ID: 1144829776

View in Genome Browser
Species Human (GRCh38)
Location 17:18124661-18124683
Sequence CTGAGGCTCTGAAAATGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 223}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144829776_1144829779 27 Left 1144829776 17:18124661-18124683 CCAGGACATTTTCAGAGCCTCAG 0: 1
1: 0
2: 2
3: 21
4: 223
Right 1144829779 17:18124711-18124733 GGTGTGCTTTGTGAGTTAGACGG 0: 1
1: 0
2: 1
3: 12
4: 137
1144829776_1144829778 6 Left 1144829776 17:18124661-18124683 CCAGGACATTTTCAGAGCCTCAG 0: 1
1: 0
2: 2
3: 21
4: 223
Right 1144829778 17:18124690-18124712 AGTGTCACAAAGACTAAATGTGG 0: 1
1: 0
2: 2
3: 16
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144829776 Original CRISPR CTGAGGCTCTGAAAATGTCC TGG (reversed) Intronic
900534227 1:3169130-3169152 CTGAGGCTCAGAAAGTGTCCAGG - Intronic
903613947 1:24638405-24638427 CTCAGGCTCTCAAAAAGTGCTGG - Intronic
904434390 1:30484878-30484900 CTGAGGCTCTGCAGACCTCCTGG + Intergenic
904666130 1:32123008-32123030 ATGAGGCTCTTATAATGTCTAGG + Intronic
905063174 1:35157088-35157110 TTGAGGCTTTGAAAACGACCTGG + Intergenic
906829937 1:49020559-49020581 CTGAGGGCCTGAAAGTGTTCAGG - Intronic
906880819 1:49587902-49587924 CTGAGGCTCTGTAATTTTTCAGG + Intronic
907105740 1:51880825-51880847 CTGAGGCTGTGAAATTCTGCTGG + Intergenic
907255907 1:53178969-53178991 GTGATGCTCTGAAAAGGCCCTGG - Intergenic
907441991 1:54484669-54484691 CTTAGGGTCAGAAACTGTCCAGG - Intergenic
907628194 1:56052499-56052521 CTGAGCATCTGAAACTGTCAAGG + Intergenic
907924109 1:58940057-58940079 CTGGGGCTCTGACAGAGTCCTGG - Intergenic
908530310 1:65027694-65027716 GTGCAGCTCTGGAAATGTCCTGG + Intergenic
910245881 1:85137642-85137664 CTGAGGACCTGAAAATATGCTGG - Intergenic
911354481 1:96799141-96799163 CTGAGTCACTCAAAATGTCTGGG + Intronic
912419201 1:109531980-109532002 CTGAGCCTCTGAAGCTGTCCGGG + Intergenic
916533778 1:165683398-165683420 CTGAGGCTCTGAAAGTCACAGGG + Intronic
920035104 1:203060438-203060460 CAGGACCTCTGAAAATGTCCTGG - Intronic
920661014 1:207914348-207914370 CTGAGGCTGTGAGACTGTGCAGG - Intergenic
923562104 1:235049261-235049283 CTGAGGCTCTGATAAACTGCTGG + Intergenic
924263405 1:242254697-242254719 CTGAGGCTCAGAGAAAGTGCCGG + Intronic
1063279568 10:4612099-4612121 TTGGGGCTATGAAAATGTTCTGG - Intergenic
1066351088 10:34637491-34637513 CAGAGGCTCCGAGAATTTCCCGG + Intronic
1066467504 10:35666658-35666680 CTGAGGTGGTGACAATGTCCTGG - Intergenic
1066477361 10:35760967-35760989 CTAAAGATCAGAAAATGTCCAGG + Intergenic
1066721390 10:38343775-38343797 CTGAGGCTCAGAGAAAGTGCCGG - Intergenic
1068408323 10:56622859-56622881 CTGTGGTTCTGAAATTGTACTGG + Intergenic
1069070884 10:63989698-63989720 CAGGGGCTATGAAGATGTCCAGG - Intergenic
1069567513 10:69473633-69473655 CTGAGGCTCAGAAAAGGTAAGGG + Intronic
1069761484 10:70814679-70814701 TTGAGGGTCAGAAAATGTTCTGG - Intergenic
1072269003 10:93757221-93757243 CTGGGGCTTTGAAAAAGGCCTGG - Intergenic
1077317581 11:1926219-1926241 CTGAGGCTCAGAGGATGGCCGGG - Intronic
1079121858 11:17691465-17691487 CAGAGGCAATGAAAATGTTCTGG + Intergenic
1079710707 11:23679916-23679938 CTGAGGCCCATAAAATCTCCAGG - Intergenic
1080062443 11:27971321-27971343 CTGAGCTTCCCAAAATGTCCTGG + Intergenic
1081067814 11:38568464-38568486 CTGAAGTTTTAAAAATGTCCAGG + Intergenic
1083646402 11:64173742-64173764 ATGAGTCACTGAAAATGTACTGG + Intergenic
1084455609 11:69266415-69266437 CCCAGGCTCTGACATTGTCCTGG - Intergenic
1086075717 11:82849334-82849356 CAGTTGCTCTGAAAATATCCTGG - Intronic
1089961864 11:122623763-122623785 CAGAAACTCTGAAAATGGCCGGG - Intergenic
1090026962 11:123175983-123176005 GTGAGGCAATGAAAATGTCAAGG - Intronic
1090391545 11:126392058-126392080 CTGAGGCTTTGAGATTGTCAAGG + Intronic
1091806573 12:3361277-3361299 CAGAGGCTCAGGAAATGTTCGGG - Intergenic
1093437103 12:19148379-19148401 CTCAGGCTCTGCAAAGGTGCTGG + Intronic
1093815042 12:23535322-23535344 CTGAGTCTCTGAAACAGTTCTGG + Intronic
1095125144 12:38468507-38468529 CTGAGGTTCTGATAATGTTCTGG - Intergenic
1096670020 12:53193065-53193087 CTTAGGCTCTGGGAATCTCCTGG - Exonic
1096810384 12:54165756-54165778 GTGAGGATTTTAAAATGTCCTGG + Intronic
1098159956 12:67640478-67640500 CTGAGCCTCAGAAAATGAGCAGG - Intergenic
1100692153 12:97049456-97049478 CTGGGACTATTAAAATGTCCTGG - Intergenic
1102687052 12:114732793-114732815 CTCAGGCTTTGAAAACGACCTGG - Intergenic
1104852455 12:131883704-131883726 CTGAGGCTCAGAAAATCTTTTGG + Intergenic
1104987055 12:132603262-132603284 CTGGGGCTCTGAAAATCTGTGGG - Exonic
1105282837 13:18978977-18978999 CAGAGGCTCTGAAAATCTCGGGG - Intergenic
1105842222 13:24264707-24264729 CTAAGGATCTGAAAATAACCAGG + Intronic
1106565529 13:30881467-30881489 CTCAGGCTCTGACACTGTCATGG + Intergenic
1107696939 13:43009606-43009628 TTGAGGCTATGCAAATATCCTGG + Intergenic
1107831432 13:44376911-44376933 TTGAGGCTCCAAAAATGTCAGGG - Intronic
1111774027 13:92636588-92636610 ATAAGTCTCTGAAAATGTACTGG + Intronic
1112320852 13:98406279-98406301 CCGAGGCTTTGAAAATGTACAGG - Intronic
1113075320 13:106462311-106462333 CTGAGACTCTGGAAGTCTCCGGG - Intergenic
1113272794 13:108693331-108693353 TTGGGGCTATGAAAATGTCCTGG - Intronic
1113543127 13:111124277-111124299 GTGAGGCCCTCAAAATGACCAGG + Intronic
1114381826 14:22213846-22213868 CTGAGGATCATAAAAGGTCCTGG - Intergenic
1114401902 14:22417890-22417912 ATGTGGCTCTGAGAATCTCCAGG - Intergenic
1115546326 14:34467788-34467810 GAGAGGCTGTGAAACTGTCCTGG - Intergenic
1123122701 14:105925413-105925435 CTGGGGCTCTGGACATGACCAGG - Intronic
1126421285 15:48475791-48475813 CTGAAGCTCTGAAATGGTCCTGG + Intronic
1126435568 15:48633929-48633951 CTGAGGCCCAGAGAAGGTCCAGG - Intronic
1128353418 15:66907490-66907512 CTGAGGCCCTGAAACTGTTGTGG - Intergenic
1128694070 15:69747330-69747352 CTGAGGCTCAGCAATGGTCCTGG + Intergenic
1129870007 15:78934053-78934075 CAGAGGGTCTAAAAATGTCACGG + Intronic
1130194142 15:81763184-81763206 CTTAGACTCTGAATCTGTCCAGG - Intergenic
1132196989 15:99921734-99921756 GGGAGGCGATGAAAATGTCCTGG + Intergenic
1132477038 16:144965-144987 CTGAGGCGATGAAAATGTCCTGG - Intergenic
1133020924 16:2966674-2966696 CTGTGGCTCTGAAAGCGACCTGG + Exonic
1133696083 16:8264246-8264268 CTGAGACTCCTCAAATGTCCTGG + Intergenic
1136592014 16:31223286-31223308 CTGAGGCTCTGCAGAGCTCCTGG + Intronic
1137632402 16:49956206-49956228 CTGAGCCTGTGGTAATGTCCTGG + Intergenic
1141380135 16:83568878-83568900 CTGAGACTCTGCAATGGTCCAGG - Intronic
1141716508 16:85730070-85730092 CTGAGGCTGTGTAACTGCCCAGG - Intronic
1144829776 17:18124661-18124683 CTGAGGCTCTGAAAATGTCCTGG - Intronic
1148519843 17:48262259-48262281 CTGAGACTCTTAAAATGTACTGG - Intronic
1151658482 17:75506747-75506769 CTGAGACCCTGTAGATGTCCAGG + Intronic
1151833852 17:76570703-76570725 CTGAGGAGCTAAACATGTCCTGG - Intronic
1152388021 17:79986757-79986779 CTGAGGCTCTGAGGAGGGCCGGG - Intronic
1152982379 18:290653-290675 CTGAGACTCTGGAAATTTCCAGG + Intergenic
1153546886 18:6217229-6217251 CTGGAGCTCTGGAAATGTCCTGG - Intronic
1154338048 18:13481722-13481744 CTGAGGCTCTGAAGGGATCCAGG + Intronic
1155405530 18:25482965-25482987 CAGATGCCCTGAAACTGTCCAGG + Intergenic
1155758294 18:29530189-29530211 CTGAAGCTCTGAATATGGCAGGG - Intergenic
1157652800 18:49352253-49352275 CTGGGGTGCTGAAAATGTTCCGG + Intronic
1159844286 18:73440143-73440165 CTGAGGCTCTGGCAGTGACCTGG + Intergenic
1160117952 18:76099685-76099707 CTGTGGCTCTGAGCATCTCCTGG - Intergenic
1160970600 19:1766228-1766250 CTGAGGCTTCCCAAATGTCCCGG - Intronic
1161663481 19:5561053-5561075 GTGTGGCTGGGAAAATGTCCTGG + Intergenic
1168060261 19:53887933-53887955 CTGAGGCTTTGAAAAGGGGCAGG + Intronic
1168646665 19:58063385-58063407 CTGAGGCTCAGGAAGGGTCCTGG + Intronic
925223585 2:2162482-2162504 CTGAGGCTCTGCTCATATCCAGG + Intronic
925779851 2:7372213-7372235 CTGAGGCCCCGCAAATGTGCAGG + Intergenic
928680764 2:33700107-33700129 CTGGGGCCCTGAGAATGGCCTGG - Intergenic
930487968 2:52032152-52032174 TTGAGGCTGTGAAAATCACCAGG + Intergenic
932176202 2:69605057-69605079 CTGGGGCTCTGTAAAAGCCCGGG - Intronic
932421692 2:71605042-71605064 CTGAGGCTTTGATGATGTCCGGG + Intronic
934696503 2:96404412-96404434 CTGAGGCTCACAAAAAGCCCTGG - Intergenic
934778332 2:96953031-96953053 CTGTCTCTCTGAGAATGTCCAGG + Intronic
936664575 2:114579507-114579529 CTTAGGGGCTGAAAATGTCAAGG - Intronic
937053874 2:118914680-118914702 TTGAGGATGTGAGAATGTCCAGG - Intergenic
939581604 2:143956004-143956026 CACAGGCTCTGAAAAGGACCAGG - Intronic
939908996 2:147956525-147956547 CTTAGGTTCTTATAATGTCCAGG + Intronic
942811438 2:180005215-180005237 CTGGGGCTCTGAGACTGTCTTGG - Intronic
943438451 2:187896610-187896632 CTGAGGATTTGATAATCTCCTGG - Intergenic
945216906 2:207443670-207443692 CCAAGGCACTGAAAAAGTCCAGG + Intergenic
945848239 2:214973948-214973970 CTCCTGCTCAGAAAATGTCCAGG - Exonic
947362129 2:229356657-229356679 CGGAGGCTCAGACAATGTCCAGG + Intergenic
947431098 2:230028485-230028507 TTGAGGTGCTGAAAATGTTCTGG - Intergenic
1171018156 20:21560490-21560512 CTAAGGCTTTGAACATTTCCCGG - Intergenic
1171204622 20:23269205-23269227 CTGAAGCTATGCAAATCTCCTGG + Intergenic
1171937264 20:31286601-31286623 CTGTGCCTTTGAAAAGGTCCAGG + Intergenic
1172774642 20:37399962-37399984 CTGAGGCTCAGAAAGGGCCCAGG + Intronic
1179245076 21:39626030-39626052 CTGGGGTAATGAAAATGTCCTGG - Intronic
1181087694 22:20449932-20449954 CGGAGGCTCTGGAGCTGTCCGGG - Intronic
1181734040 22:24868238-24868260 CTGAGGCTCTGGGAAAGTCCTGG - Intronic
1182008551 22:26981582-26981604 CAGAGGCTCTGAAAGTCTCTGGG + Intergenic
1182280158 22:29213798-29213820 CTGTGGCTCTGTAAACGCCCCGG - Intronic
1183575019 22:38682420-38682442 TTGTGGCTCAGAAAATGTACAGG + Exonic
1185048815 22:48543137-48543159 CTGCGTCTCTGAACATCTCCTGG + Intronic
950053135 3:10007218-10007240 CTGAGGCTCTGAGCAGGTGCAGG + Intronic
950053723 3:10009986-10010008 CGGAGGCTCTGAAAAAGGCCTGG - Intronic
950305364 3:11912274-11912296 CAGAGGCTCTGAGAAAGGCCTGG - Intergenic
950691575 3:14662615-14662637 CTGATGCTCTGACAATTTCCTGG + Intronic
951405903 3:22296977-22296999 CTCAGGCCCTGAAAATGTTAGGG - Intronic
952859571 3:37801832-37801854 CTGAGGCTCAGAAACTGTGGTGG + Intronic
952932002 3:38367758-38367780 CTGACGCCCTGAGAGTGTCCTGG + Intronic
953634695 3:44652803-44652825 CTGAGGTATTGAAAGTGTCCAGG + Intronic
955766606 3:62350807-62350829 ATGCAGCTCTGAGAATGTCCAGG - Intergenic
960018974 3:112927634-112927656 CTGAGGCAATGAGAGTGTCCAGG + Intronic
960321882 3:116246840-116246862 CTCATACTTTGAAAATGTCCTGG + Intronic
961168803 3:124781257-124781279 CTGGGGCTTTGAAGATTTCCTGG + Intronic
961783873 3:129337802-129337824 CGGAGGCTCTGAGAAAGGCCTGG - Intergenic
961785173 3:129343239-129343261 CAGAGGCTCTGAGAAAGCCCTGG - Intergenic
961786003 3:129347354-129347376 CTGAGGCTCTGAGCAGGTGCAGG + Intergenic
963812320 3:149790174-149790196 CTTAGACTCAGAAAATCTCCAGG + Intronic
966490506 3:180523081-180523103 TTGAGGTAATGAAAATGTCCTGG - Intergenic
967314914 3:188143166-188143188 CTGAGGCACTGAAAAGGCTCTGG - Intergenic
969263693 4:6050309-6050331 CTAAGGCTCTGAAAGTTTACAGG + Intronic
969475500 4:7420436-7420458 CTGAGACTCAGAGAGTGTCCAGG + Intronic
969618602 4:8267840-8267862 CTGAGTCTCTGAGAGAGTCCAGG - Intergenic
969710146 4:8838490-8838512 CTGAGGCTCTGACAGTGTCTCGG - Intergenic
970106042 4:12585573-12585595 CTGGGACACTGAAAATGTTCTGG + Intergenic
972928940 4:44047498-44047520 GTGTGGCTCTGAAAGTGTCTTGG - Intergenic
976274538 4:83262812-83262834 CTGAGCCACTGAAAATGACTTGG - Intronic
976385080 4:84447650-84447672 CAGAGGCTGTGGCAATGTCCAGG + Intergenic
978830948 4:113084128-113084150 CTGAGGAACTGAGAATGTGCAGG + Intronic
979802262 4:124925739-124925761 CCTAGGCCCTGAAAATGTCATGG + Intergenic
979960404 4:127013400-127013422 CTTATGCTCAGAATATGTCCTGG - Intergenic
980867997 4:138576383-138576405 CTGAGGCTGAGAAAATTTCTAGG + Intergenic
982212091 4:153046105-153046127 CTGAGGCCCTCAAAATATCCTGG - Intergenic
984888143 4:184469190-184469212 CTGAGGCACTGAAACTAGCCGGG - Intronic
985062579 4:186093418-186093440 CTGGGGCTCTGAGCATCTCCAGG + Intergenic
986439022 5:7762381-7762403 CTGAGGATCTGCAGATGCCCTGG + Intronic
987680280 5:21127394-21127416 CTGTTGCCCTAAAAATGTCCTGG - Intergenic
988700962 5:33674084-33674106 CTCAGGCACTGAATATATCCTGG + Intronic
992245517 5:74818408-74818430 CTGAGGTGATGAAAATGTTCAGG + Intronic
994314942 5:98322151-98322173 CTGAGGATCTGAAATGGTCTGGG + Intergenic
995744965 5:115393714-115393736 CTGAGGCCCATAAAATCTCCAGG - Intergenic
997692195 5:135834484-135834506 CTGAGGCTCTGAAGTTGGCAAGG + Intergenic
998151490 5:139759941-139759963 CTGAGGCTCAGAGAAAGGCCAGG + Intergenic
998914240 5:146996870-146996892 CTGGGGATCTGGAAAGGTCCAGG - Intronic
999312653 5:150561768-150561790 CTGAGGCTGGGAATGTGTCCTGG + Intergenic
999861720 5:155655082-155655104 TTGCTGCTCTCAAAATGTCCTGG - Intergenic
1002893406 6:1357280-1357302 CTGGGGTTATGAAAATGTTCTGG + Intergenic
1006326584 6:33358513-33358535 CTGAGACTCAGAAAAAATCCTGG + Intergenic
1006896735 6:37476041-37476063 CTGGAGCTGTGAAAATGCCCTGG + Intronic
1007392387 6:41557190-41557212 TTCAGGCTCTGAGAATCTCCTGG + Intronic
1010784417 6:79983715-79983737 CAGAGCCCCTGAAAATGTCCTGG + Intergenic
1011255788 6:85419514-85419536 CTTGGGCCCTAAAAATGTCCTGG + Intergenic
1011453672 6:87523721-87523743 CAGAGGCTCTGTAACTATCCGGG - Intronic
1011622651 6:89257342-89257364 CTGAGGGTCTAAGAATGTCTAGG + Intronic
1012249014 6:96959289-96959311 CTGTGGCTCAGAAGCTGTCCCGG - Intronic
1013191639 6:107808666-107808688 CAGAGGCTTTGAGAATGTTCAGG + Intronic
1015789296 6:136950477-136950499 CTGAGGGTATCAAGATGTCCCGG + Intergenic
1015990301 6:138934302-138934324 CTGATGCTCTGATGATGTCAGGG - Intronic
1016429109 6:143964336-143964358 CAGAGGCCATGAAAATCTCCAGG + Intronic
1016452208 6:144195015-144195037 CTGTGCCTCTGAATATGTCAGGG + Intergenic
1017155752 6:151321285-151321307 ATGAGGTAATGAAAATGTCCTGG - Intronic
1018124667 6:160670083-160670105 CTGAGGCTCAGAGAAGGTGCAGG - Intergenic
1018132701 6:160747924-160747946 CTGAGGCTCAGAGAATGTGTGGG + Intronic
1018149280 6:160923583-160923605 CTGAGGCTCTGGAAGGGCCCTGG - Intergenic
1018323728 6:162641050-162641072 CAGAGGCACTGACAATTTCCAGG + Intronic
1019766819 7:2857652-2857674 CTGAGGCCCTGCAATTATCCAGG - Intergenic
1021172316 7:17413779-17413801 CTAAGGCACTGATAAAGTCCAGG + Intergenic
1022176217 7:27874244-27874266 CTGAGGCTGGGAAAATCCCCAGG + Intronic
1023182644 7:37500652-37500674 CTGGGGCACTGCAAATGTTCTGG + Intergenic
1023233944 7:38064547-38064569 CTGAGGAACTGAAGAAGTCCTGG + Intergenic
1024228521 7:47346522-47346544 CTGAGAGTCTGAGAATGCCCTGG - Intronic
1025187960 7:56875643-56875665 CTGAGGATCTGAGCATGACCCGG - Intergenic
1025683962 7:63701281-63701303 CTGAGGATCTGAGCATGACCCGG + Intergenic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1027435952 7:78164436-78164458 CTGTGGCCCTGAAAATGTTAGGG + Intronic
1027628009 7:80567516-80567538 TTGAGGCCCTGAAAAGGTCTAGG + Intronic
1034501050 7:151451381-151451403 CTGAGGCTCTGGAAGGTTCCTGG + Intergenic
1035326151 7:158067473-158067495 CAGAGGTTCAGAACATGTCCTGG - Intronic
1035783190 8:2244542-2244564 CTGAGGCTTAGGGAATGTCCGGG + Intergenic
1035808934 8:2475044-2475066 CTGAGGCTCAGGGAATGTCCGGG - Intergenic
1036430392 8:8684420-8684442 CCAATGCTCTGAAAATGACCAGG + Intergenic
1036538479 8:9676988-9677010 CTGAGAATCTGAAAATATTCTGG - Intronic
1036677022 8:10842637-10842659 CTGAGGCTCTGGAGAGGCCCTGG + Intergenic
1037668542 8:20994917-20994939 CTGAGACTCTGAAATGGACCAGG + Intergenic
1044131954 8:88534396-88534418 CTCAGGCTCTGAATAAGTCAGGG - Intergenic
1044593264 8:93934469-93934491 CTGGGACCATGAAAATGTCCTGG - Intergenic
1045133675 8:99188254-99188276 TTGAGGTTTTGAAAATGTTCTGG - Intronic
1045842062 8:106592059-106592081 CTGAGGCCCTGAAAGTGATCTGG + Intronic
1046229977 8:111342266-111342288 CTGATAATCTGAAAATCTCCTGG + Intergenic
1048081933 8:131138008-131138030 CTGAGGTACTGACATTGTCCTGG + Intergenic
1048335097 8:133496785-133496807 CTGATGCTCTGGGATTGTCCAGG + Intronic
1048500011 8:134966938-134966960 ATGAGGCACTGAAACAGTCCAGG - Intergenic
1048836247 8:138521506-138521528 CAGAGGCTCTGAAAGAGTCTTGG + Intergenic
1048943343 8:139422181-139422203 CTGAGGAGCTCAAAGTGTCCAGG - Intergenic
1049158111 8:141079393-141079415 TTGAGGTGATGAAAATGTCCTGG - Intergenic
1050183560 9:2946610-2946632 CTAACCATCTGAAAATGTCCAGG + Intergenic
1050859270 9:10404768-10404790 CTGAGGATCTGAAATTGGCTTGG - Intronic
1051284509 9:15482511-15482533 AGGAGGCTCTGAAAATTTCTTGG - Intronic
1052125370 9:24767952-24767974 GTGAGGTTCTGAAAACGTTCTGG - Intergenic
1052618699 9:30877264-30877286 CTGACGCTATGCAAACGTCCCGG - Intergenic
1055393982 9:75853749-75853771 AAGAAGCTCTGAAAATTTCCAGG + Intergenic
1055508075 9:76968179-76968201 CTGAGGCTCTGCAAATCGGCCGG + Intergenic
1056805532 9:89726034-89726056 CTGATGCTCTGAAAAAATCATGG - Intergenic
1057325400 9:94058735-94058757 CTGGGCCTCCCAAAATGTCCGGG - Intronic
1058859861 9:109105706-109105728 CTGAGGTAATGAAAATGTCTTGG + Intronic
1060513944 9:124254166-124254188 CTGAGGCTCAGAAAATAGCCAGG - Intergenic
1060886345 9:127155236-127155258 CAGGGGCTCAGAAAATGGCCAGG - Intronic
1061594663 9:131621135-131621157 ATGAGGCTCTGGAACTGCCCAGG - Intronic
1061700600 9:132412149-132412171 CTTAGGGTCGGAAAATGTACAGG + Intronic
1185756295 X:2655669-2655691 CTCAAGCTCTGAGAATGTTCTGG - Intergenic
1185822023 X:3214678-3214700 CTGAAGCTTTGTATATGTCCAGG + Intergenic
1187626171 X:21116629-21116651 CTGAGGAACTGAAAATGTTCTGG + Intergenic
1188811533 X:34657746-34657768 CTCAGGATGTGAAATTGTCCGGG - Intergenic
1189709215 X:43792020-43792042 TTGAGATTCTGAAAATGTCTTGG - Intronic
1192243932 X:69357938-69357960 CTGTGGAGCTGAAATTGTCCTGG - Intergenic
1192480331 X:71479675-71479697 CAGAGGCTCTGGTAATGTTCTGG + Intronic
1194764974 X:97839125-97839147 TTGAGACTCTGAAAATTTACTGG + Intergenic
1197774078 X:130109085-130109107 CTTTGGCACTGAAAATGCCCGGG - Intronic
1198182554 X:134223869-134223891 CTGAGTCTCTGGAGATGGCCTGG + Intergenic
1199833886 X:151569664-151569686 GTGAAGCTCTGCAAATGCCCTGG - Intronic
1200325829 X:155237764-155237786 CTGAGGATCAGAAAATGTTCAGG - Intronic
1201602043 Y:15741656-15741678 CTTGCTCTCTGAAAATGTCCAGG + Intergenic