ID: 1144831274

View in Genome Browser
Species Human (GRCh38)
Location 17:18132563-18132585
Sequence GATGCCTGCTGGCACTCACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 133}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144831274_1144831293 30 Left 1144831274 17:18132563-18132585 CCAGGTGAGTGCCAGCAGGCATC 0: 1
1: 0
2: 0
3: 15
4: 133
Right 1144831293 17:18132616-18132638 CGACGCCCCTGGCTGGGCCTTGG 0: 1
1: 0
2: 0
3: 18
4: 201
1144831274_1144831284 19 Left 1144831274 17:18132563-18132585 CCAGGTGAGTGCCAGCAGGCATC 0: 1
1: 0
2: 0
3: 15
4: 133
Right 1144831284 17:18132605-18132627 TCCTCCCACCCCGACGCCCCTGG 0: 1
1: 0
2: 3
3: 41
4: 516
1144831274_1144831289 24 Left 1144831274 17:18132563-18132585 CCAGGTGAGTGCCAGCAGGCATC 0: 1
1: 0
2: 0
3: 15
4: 133
Right 1144831289 17:18132610-18132632 CCACCCCGACGCCCCTGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 170
1144831274_1144831278 -4 Left 1144831274 17:18132563-18132585 CCAGGTGAGTGCCAGCAGGCATC 0: 1
1: 0
2: 0
3: 15
4: 133
Right 1144831278 17:18132582-18132604 CATCTGAAGGCCCCTGGCCCTGG 0: 1
1: 0
2: 1
3: 35
4: 276
1144831274_1144831277 -10 Left 1144831274 17:18132563-18132585 CCAGGTGAGTGCCAGCAGGCATC 0: 1
1: 0
2: 0
3: 15
4: 133
Right 1144831277 17:18132576-18132598 AGCAGGCATCTGAAGGCCCCTGG 0: 1
1: 0
2: 3
3: 40
4: 252
1144831274_1144831287 23 Left 1144831274 17:18132563-18132585 CCAGGTGAGTGCCAGCAGGCATC 0: 1
1: 0
2: 0
3: 15
4: 133
Right 1144831287 17:18132609-18132631 CCCACCCCGACGCCCCTGGCTGG 0: 1
1: 0
2: 2
3: 20
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144831274 Original CRISPR GATGCCTGCTGGCACTCACC TGG (reversed) Exonic
900830547 1:4962217-4962239 GTTGCCTGCAGGCTCTCTCCTGG - Intergenic
900898639 1:5501987-5502009 GATGCCTCCTGGCACTTTCTAGG - Intergenic
902191521 1:14766459-14766481 GATGCCGGCTGGCACACTGCAGG + Intronic
904829032 1:33295012-33295034 GAGGCAGGCAGGCACTCACCTGG - Exonic
906033088 1:42735600-42735622 GATGCATGCTGGTGCCCACCAGG + Intronic
907577688 1:55542304-55542326 CATGCCTGCTGCCACTACCCTGG + Intergenic
908902453 1:68971216-68971238 GATGGTTGCTGGCACACAACAGG + Intergenic
910890266 1:92011571-92011593 GTTTCCTGTTGGCACTCACACGG + Intronic
923042790 1:230331768-230331790 CAGGCCTGGTGGCACCCACCTGG - Intronic
1067999145 10:51311391-51311413 TATGCCTGCTGGCACTTAGATGG + Intronic
1069598722 10:69689404-69689426 GCTGCCTCCTGGAACTCTCCAGG - Intronic
1069717998 10:70532969-70532991 GATGGCTGCTCTCCCTCACCTGG + Intronic
1070389336 10:75955369-75955391 GATGCCTCTGGGCTCTCACCTGG + Intronic
1072305569 10:94103372-94103394 GAGGGCTGCTGCCACTCCCCTGG - Intronic
1074059122 10:109948987-109949009 GATACCTGCTGGAACTGACCTGG - Intronic
1075535201 10:123265250-123265272 CATGCCTGCTGACACTGACCTGG + Intergenic
1076695726 10:132246428-132246450 CAGCCCTGCTGGCACTCACTGGG + Intronic
1077415660 11:2423169-2423191 GATGCCTGGGGGCAGTCCCCAGG - Intergenic
1083176003 11:60950975-60950997 CAGGCCTCCTGCCACTCACCTGG + Exonic
1085299182 11:75448645-75448667 GATGCCTGGTGGCAGACCCCAGG + Intronic
1089205726 11:116760934-116760956 GTTGCTTTCTGGCAGTCACCTGG + Exonic
1089336499 11:117727604-117727626 GATCCCTGCCGACATTCACCTGG - Intronic
1090774028 11:129947429-129947451 GGTGCCTGCTGGCACAAACAGGG + Intronic
1094194249 12:27729800-27729822 GATCCCTACTGTTACTCACCTGG + Intronic
1097262547 12:57727662-57727684 GCTGCCTCCTGGCACTCACTGGG + Exonic
1101656169 12:106722092-106722114 CATGCCTGATGGCACTGCCCAGG - Intronic
1103248995 12:119483724-119483746 GCTGACTGCTGGCACTCGCCCGG + Intronic
1103824209 12:123723201-123723223 GATGACTGCTGTTACTCATCTGG - Intronic
1104398751 12:128458545-128458567 GGTGCCTGGTGGTAGTCACCGGG - Intronic
1104891280 12:132141381-132141403 GATGCATGCTGTCAATCATCCGG + Exonic
1112046309 13:95601737-95601759 CCTGCCTACTGGCACTCACTGGG + Intronic
1114656005 14:24316052-24316074 GATGCCTGCCAGCACCCGCCGGG - Exonic
1121302978 14:92886639-92886661 CCTGCCTGCTGGCACCCAGCTGG + Intergenic
1122358031 14:101135976-101135998 CATGCCTGGTGGCACTAGCCAGG - Intergenic
1124261070 15:28191974-28191996 GAGCCCTGCTGGCAGTCATCGGG - Exonic
1126784274 15:52163814-52163836 GATGCCAGCTGGAACGCTCCTGG - Intronic
1127414856 15:58748864-58748886 GATGACTGCTGCCACTCCACGGG + Intronic
1127700580 15:61496331-61496353 TATGCCTCCTGGGACTCACCTGG - Intergenic
1127812530 15:62576979-62577001 GATTCCTGGTGGCACACAGCTGG - Intronic
1130004795 15:80084824-80084846 GATGCAGGATGACACTCACCTGG - Intronic
1132702988 16:1229872-1229894 GACCCCGGCTGGGACTCACCAGG + Exonic
1132705335 16:1240996-1241018 GACCCCGGCTGGGACTCACCAGG - Exonic
1132708466 16:1256359-1256381 GACCCCGGCTGGGACTCACCAGG - Exonic
1133294549 16:4744961-4744983 GGTGCCTGCCGACACTCCCCAGG + Exonic
1133516074 16:6510480-6510502 TGTGCCTGCTGTCCCTCACCTGG - Intronic
1136346357 16:29678850-29678872 AATGCCTGCCTGCCCTCACCAGG + Intronic
1137001730 16:35235178-35235200 GATGCCTGCTGCTTCTCAGCTGG + Intergenic
1137018017 16:35395044-35395066 GATGCCTGCTGCTTCTCAGCTGG + Intergenic
1138222058 16:55260285-55260307 GATGCCATCTGGCAGGCACCTGG - Intergenic
1138521952 16:57576098-57576120 GATGCCATCTGGCCCTCCCCTGG - Exonic
1138577041 16:57914693-57914715 CATTCCTTCTGGCACTCACTGGG - Intronic
1141808027 16:86354832-86354854 CATGCCTGCTGGGACTGAACAGG - Intergenic
1143562062 17:7702287-7702309 AATGGCTCCTGGCACTAACCAGG - Intronic
1144185557 17:12791867-12791889 GATACAGGCTGGCCCTCACCTGG - Intronic
1144626873 17:16848357-16848379 TAGGCCTGGAGGCACTCACCAGG + Intergenic
1144831274 17:18132563-18132585 GATGCCTGCTGGCACTCACCTGG - Exonic
1144879565 17:18424355-18424377 TAGGCCTGGAGGCACTCACCAGG - Intergenic
1145152674 17:20520032-20520054 TAGGCCTGGAGGCACTCACCAGG + Intergenic
1146164008 17:30574196-30574218 TAGGCCTGGAGGCACTCACCAGG + Intergenic
1149001306 17:51760435-51760457 GCTCCCTGCTGTCACACACCTGG - Intronic
1149024859 17:52015962-52015984 GATGTCTACTTCCACTCACCTGG - Intronic
1151034263 17:70779926-70779948 AAGGCTTGCTGGCACTCTCCAGG + Intergenic
1155021448 18:21900689-21900711 GCTGTCTGCTGGCACTCCCCTGG - Intergenic
1157498953 18:48176846-48176868 GTTGCCTGCTGGCAGTCCCCTGG - Intronic
1158497981 18:57973934-57973956 TCTGGCTCCTGGCACTCACCAGG + Intergenic
1160678623 19:403605-403627 AGTGCCTGCAGGCGCTCACCTGG + Intergenic
1161370681 19:3909280-3909302 GATGCCCGCTGACACTCATGTGG + Intronic
1161569659 19:5023578-5023600 GAGGCCGGCTGGGACTCACTGGG + Intronic
1161842867 19:6693393-6693415 GCTGGCTGTTGGGACTCACCAGG + Exonic
1162186704 19:8910485-8910507 TATGGCTGCTGGCCCTCTCCTGG - Exonic
1163864206 19:19758479-19758501 CAGGGCTGCTGTCACTCACCAGG + Intergenic
1164861235 19:31563871-31563893 GATGCCTGCTTGCACTCAGGAGG + Intergenic
927077913 2:19598494-19598516 GATGTCTGATGCCACTCAACTGG - Intergenic
929223150 2:39486183-39486205 GCTGCCTGGAGGCACTCACATGG - Intergenic
931861992 2:66364904-66364926 GAGGACAGCTGGCACTCAGCTGG - Intergenic
932716038 2:74101268-74101290 GCTGCCTGCTGCCCCTCACCGGG - Exonic
933393425 2:81701571-81701593 GAAGCCTGCATTCACTCACCTGG - Intergenic
936674819 2:114702714-114702736 GATGCCTTCTGGCATTTATCAGG + Intronic
937910258 2:127072195-127072217 GGTCCCTGCTGGCCTTCACCTGG - Intronic
943513451 2:188855065-188855087 AGTGCCTGCTTTCACTCACCTGG - Intergenic
944448234 2:199813961-199813983 CATGGTTCCTGGCACTCACCAGG - Intronic
946044250 2:216807987-216808009 CAGGCCAACTGGCACTCACCTGG + Intergenic
947670901 2:231934749-231934771 CAGGACTGCTGGGACTCACCTGG + Intergenic
1169262945 20:4150765-4150787 GAACCCTGATGGCACTCCCCAGG + Intronic
1172667602 20:36611471-36611493 GAGTCCTGCTGGGACTCAACAGG - Intronic
1175524280 20:59622804-59622826 GATGATTCCTGGCACCCACCAGG + Intronic
1175780186 20:61677155-61677177 AATGACTGCTGGGACTCCCCAGG + Intronic
1175911841 20:62408716-62408738 CATCCCTGCTGGCTATCACCAGG + Intergenic
1177801998 21:25836975-25836997 AAGAACTGCTGGCACTCACCAGG - Intergenic
1178855909 21:36250304-36250326 TGTGCCTGCTGCCACGCACCAGG + Intronic
1179015676 21:37592785-37592807 CAAGCCTGCTGACACTGACCAGG + Intergenic
1180866293 22:19121949-19121971 GACGCCTGCTGGAGCTTACCTGG - Intronic
1181684607 22:24519885-24519907 GCTCCCTTCTGGCATTCACCAGG + Intronic
1183182910 22:36273108-36273130 GATGCCTGCTGGAAGGCAACTGG + Intergenic
1183293798 22:37018614-37018636 GACGCGTCCTGGTACTCACCAGG - Exonic
1184239246 22:43203258-43203280 GATAGCTGCTGGGACTCACTGGG + Exonic
1185086643 22:48744447-48744469 GATACCTGGTGGCCCTCCCCAGG + Intronic
1185366775 22:50440459-50440481 GGAGCCAGCTGTCACTCACCTGG - Intronic
951741050 3:25923744-25923766 GTTTCTTGCTGCCACTCACCTGG - Intergenic
954529280 3:51304343-51304365 GATGCCTGCTGCCCCTCTCCTGG + Intronic
954855294 3:53638965-53638987 CATGCCTGCCAGCTCTCACCTGG - Intronic
956642708 3:71429793-71429815 GGTGCCTGATCTCACTCACCTGG + Intronic
962463901 3:135639308-135639330 CATCCCTGCTGGTACTCCCCTGG + Intergenic
967304581 3:188048228-188048250 GATGCCAGATAGAACTCACCTGG - Intergenic
968967700 4:3777382-3777404 GATGCCTGCTTGGTCTCACTGGG + Intergenic
968984879 4:3869712-3869734 GGTGCCGGTTGGCTCTCACCTGG - Intergenic
971286033 4:25290935-25290957 GATGACTGCTGCCCCTCCCCCGG + Intergenic
985280253 4:188279316-188279338 GATGCCTGCATGCCCTCTCCTGG - Intergenic
992738275 5:79745776-79745798 GATGCCAGCTGGCCCTCAGAGGG - Intronic
995264192 5:110139028-110139050 GATGGCTGCTGTCCCTCTCCTGG + Intergenic
1001228027 5:169962507-169962529 GATGCCTGCAAACATTCACCTGG + Intronic
1002571678 5:180143205-180143227 GATGCCTGCCAGCACCCAGCTGG + Intronic
1004185587 6:13418770-13418792 GGTGCCTGTTGCCACACACCTGG + Intronic
1004331174 6:14722834-14722856 GATGCCTGCTGGGCCCCACAAGG - Intergenic
1005963133 6:30707572-30707594 GATGCCTCCTGGGGCTCACTGGG + Exonic
1006440282 6:34049573-34049595 GATGCCTGCTGGGACCCACGTGG - Intronic
1006578045 6:35060250-35060272 GAGGCCTGCAGCCACTTACCAGG - Exonic
1006945123 6:37779604-37779626 CATGCCAGCTGGCCCTCCCCTGG + Intergenic
1013271056 6:108545617-108545639 GGTACCTGCTTGCACTCACATGG - Intergenic
1019374771 7:683586-683608 GATGGCGGCTGGCATTCAGCAGG - Intronic
1022537543 7:31107243-31107265 CAGGCCTCCTGGCACTCGCCTGG + Exonic
1023059248 7:36312972-36312994 GATGCCATCTGCTACTCACCCGG - Intergenic
1023726079 7:43143600-43143622 GATGCCAGCTCTCACTCCCCAGG + Intronic
1024020565 7:45364222-45364244 GCTGCCTCCTGGCTCTGACCTGG + Intergenic
1026628752 7:72019375-72019397 CCTGCCTCCTGGCATTCACCGGG + Intronic
1028944595 7:96562802-96562824 CACGCATGGTGGCACTCACCTGG - Intronic
1029734394 7:102457565-102457587 GCTCCCTGCTGGTCCTCACCGGG - Exonic
1034809377 7:154118052-154118074 GATGCCTGCTGGTAAACATCAGG + Intronic
1037728084 8:21500673-21500695 GAAGCAAGCTGGCACTCACCTGG + Intergenic
1037833014 8:22200022-22200044 GATGTCTGCTGGCACTGAGCTGG - Intronic
1038167505 8:25100152-25100174 CATGCATGCAGGCACCCACCAGG + Intergenic
1040461452 8:47653067-47653089 CATGACTGATGCCACTCACCAGG + Intronic
1042429133 8:68684210-68684232 GATGCATGCTGGCTCTCAGAAGG - Intronic
1044412376 8:91898236-91898258 GACTACTGCTGGAACTCACCAGG - Intergenic
1050069519 9:1795858-1795880 CATTCCTTCTGGCACTCATCAGG + Intergenic
1051823984 9:21198400-21198422 CATGCCTGCCAGCTCTCACCTGG + Intergenic
1057203635 9:93157531-93157553 GATGCCTGCTGACCATCCCCGGG + Intergenic
1057230904 9:93320743-93320765 GATGCCAGCTGGCACGGACTCGG + Intronic
1058051540 9:100411523-100411545 GCTGTGTGCTGGCACCCACCTGG - Intergenic
1189246916 X:39570422-39570444 GAAGTCTGCTGGAACACACCAGG - Intergenic
1192503182 X:71666307-71666329 GAGGCCTGCTGCCATTCTCCAGG + Intergenic
1192503626 X:71668260-71668282 GAGGCCTGCTGCCATTCTCCAGG - Intergenic
1192805910 X:74509102-74509124 TAGGCCTGGTGGCACGCACCTGG - Intronic
1193094170 X:77528265-77528287 GATGGCCGCTGGCCCTCCCCTGG - Intronic
1197034145 X:121854159-121854181 TATGCCTGCGTGCACTCGCCCGG + Intergenic
1200006728 X:153090130-153090152 GAGGCCTTCAGTCACTCACCTGG - Intergenic
1200049189 X:153419760-153419782 GATTCCTTCTGACACTCACCAGG + Intronic
1200072029 X:153533927-153533949 GAGGCCTGGTGGCCCTCCCCTGG - Intronic
1200377437 X:155798614-155798636 GATGGCTGATGGCACTCATCAGG - Intergenic