCCTGG + Intronic
985622700 5:963785-963807 GGGGCTCCAGACGCAGCAGCTGG + Intergenic
985694395 5:1331690-1331712 CTGGCTGCAGACACAGCCCCGGG - Intronic
985749674 5:1667163-1667185 AGGGCGGGAGACGCAGCCCCGGG - Intergenic
985784937 5:1888386-1888408 GGGGCTGCAGACGCGCCCCCTGG + Intergenic
985908211 5:2858180-2858202 GGTGCTGCAGTCTCAGCTCCAGG - Intergenic
986273299 5:6252739-6252761 GCTGCTGGAGACGCAACACCAGG - Intergenic
986807996 5:11326913-11326935 GGTGATGCAGAGGCATCTCCTGG + Intronic
990554909 5:56923092-56923114 GGTGCTGCACACGCAGTTCCGGG + Exonic
997763988 5:136480854-136480876 GGTGCTTCAGAGGCAGACACAGG - Intergenic
997792038 5:136770044-136770066 GGCACTCCAGAGGCAGCCCCGGG + Intergenic
997859365 5:137402591-137402613 GGGGTTGCAAAAGCAGCCCCCGG + Intronic
999062846 5:148654248-148654270 GGTCCTGCGCCCGCAGCCCCTGG - Intronic
999205226 5:149842829-149842851 GGTGCTGCAGAGGAAGCACAGGG - Intronic
999293344 5:150441916-150441938 GGGGCTGCAGTCGCAGCTTCAGG + Intergenic
1001644473 5:173269868-173269890 GAGGCTTCAGATGCAGCCCCAGG + Intergenic
1002105417 5:176877415-176877437 GGTCCTGCAGCCCAAGCCCCTGG + Intronic
1002337452 5:178489670-178489692 GGTGCAGCAGATGCAGCCACCGG + Intronic
1002674263 5:180897564-180897586 GGGGCCCCAGACTCAGCCCCAGG - Intergenic
1002691276 5:181052637-181052659 GGTGCTGTCGGCGCTGCCCCCGG + Intronic
1003133978 6:3418795-3418817 GGTGTTGCAGGCGGATCCCCAGG - Intronic
1003274404 6:4637013-4637035 GGCTCTGCTGAAGCAGCCCCGGG - Intergenic
1003974979 6:11333810-11333832 GGGCATGCAGACACAGCCCCAGG - Intronic
1004268277 6:14169155-14169177 GGTGCTGGAGATACAGCCCCTGG - Intergenic
1004365142 6:15006489-15006511 GGAGCTGCCAACCCAGCCCCTGG + Intergenic
1006110604 6:31742590-31742612 GGTGCTTCAGATTCAGCCCTGGG + Intronic
1006977397 6:38115894-38115916 GGTGCAGCAGCAGCAGCACCAGG - Intronic
1007610086 6:43143568-43143590 GCGGCTGCAGAAGCAGCCCGAGG + Exonic
1011194686 6:84768832-84768854 GGTGCTGCAGATGCAAACCCAGG + Intergenic
1011603630 6:89081494-89081516 GGGGCTGCAGACCCTGCACCCGG + Intronic
1013318025 6:108960081-108960103 GGTGCTTCTGAAGCACCCCCAGG - Intronic
1016965723 6:149717620-149717642 GGTGCTGCAGGAAGAGCCCCAGG - Intronic
1017806610 6:157951945-157951967 GGTGCCGCAGATGCAGCGTCTGG - Intergenic
1017908225 6:158771278-158771300 GGTGCAGCAGATGAAGGCCCAGG - Exonic
1017996983 6:159540818-159540840 GCAGCTCCAGACGCAGCTCCCGG + Intergenic
1019288604 7:236144-236166 GATGCTGCTGATTCAGCCCCCGG - Intronic
1019319939 7:411018-411040 GGGGCTGGAGAGGCTGCCCCGGG - Intergenic
1019319964 7:411090-411112 GGGGCTGGAGAGGCTGCCCCGGG - Intergenic
1019320026 7:411270-411292 GGGGCTGGAGAGGCTGCCCCTGG - Intergenic
1019320050 7:411342-411364 GGGGCTGGAGAGGCTGCCCCTGG - Intergenic
1019320074 7:411414-411436 GGGGCTGGAGAGGCTGCCCCTGG - Intergenic
1019320086 7:411450-411472 GGGGCTGGAGAGGCTGCCCCGGG - Intergenic
1019320123 7:411558-411580 GGGGCTGGAGAGGCTGCCCCGGG - Intergenic
1019320174 7:411702-411724 GGGGCTGGAGAGGCTGCCCCGGG - Intergenic
1019320188 7:411738-411760 GGGGCTGGAGAGGCTGCCCCGGG - Intergenic
1019320247 7:411892-411914 GGGGCTGGAGAGGCTGCCCCGGG - Intergenic
1019334320 7:475870-475892 GGTGCTGCAGCCTCATGCCCCGG - Intergenic
1019336426 7:485047-485069 GGTGCCGCAGTCCCAGTCCCAGG - Intergenic
1019400291 7:848157-848179 GGTGCTGCAGAGTAACCCCCAGG - Intronic
1019436519 7:1025098-1025120 ACTGCTGGAGACCCAGCCCCAGG + Intronic
1019651058 7:2158854-2158876 GGTGCAGCAGGTGCAGCCTCAGG - Intronic
1019691655 7:2418169-2418191 GGGGCTGCAGAGTCTGCCCCTGG + Intronic
1019909272 7:4089333-4089355 AGTGCTGCAGCCTCTGCCCCAGG - Intronic
1021230577 7:18082519-18082541 GCTCCTGCAGACTCAGCCACAGG - Intergenic
1023177675 7:37449001-37449023 GGAGTTGCAGCCGCCGCCCCCGG + Exonic
1023613148 7:41991975-41991997 AGTGCTGCAGAGGCAGCCTGGGG + Intronic
1026904924 7:74057420-74057442 GGTGCCCCAGGCGCAGTCCCAGG + Intronic
1027123262 7:75537455-75537477 GGCCCTGGAGACTCAGCCCCAGG + Exonic
1027266018 7:76495680-76495702 GGTGCTGGAGATGCAGCTACGGG + Intronic
1027317392 7:76993797-76993819 GGTGCTGGAGATGCAGCTACGGG + Intergenic
1029640238 7:101815831-101815853 GGAGCCGGAGTCGCAGCCCCAGG - Intergenic
1030676570 7:112391627-112391649 GGTGTTTCAGAGGCAGCCGCGGG - Intergenic
1032239522 7:130149927-130149949 GGTGCAGAAGAGGCAGCCGCAGG + Intergenic
1033225734 7:139560794-139560816 GCTGCTGCAGGCACAGCGCCTGG + Intergenic
1034237655 7:149585256-149585278 GCTGCTGCAGACTCACACCCTGG + Intergenic
1034240736 7:149608915-149608937 GCTGCTGCAGACTCACACCCTGG + Intergenic
1034745911 7:153523934-153523956 TGTGCTGAAGTCCCAGCCCCTGG - Intergenic
1035027172 7:155833741-155833763 GGTGGTGCAGACTCGGCCTCAGG - Intergenic
1035211244 7:157329840-157329862 GGAGGTGGAGACGCAGCACCAGG + Intergenic
1035276393 7:157750514-157750536 GCTGCTGGAGACCCAGCCCCAGG + Intronic
1035313407 7:157983709-157983731 CGTGCTGCCGACCCAGTCCCTGG + Intronic
1035785063 8:2253538-2253560 GGTGCTGCAGCCACAGGCTCTGG + Intergenic
1035807748 8:2468178-2468200 GGTGCTGCAGCCACAGGCTCTGG - Intergenic
1036691821 8:10949139-10949161 GCCCCTGCAGAGGCAGCCCCGGG - Intronic
1037988373 8:23303557-23303579 GGTGCTGCAGAGGCAGCTTCAGG + Intronic
1040481578 8:47832025-47832047 GGTGCCGCAGAGGCAGCGACCGG + Intronic
1041359283 8:57033973-57033995 TCTGCTGCTGAGGCAGCCCCTGG + Intergenic
1043142178 8:76603804-76603826 GCTGGTGCAGACGCAGCTTCTGG + Intergenic
1045653865 8:104367364-104367386 GGCGCTGCAGACGGGCCCCCTGG - Intronic
1048200523 8:132370427-132370449 GGTGCTGAGGACTCACCCCCAGG - Intronic
1048455628 8:134575678-134575700 TGTGCTCCAGAGGCAGGCCCAGG - Intronic
1049380989 8:142315654-142315676 GGGGCTGGACACGCAGCCCTGGG + Intronic
1049655460 8:143795094-143795116 GGGGCTGCAGACCCCGACCCTGG + Exonic
1049797139 8:144501972-144501994 CGTGCTGCACCCGCAGCACCAGG - Exonic
1051667658 9:19480615-19480637 AGTGCTGAAGACACAGGCCCTGG - Intergenic
1051690289 9:19705424-19705446 GGTGCTGCATGAGCAGCCCCTGG - Intronic
1053150684 9:35740872-35740894 GATGATGCAGGAGCAGCCCCCGG + Exonic
1053150702 9:35740943-35740965 GGTGGTGGAGACGATGCCCCAGG - Exonic
1053674379 9:40408919-40408941 TGTGATTCATACGCAGCCCCTGG + Intergenic
1054385486 9:64548988-64549010 TGTGATTCATACGCAGCCCCTGG + Intergenic
1054510242 9:65967371-65967393 TGTGATTCATACGCAGCCCCTGG - Intergenic
1055897401 9:81194259-81194281 AGTGCTGCAGATGCAACCCAAGG + Intergenic
1057189608 9:93079370-93079392 GGTCCTGCAGACGGTGCCCTGGG + Intronic
1057245635 9:93451978-93452000 GGAGCTGCAGAAGCTGGCCCGGG + Exonic
1057470065 9:95349430-95349452 GGCCCTGCAGAGGCAGCCCCAGG + Intergenic
1060811700 9:126614138-126614160 GCTGCTGCAGACGGAGCCGCGGG - Intergenic
1060884480 9:127140860-127140882 TGTGCTGCAGAGGCAGGCCCTGG + Intronic
1061258028 9:129464085-129464107 GAGGCTGCAGGCGCTGCCCCCGG - Intergenic
1061681560 9:132245039-132245061 GGGGCTGCAGTAGAAGCCCCTGG + Intergenic
1061707287 9:132462916-132462938 GGTGCTGGAGAGACAGACCCAGG - Intronic
1061779912 9:132989339-132989361 GGTGTTGGAGACCCAGACCCAGG - Intronic
1061990610 9:134156771-134156793 TGTGCTGCCGACTCAGACCCGGG + Intronic
1062226492 9:135455401-135455423 TGTGCTGCACAGCCAGCCCCCGG + Intergenic
1062232213 9:135487828-135487850 GGCCCTGCAGAGGCAGCCCCAGG - Exonic
1062287937 9:135781438-135781460 GCTGGAGAAGACGCAGCCCCTGG - Intronic
1062312444 9:135946200-135946222 GGAGCTGCAGACGCTCCCCAAGG + Intronic
1062366155 9:136210116-136210138 GGTGCTGCACACGAAGCCAGAGG + Intronic
1062613673 9:137386711-137386733 GGTGCTCGAGAAGCAGCCTCAGG - Intronic
1062720304 9:138038458-138038480 GGAGCTGAAGAGGAAGCCCCTGG - Intronic
1203746035 Un_GL000218v1:41138-41160 GGTGCTGCAGAGGGGGCCTCGGG - Intergenic
1203564079 Un_KI270744v1:78344-78366 GGTGCTGCAGAGGGGGCCTCGGG + Intergenic
1185643134 X:1599437-1599459 GCGGCTGCAGAGGGAGCCCCCGG - Intronic
1186781506 X:12916559-12916581 GCTCCTGCAGAGGCAGCCACAGG - Intronic
1189491316 X:41473548-41473570 GGTGCTGCAGGCGCAGGCGGCGG - Exonic
1190233365 X:48598816-48598838 GGTACTGCCGACGCAGCGCTGGG - Exonic
1190335114 X:49257511-49257533 TGTGCTGCAGGTGCACCCCCTGG - Exonic
1192630751 X:72776607-72776629 GAAGCTGCAGAGGCAGCCGCTGG + Intergenic
1192650959 X:72944197-72944219 GAAGCTGCAGAGGCAGCCGCTGG - Intergenic
1196031073 X:111096310-111096332 GCGGCCGCAGCCGCAGCCCCGGG - Intronic
1196755138 X:119150972-119150994 GGTGCTGCTGAGGGAGCCGCTGG + Intergenic
1199596484 X:149510037-149510059 GGTGCAGCAGTAGCAGCCCTAGG + Intronic
1200401912 X:156024804-156024826 GGTGCTGCACACCCTGGCCCTGG + Intergenic
1201159358 Y:11156150-11156172 GGTGCTGCAGAGGGGGCCTCTGG - Intergenic