ID: 1144826061

View in Genome Browser
Species Human (GRCh38)
Location 17:18106343-18106365
Sequence ACACCCAAAGCTCAGGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 192}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144826061_1144826064 -8 Left 1144826061 17:18106343-18106365 CCTGTGTCCTGAGCTTTGGGTGT 0: 1
1: 0
2: 2
3: 14
4: 192
Right 1144826064 17:18106358-18106380 TTGGGTGTGCAGCCAAGCTTGGG 0: 1
1: 0
2: 3
3: 19
4: 158
1144826061_1144826068 3 Left 1144826061 17:18106343-18106365 CCTGTGTCCTGAGCTTTGGGTGT 0: 1
1: 0
2: 2
3: 14
4: 192
Right 1144826068 17:18106369-18106391 GCCAAGCTTGGGATGGGGTTAGG 0: 1
1: 0
2: 0
3: 18
4: 274
1144826061_1144826066 -3 Left 1144826061 17:18106343-18106365 CCTGTGTCCTGAGCTTTGGGTGT 0: 1
1: 0
2: 2
3: 14
4: 192
Right 1144826066 17:18106363-18106385 TGTGCAGCCAAGCTTGGGATGGG 0: 1
1: 0
2: 0
3: 10
4: 149
1144826061_1144826063 -9 Left 1144826061 17:18106343-18106365 CCTGTGTCCTGAGCTTTGGGTGT 0: 1
1: 0
2: 2
3: 14
4: 192
Right 1144826063 17:18106357-18106379 TTTGGGTGTGCAGCCAAGCTTGG 0: 1
1: 0
2: 2
3: 18
4: 153
1144826061_1144826067 -2 Left 1144826061 17:18106343-18106365 CCTGTGTCCTGAGCTTTGGGTGT 0: 1
1: 0
2: 2
3: 14
4: 192
Right 1144826067 17:18106364-18106386 GTGCAGCCAAGCTTGGGATGGGG 0: 1
1: 0
2: 2
3: 12
4: 187
1144826061_1144826065 -4 Left 1144826061 17:18106343-18106365 CCTGTGTCCTGAGCTTTGGGTGT 0: 1
1: 0
2: 2
3: 14
4: 192
Right 1144826065 17:18106362-18106384 GTGTGCAGCCAAGCTTGGGATGG 0: 1
1: 0
2: 0
3: 14
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144826061 Original CRISPR ACACCCAAAGCTCAGGACAC AGG (reversed) Intronic
900189737 1:1348333-1348355 CCACAGGAAGCTCAGGACACGGG + Intronic
900205339 1:1429513-1429535 ACCCCCAAAGACTAGGACACTGG - Intergenic
900355393 1:2259447-2259469 ACCTCCACAGCTCAGGACAAAGG - Intronic
900511650 1:3063645-3063667 ACGCCCAGAGCCCGGGACACGGG - Intergenic
901096034 1:6680947-6680969 AGACCCAGAGCTCAAGTCACAGG - Exonic
901669842 1:10849793-10849815 ACTCCCAGAGCCCAGGGCACAGG + Intergenic
903681179 1:25098305-25098327 ACACACACAGCTCAGGGCACAGG + Intergenic
904399073 1:30243915-30243937 AGACACTCAGCTCAGGACACTGG - Intergenic
905272840 1:36798038-36798060 ACACTCAAAGTCCAGCACACTGG + Exonic
907222225 1:52915274-52915296 ACAGACAAAGCTGAGGACCCTGG - Intronic
907674843 1:56508864-56508886 AGAAGCAAAGCTCAGGACCCTGG - Intronic
907861293 1:58356182-58356204 GAACCCAAAGCTGAGGACAAAGG - Intronic
908432914 1:64076312-64076334 ACACACAAAGCTAAGGGCAAAGG + Intronic
910859058 1:91725562-91725584 TCACCTAAAGCACTGGACACAGG - Intronic
911101138 1:94096658-94096680 AGAACCAAAACTCAGGACACTGG - Intronic
913199988 1:116488145-116488167 TCTCACAAAGCTCAGGACAAAGG + Intergenic
915016611 1:152740018-152740040 ACACCCAGAGATCCTGACACTGG - Intronic
916501581 1:165392159-165392181 TCACCCTAAGCTCTGGGCACTGG - Intergenic
917667769 1:177241821-177241843 ACAGGCACACCTCAGGACACAGG + Intronic
923463552 1:234228494-234228516 CCACCCAAAGCTCTTGGCACAGG + Intronic
924199470 1:241643793-241643815 ACACCAAAAGCACAGGCAACAGG + Intronic
924463826 1:244282859-244282881 ACAAGCATAGCTCAGGACTCAGG + Intergenic
1063378704 10:5570605-5570627 GCACTCAAAGCCCTGGACACTGG - Intergenic
1063576890 10:7270223-7270245 CCAAGCAAAGCCCAGGACACAGG + Intronic
1067044000 10:42974438-42974460 ACACCTAGAGTTCAGGCCACAGG - Intergenic
1068962937 10:62883496-62883518 AGACTCAAAGCTCAGGATAAGGG + Intronic
1069266548 10:66465595-66465617 ACAGCCAAATCTCATGTCACTGG + Intronic
1070682424 10:78457704-78457726 AACCCCAAAGCCCAGGACAATGG - Intergenic
1073001399 10:100288695-100288717 ACACACAGAGCTAAGTACACAGG + Intronic
1074270413 10:111948002-111948024 ACAACCAACCCTCATGACACAGG + Intergenic
1074342687 10:112649281-112649303 AAACAGAAAGCTCAGGAAACTGG - Intronic
1074778330 10:116782898-116782920 ACATACCAAGCCCAGGACACAGG + Intergenic
1075314566 10:121442343-121442365 ACAACCAAAGCTGAGCTCACAGG + Intergenic
1076157586 10:128215642-128215664 ACACCCAACCCCCAGGACGCTGG - Intergenic
1076787621 10:132758871-132758893 AAACCCGACGCTCAGGAGACAGG - Intronic
1081578191 11:44332800-44332822 ACACCCAGAGCTCTGTACTCAGG - Intergenic
1084565773 11:69927917-69927939 GTATCCTAAGCTCAGGACACGGG + Intergenic
1091071841 11:132572281-132572303 ACACCAAAAGCACAGGCAACAGG - Intronic
1094278313 12:28705402-28705424 ACTCCCTAAGTTGAGGACACAGG - Intergenic
1095991188 12:48035702-48035724 CAACCCAGAGCTCAGGACACAGG + Intergenic
1102277800 12:111597506-111597528 ACTCCCGAAGTTAAGGACACCGG + Intronic
1103226680 12:119293700-119293722 TCACCCAGAGCTCAGGTCCCAGG + Intergenic
1103746876 12:123130887-123130909 ACACCCTAAGCTTAGCACCCTGG - Intronic
1103763891 12:123268840-123268862 ACATCAGAAGCTCAGGAAACTGG - Intronic
1106243281 13:27926795-27926817 CCTCCCAAAGCTGAGGACGCAGG + Intergenic
1109252613 13:60038077-60038099 AAACCCAAAACTCAGGATAGTGG + Intronic
1110124339 13:71923716-71923738 ACATCCAAATCTCAAGACTCTGG + Intergenic
1111496150 13:89053502-89053524 ACACTCAAAGCTCTGGCCACTGG + Intergenic
1113327097 13:109293051-109293073 ATACCCTAAGCCAAGGACACAGG + Intergenic
1114191210 14:20440700-20440722 ACAGCCAAAGTTGAGGGCACAGG - Intergenic
1114244566 14:20900586-20900608 ACAATCACAGCTCTGGACACTGG + Intergenic
1114247557 14:20928729-20928751 ACAATCACAGCTCTGGACACTGG + Intergenic
1120946411 14:90001932-90001954 TCACCTGAAGCTCATGACACAGG - Intronic
1121445091 14:93973725-93973747 ACACTCACAGCTCAGGACACAGG + Intronic
1121739134 14:96239155-96239177 TCACCCACAGCACAGGGCACTGG + Intronic
1121922232 14:97892815-97892837 ACAGCCAGATCTCAGGTCACTGG - Intergenic
1122272476 14:100574350-100574372 AGACCCAGGGCTCAGGTCACAGG - Intronic
1122689858 14:103527082-103527104 ACCCCCAAAGCTCAGCACTGAGG - Intergenic
1122720679 14:103720540-103720562 AGAACCAAGTCTCAGGACACAGG - Intronic
1124466592 15:29945551-29945573 AAACCCAATGCCCAGGATACTGG + Intronic
1127187596 15:56495276-56495298 ACACCCTACACTCAGCACACAGG + Intergenic
1128938901 15:71771003-71771025 AGACCAATAGCTCAGCACACTGG - Intronic
1130024342 15:80258545-80258567 ACTCCCAAAGTTCAAAACACAGG + Intergenic
1131681992 15:94733254-94733276 ACACCCACTGGCCAGGACACAGG + Intergenic
1132676835 16:1124501-1124523 GCAACCAAAGCCCAGGCCACCGG + Intergenic
1134292151 16:12910432-12910454 ACAGCCAAATATCAGGAGACAGG + Intronic
1136131592 16:28225366-28225388 AGTCCCAAAGGTCAGGCCACAGG - Intergenic
1136266338 16:29121651-29121673 ACATCCAAGACACAGGACACAGG + Intergenic
1137522608 16:49207910-49207932 GCAGCCAAACCCCAGGACACAGG - Intergenic
1137923993 16:52522283-52522305 ACAGCCAAATGTCAGGCCACAGG + Intronic
1138346702 16:56324644-56324666 GCACCCAAAGCCCAGGCCCCAGG + Intronic
1141273822 16:82566377-82566399 ACAACCAAAGCTAGTGACACTGG - Intergenic
1141433284 16:83981875-83981897 ACTCCCAAAGCTCAGGGTGCTGG - Intronic
1142279977 16:89142811-89142833 ACACCCACACCTAAGGAGACGGG + Intronic
1143256095 17:5559129-5559151 ACACCCAGGGCACAAGACACAGG + Exonic
1143852066 17:9820530-9820552 ACACTTAAAGCACAAGACACAGG + Intronic
1144826061 17:18106343-18106365 ACACCCAAAGCTCAGGACACAGG - Intronic
1144847576 17:18227909-18227931 ACCCCCTAAGCTCAGGAATCAGG - Intronic
1150248641 17:63693999-63694021 CCACGCTGAGCTCAGGACACTGG - Exonic
1158679661 18:59555903-59555925 AAACCCACAGCTCAGGAGATTGG + Intronic
1159167232 18:64719285-64719307 CCCCCCAAATCTCAGGAGACTGG + Intergenic
1159256944 18:65958883-65958905 CCACCCACAGCTAAGGCCACAGG - Intergenic
1160038627 18:75323014-75323036 ACGCCCAGAGCTCAGAACAGTGG - Intergenic
1160508185 18:79438787-79438809 ATACCCCAAGCTCAGGACGCAGG + Intronic
1162727544 19:12699160-12699182 ACTACCAAAGCCAAGGACACAGG + Intergenic
1163453367 19:17391944-17391966 CCACACAAAGCTCAGGACACAGG - Intergenic
1164626719 19:29734185-29734207 CCACCCAAAGCTGTGGACACAGG + Intergenic
1164772538 19:30821193-30821215 AGACCCAAAGACCAGGAGACAGG - Intergenic
1168020942 19:53608254-53608276 ACACCCACAGGTGAGGGCACAGG - Intergenic
926112380 2:10191666-10191688 ACAGCCAGGGCTCAGGACCCAGG + Intronic
926301214 2:11604389-11604411 ACACCTAAAGCTTTGGAAACAGG + Intronic
927554269 2:24021520-24021542 ACAACCCAAGCCCAGGACGCTGG - Intronic
929346679 2:40892576-40892598 ATACCCAAAATTCAGAACACTGG + Intergenic
931240358 2:60446803-60446825 TCACCCAAAGCTCAGAACTCAGG - Intergenic
934649806 2:96084403-96084425 AAACCCACAGCACAGGACAAAGG - Intergenic
935788503 2:106570316-106570338 CCACCCACAGCCCAGGAAACGGG + Intergenic
936044844 2:109179450-109179472 ACACACAAAGACAAGGACACTGG - Intronic
936787293 2:116108998-116109020 ACAACTATAGCCCAGGACACAGG - Intergenic
937299683 2:120831621-120831643 ACACCCAAAGCTCCCTTCACAGG - Intronic
940910287 2:159204307-159204329 ACACCAAGAAATCAGGACACTGG - Intronic
944158427 2:196633752-196633774 ATCCCCGCAGCTCAGGACACAGG - Intergenic
945755015 2:213835008-213835030 ACAACCAGAGATCAGGAAACTGG - Intronic
946042219 2:216792220-216792242 ACACCCTAACCTCAAGAGACTGG - Intergenic
946507509 2:220317499-220317521 ACACCCAGAGCTTAGGCCCCAGG - Intergenic
947875782 2:233467505-233467527 AGACACAAAGCTCTGGACTCAGG + Intronic
948776801 2:240293418-240293440 AGGTCCAAAGCTCAGGCCACTGG - Intergenic
1171419861 20:25010804-25010826 GCAGGCAAGGCTCAGGACACTGG + Intronic
1172776853 20:37412817-37412839 ACACACACAGCCCAGTACACAGG - Intergenic
1173760568 20:45556136-45556158 CCTACCAAAGCTCAGGACAGTGG - Intronic
1174203646 20:48824363-48824385 ACACCCTAAACTCCGGCCACAGG - Intronic
1175380054 20:58556745-58556767 ATACCCCAAGCTCAGGACCTGGG - Intergenic
1175657393 20:60782854-60782876 ACAGCTACAGCTCTGGACACAGG + Intergenic
1176659925 21:9624627-9624649 CCAACCAAAGCTCAGGAGAATGG - Intergenic
1178813247 21:35904017-35904039 TCACCTACAGCTCAGGACCCAGG + Intronic
1181682645 22:24506405-24506427 TTATCCAAAGCTCAGGACCCAGG - Intronic
1183098963 22:35571640-35571662 AATCTCAAAGCTCAGAACACTGG + Intergenic
1183603106 22:38851371-38851393 ACCCCCAAAGCTGAGGACAATGG - Intergenic
1184476914 22:44726951-44726973 ACCCCCAAAGACCAGGACAGGGG - Intronic
1184998490 22:48227506-48227528 ACAGGCCAAGCCCAGGACACTGG + Intergenic
949626756 3:5875791-5875813 TCACCCAAAGCTGTGAACACAGG - Intergenic
950271564 3:11620248-11620270 ACACCCAAAGGTCTGGCCCCAGG + Intronic
951910701 3:27747623-27747645 AAACCCAGAGATCAGGTCACAGG + Intergenic
952719627 3:36518954-36518976 ACACCCACAGCCCTGCACACTGG - Intronic
953017952 3:39096478-39096500 CCACCCAAGGCTTAGCACACAGG - Intronic
954110785 3:48431643-48431665 ATAGGCAGAGCTCAGGACACCGG - Intergenic
957135611 3:76284718-76284740 ACATCCAAAGGTCAGGCCTCTGG - Intronic
958979392 3:100703663-100703685 ACACACAAAGCTCATTACAGTGG - Intergenic
959650404 3:108745360-108745382 GCAGCCTAAGCTCAGCACACAGG + Intronic
960512085 3:118562260-118562282 AAAACCAAAGCTCAGGGAACTGG - Intergenic
961383033 3:126508319-126508341 AAACCCACAGCTCAGGATGCAGG - Intronic
965091223 3:164164757-164164779 ACACCCAAAGCCCAGGAAATAGG + Intergenic
968501592 4:952682-952704 ACACACAGAGCACAGGACCCCGG - Intronic
969027525 4:4185634-4185656 AAACCCAAAGCTGAGGCCTCAGG + Intergenic
970616970 4:17776867-17776889 GCACCCAATTCTCAGGTCACAGG - Intronic
972231517 4:37078001-37078023 AAACCCAAAACTTAGAACACTGG - Intergenic
972657372 4:41077439-41077461 ACAAGAAAAGCTCAGAACACTGG + Intronic
973019092 4:45177993-45178015 ACCCCCAAGGCTCAGGAAAGTGG + Intergenic
977153228 4:93540677-93540699 AGACCAAAAGCTCAGGGCAAAGG + Intronic
979950086 4:126881435-126881457 AAACCCAAAGCTCATGAAGCTGG + Intergenic
982133058 4:152247612-152247634 GCCTCCCAAGCTCAGGACACAGG + Intergenic
982368174 4:154603506-154603528 AAAGCCAAAGCTCAGGACTTCGG + Intergenic
982435703 4:155382213-155382235 CCACCCACACCTCAGGAGACAGG + Intergenic
983381914 4:167006300-167006322 TCACCGAAAGCTCAGGAAACGGG - Intronic
985415448 4:189731779-189731801 CCAACCAAAGCTCAGGAGAATGG + Intergenic
995802443 5:116013053-116013075 ACACACAAAACTTAGGGCACAGG - Intronic
996005081 5:118410162-118410184 ACACCCAAAACTCACTACATAGG + Intergenic
997338213 5:133122531-133122553 AATCCCAAAACTCAGGACACTGG - Intergenic
1002001900 5:176200686-176200708 ACACCCACAGCCTAGGACCCGGG + Intergenic
1002168336 5:177361707-177361729 ACAGTCAAAGCTCAGGAAATTGG + Intronic
1002252398 5:177938184-177938206 ACACCCAGAGCCTAGGACCCGGG - Intergenic
1002252407 5:177938211-177938233 ACACCCAGAGCCTAGGACCCGGG - Intergenic
1002252416 5:177938238-177938260 ACACCCAGAGCCTAGGACCCGGG - Intergenic
1002252425 5:177938265-177938287 ACACCCAGAGCCTAGGACCCGGG - Intergenic
1002252434 5:177938292-177938314 ACACCCACAGCCTAGGACCCGGG - Intergenic
1002252443 5:177938319-177938341 ACACCCAGAGCCTAGGACCCGGG - Intergenic
1002293538 5:178215396-178215418 AGCCCCACAGCGCAGGACACTGG + Exonic
1004414323 6:15411530-15411552 ACATACAAAGCTCAGTACACGGG - Intronic
1006164035 6:32054081-32054103 ACACCCCAAGCTCTGGCCTCGGG - Intronic
1007305568 6:40901416-40901438 ACTCCCAAAGCTTAGGAGAATGG + Intergenic
1009419893 6:63454076-63454098 ACACTAAAAGCTCTGGAAACAGG - Intergenic
1010489240 6:76453536-76453558 CCAGCCACAGCTCTGGACACAGG - Intergenic
1011842241 6:91516210-91516232 AGACCCAAATCGCAGGACAAAGG + Intergenic
1016988944 6:149916319-149916341 CCACCCAATGCCAAGGACACAGG - Intergenic
1017553820 6:155541636-155541658 AGACCCAAAGCCCAGCAGACAGG - Intergenic
1018940897 6:168308390-168308412 ACACCCTCAGCTCAGGACTATGG - Exonic
1021247720 7:18284375-18284397 TCAACCAAAAGTCAGGACACAGG - Intronic
1021438623 7:20651641-20651663 CCACCATAAGCTAAGGACACAGG - Intronic
1022484235 7:30765659-30765681 ATCCCCAAAGATCAGGACAGGGG - Intronic
1023255518 7:38308724-38308746 ACACTCTAAGCTCAGGAGAATGG - Intergenic
1024054839 7:45653373-45653395 GGCCCCAAACCTCAGGACACAGG - Intronic
1024564466 7:50669936-50669958 ACACCCAGAAAGCAGGACACAGG + Intronic
1025077332 7:55954224-55954246 ACATCCAAAGTTCAGCACACAGG + Intronic
1028030535 7:85906542-85906564 ACACCTAAAGCTCAGCATAGTGG + Intergenic
1029493469 7:100884653-100884675 ACCCCCACAGCTGAGGCCACAGG - Intronic
1031383939 7:121122675-121122697 TCTCCCAAAGCACAGAACACAGG + Intronic
1031610833 7:123825073-123825095 AAACCCAAAGCTGAAGACAGTGG - Intergenic
1032292192 7:130598496-130598518 ACATCCTAAGCCCAGGAAACCGG + Intronic
1032695212 7:134330079-134330101 CCTCACAAAGGTCAGGACACAGG + Intergenic
1035314931 7:157991730-157991752 ACACCCAAGGCTGGGGACCCAGG + Intronic
1035446683 7:158947926-158947948 ACACCCAATGCTTAGGAGCCTGG - Intronic
1035761670 8:2073132-2073154 GCACCCACAGCCCAGAACACAGG - Intronic
1035953945 8:4054896-4054918 AACCCCAGAGCTCAGGGCACAGG - Intronic
1036237018 8:7047768-7047790 ACACCCAGAGCTCAGGAGAAGGG - Intergenic
1037665940 8:20970149-20970171 ACAGCCAGAGCTGGGGACACTGG + Intergenic
1037703755 8:21297956-21297978 ACACCCGAATCCCAGGACCCGGG + Intergenic
1038363960 8:26912004-26912026 GCACCCAAGGTTAAGGACACTGG + Intergenic
1038963756 8:32549029-32549051 ACGCCCAGAGCTCAGGGCAAGGG + Intronic
1039100410 8:33935414-33935436 ATACACAGAGTTCAGGACACAGG - Intergenic
1040950535 8:52934796-52934818 CCACCCAAAGCTGTGGAGACAGG - Intergenic
1041172679 8:55161051-55161073 AAAGCCGAAGCTCAGAACACAGG - Intronic
1041799817 8:61786930-61786952 ACACACAATGCCCAGGACCCTGG - Intergenic
1044573443 8:93744192-93744214 ATACCCAAAACCCAGGACCCTGG - Intergenic
1045102601 8:98860752-98860774 ACACACAAAAATCTGGACACGGG + Intronic
1047203642 8:122786225-122786247 AGACCCAAAGGTCAGGAAAAAGG - Intronic
1047994892 8:130324973-130324995 ACCCCCAAAACCCAGAACACTGG + Intronic
1048377918 8:133838571-133838593 GCACCCACAGCTCAGGAATCTGG - Intergenic
1049756847 8:144314527-144314549 CCAACCAAACCACAGGACACGGG - Exonic
1052372203 9:27677680-27677702 TCACCTAATGCTCTGGACACAGG + Intergenic
1053422051 9:37985881-37985903 ACTCCCAGTGCCCAGGACACAGG - Intronic
1056816164 9:89802782-89802804 ACAGCCCAACCTCAGGACAGCGG - Intergenic
1058277982 9:103070847-103070869 AGACCCAAACCTCAGACCACTGG + Intergenic
1061824000 9:133246719-133246741 ACACCCAACGTGCAGGCCACGGG + Intergenic
1061914036 9:133739751-133739773 ACAGCCCTAGCTCAGGCCACTGG - Exonic
1062426859 9:136510139-136510161 AGACCCCAAGCACAGGAGACGGG - Intronic
1203637488 Un_KI270750v1:126471-126493 CCAACCAAAGCTCAGGAGAATGG - Intergenic
1190877861 X:54472410-54472432 ACATCCAGAGTTCAGGTCACAGG + Intronic
1192865141 X:75123063-75123085 ACACCAAAAGCTCAAGTCAGTGG - Intronic
1198186233 X:134256579-134256601 TCACCCAAAGCTCTGCCCACTGG + Intergenic
1201076536 Y:10194037-10194059 ACCCCAGGAGCTCAGGACACAGG + Intergenic