ID: 1144834249

View in Genome Browser
Species Human (GRCh38)
Location 17:18148637-18148659
Sequence GGACCCTATGGGACCCTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 128}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144834249_1144834258 14 Left 1144834249 17:18148637-18148659 CCCCAGAGGGTCCCATAGGGTCC 0: 1
1: 0
2: 1
3: 8
4: 128
Right 1144834258 17:18148674-18148696 TAGGGTCTGGCTTATAACCCAGG 0: 1
1: 0
2: 1
3: 17
4: 181
1144834249_1144834254 -5 Left 1144834249 17:18148637-18148659 CCCCAGAGGGTCCCATAGGGTCC 0: 1
1: 0
2: 1
3: 8
4: 128
Right 1144834254 17:18148655-18148677 GGTCCATTCTGTTCATGTTTAGG 0: 1
1: 0
2: 0
3: 11
4: 129
1144834249_1144834255 -4 Left 1144834249 17:18148637-18148659 CCCCAGAGGGTCCCATAGGGTCC 0: 1
1: 0
2: 1
3: 8
4: 128
Right 1144834255 17:18148656-18148678 GTCCATTCTGTTCATGTTTAGGG 0: 1
1: 0
2: 1
3: 23
4: 227
1144834249_1144834259 25 Left 1144834249 17:18148637-18148659 CCCCAGAGGGTCCCATAGGGTCC 0: 1
1: 0
2: 1
3: 8
4: 128
Right 1144834259 17:18148685-18148707 TTATAACCCAGGATCTCCCCAGG 0: 1
1: 0
2: 4
3: 4
4: 89
1144834249_1144834257 1 Left 1144834249 17:18148637-18148659 CCCCAGAGGGTCCCATAGGGTCC 0: 1
1: 0
2: 1
3: 8
4: 128
Right 1144834257 17:18148661-18148683 TTCTGTTCATGTTTAGGGTCTGG 0: 1
1: 0
2: 0
3: 14
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144834249 Original CRISPR GGACCCTATGGGACCCTCTG GGG (reversed) Intronic
900270300 1:1783612-1783634 GTGCCCTATGGGAGCCTCTCCGG + Intergenic
900584011 1:3423739-3423761 GGCCTCTGTGGGAGCCTCTGTGG - Intronic
900602656 1:3509693-3509715 GGGCCCTTGGGGACCCACTGAGG - Intronic
904462149 1:30686493-30686515 GGACCCTCTGGGATCCTCCATGG + Intergenic
905242367 1:36589176-36589198 GGAGCCGATGGGTCCCTCCGGGG + Intergenic
906130087 1:43450724-43450746 GGACCCCTTGGGCCCTTCTGGGG + Exonic
906668866 1:47640596-47640618 GCACTCAATGGGACCCACTGTGG - Intergenic
907314202 1:53558199-53558221 GGGCCCTTTGTGTCCCTCTGTGG - Intronic
908169184 1:61487967-61487989 GGACCTAACGGGACCCACTGGGG + Intergenic
912716400 1:111987068-111987090 GCACCCTGTGGAACCCTGTGTGG + Intronic
913162031 1:116153155-116153177 GGACCCAGAGGCACCCTCTGTGG + Intergenic
1062946433 10:1465239-1465261 GAACCCTCTCGCACCCTCTGTGG - Intronic
1065961558 10:30738101-30738123 GGTGTCTATGGGACCCTGTGTGG - Intergenic
1067466385 10:46502108-46502130 GCACTCTCTGGGACCCTGTGGGG - Intergenic
1067620803 10:47882497-47882519 GCACTCTCTGGGACCCTGTGGGG + Intergenic
1071000827 10:80828588-80828610 GGCCCCTATGGGATCTGCTGTGG - Intergenic
1071676330 10:87659561-87659583 GGACGCTCTGGGACCCTCTGGGG + Intergenic
1076978899 11:195027-195049 GGACCCTGTGTGTACCTCTGTGG - Intronic
1077324938 11:1959614-1959636 GGGCCCTGTGAGACCCTCTCTGG - Intronic
1083037953 11:59657666-59657688 GGACCCTGGGGGGGCCTCTGAGG + Exonic
1087136461 11:94725626-94725648 GGAGCCTGTGGGAGCCTCTGAGG + Intronic
1089682978 11:120129778-120129800 GGACTCTCTGGGAAGCTCTGTGG - Intronic
1090995265 11:131860390-131860412 GGGCTCTGTGGGACCCTCTTGGG - Intronic
1202807920 11_KI270721v1_random:14793-14815 GGGCCCTGTGAGACCCTCTCTGG - Intergenic
1093763699 12:22938718-22938740 GCACCATATGGACCCCTCTGAGG - Intergenic
1094855956 12:34402913-34402935 GGACCCCGTGGGCCCCTCCGTGG - Intergenic
1095945050 12:47749019-47749041 GGTCCCTGTGGGACCCTCATGGG - Intronic
1098556602 12:71825680-71825702 TGACCCTATGGGAGCCTCGTGGG - Intergenic
1104903340 12:132200983-132201005 GGGCCGAGTGGGACCCTCTGGGG + Intronic
1105426827 13:20301728-20301750 GGAGCCCATGGGACCCGCGGAGG - Intergenic
1106215380 13:27693092-27693114 GGAACCCAGGGGACTCTCTGGGG + Intergenic
1108381147 13:49855584-49855606 GTTCCCTATGGGAGCCTCTGAGG - Intergenic
1113431982 13:110258993-110259015 GCAACCTATGGGATCCTTTGCGG + Intronic
1113664377 13:112131283-112131305 GGACCCCGTGGGATCCTCTGGGG - Intergenic
1114268907 14:21089726-21089748 GGAACCTCTGGGAGCCACTGTGG - Exonic
1118138210 14:63050749-63050771 GCATCCTATGGGAATCTCTGGGG + Intronic
1118726587 14:68633217-68633239 GGACCCCATGAAACTCTCTGGGG + Intronic
1121184872 14:91958072-91958094 GGACCCTGTGCTACCCTCTGTGG - Intergenic
1122541535 14:102500377-102500399 GTACCCCATGGTAGCCTCTGAGG + Exonic
1127702492 15:61514699-61514721 GGACCCCATGGGGAGCTCTGGGG + Intergenic
1129248812 15:74296906-74296928 GTTCCCCATGGGACCCGCTGTGG - Intronic
1129691771 15:77717858-77717880 GGCCCCCTTGGGCCCCTCTGAGG - Intronic
1132980555 16:2736831-2736853 GGACACTATGGGGGCCCCTGAGG - Intergenic
1138680529 16:58680679-58680701 GGTCCTTTTGGGACCCTGTGGGG - Intronic
1139266529 16:65645031-65645053 GGACCCTAGAGCACACTCTGAGG - Intergenic
1140032258 16:71348280-71348302 GGATCCCATGGGAAGCTCTGGGG + Intergenic
1142289663 16:89187782-89187804 GCAGCCCATGGGACCCTCTGAGG + Intronic
1142466389 17:139845-139867 GGACCCTGTGTGTACCTCTGTGG - Intergenic
1143017657 17:3899524-3899546 GGACCCTCTGCTCCCCTCTGGGG + Intronic
1144834249 17:18148637-18148659 GGACCCTATGGGACCCTCTGGGG - Intronic
1151691185 17:75686608-75686630 GGGCCCTCTGGGACACGCTGGGG - Intronic
1151733984 17:75927441-75927463 GGAGCCTATGGTACCTTCAGAGG + Exonic
1152218517 17:79048305-79048327 GAACCCTCTGGGACCTTCCGCGG + Exonic
1152403305 17:80082526-80082548 GGAGCCTGTGGTAGCCTCTGGGG - Intronic
1153833686 18:8945278-8945300 GGTGCCTATGAGACCCTGTGTGG - Intergenic
1155775558 18:29756355-29756377 GGACCCTATTGGAAACACTGAGG + Intergenic
1160017664 18:75156924-75156946 GCACCCTGTGGGACACTGTGTGG - Intergenic
1161204688 19:3034874-3034896 TGACCCTATGTGACCCTGGGAGG - Intronic
1161915924 19:7228047-7228069 GGACCCATGGGGGCCCTCTGGGG - Intronic
1164646312 19:29860945-29860967 GGACACCATGGGACCATCTCTGG - Intergenic
1202703931 1_KI270713v1_random:6723-6745 GGCCCCTGTGGGGCCCTGTGAGG + Intergenic
926057777 2:9785553-9785575 GGACTCCATGGCACCCTCAGCGG + Intergenic
935328853 2:101961885-101961907 CTACCCCATGGGACCCCCTGTGG + Intergenic
938180207 2:129175672-129175694 GGACCCTAGGTTACCCTTTGTGG - Intergenic
942640816 2:178059103-178059125 GGACTGTATGTGAACCTCTGAGG - Intronic
944227225 2:197360026-197360048 GGCCCCTAGGGGCCCTTCTGGGG - Intergenic
948933457 2:241147847-241147869 GAAACTGATGGGACCCTCTGCGG + Intronic
948963377 2:241356795-241356817 GGTCCCTATGGCCCACTCTGGGG - Intronic
1169868194 20:10222949-10222971 GCACCTTCTGGGACCTTCTGGGG - Intronic
1170572245 20:17638963-17638985 AGGCCCTCTGGGACCCTCAGAGG - Intronic
1173648081 20:44646074-44646096 GGTCCCTGTGGTACCCCCTGGGG - Intronic
1174364183 20:50046550-50046572 GGACTCTAGGGGATCCTCAGAGG + Intergenic
1175899670 20:62355029-62355051 GGACCCTGTGGGCCCGTCAGGGG - Intronic
1176268282 20:64222071-64222093 AGCTCCTAGGGGACCCTCTGTGG + Intronic
1180020337 21:45120594-45120616 GGACACACTAGGACCCTCTGAGG + Intronic
1180771479 22:18390471-18390493 GGACCCCCTGGAACCCTCGGGGG + Intergenic
1181935853 22:26437865-26437887 GGAGCATATGGGACTATCTGAGG + Intronic
953889937 3:46744059-46744081 GGGCCCTCTGGGTCCCTGTGAGG - Exonic
955620362 3:60856814-60856836 GGACCCTATTGTACTCTCTCAGG + Intronic
960672778 3:120168420-120168442 GGGCACTATGGAACCCTCGGCGG - Intronic
961448931 3:126993663-126993685 GCACCCTTTGGGAGCATCTGGGG + Intronic
962418146 3:135202408-135202430 GTACCCTATGGGGGCCGCTGAGG - Intronic
962928945 3:140019971-140019993 GGAACCTCTGGGGCCTTCTGTGG + Intronic
968504175 4:964378-964400 GGTCCTCATGGGACCCTTTGGGG + Intronic
976076357 4:81303515-81303537 GTACCCTAGAGGACCTTCTGTGG - Intergenic
984992084 4:185390854-185390876 GGACACTGAGGGACACTCTGTGG - Intronic
985729543 5:1539588-1539610 TGACCCTGTGTGACCCTGTGTGG - Intergenic
985729558 5:1539648-1539670 TGACCCTGTGTGACCCTGTGTGG - Intergenic
985894345 5:2739875-2739897 GAACCCGATGGGTCCCGCTGCGG + Intergenic
986316482 5:6592080-6592102 GCACCCCGTGGGACCCGCTGGGG + Intergenic
992106019 5:73449154-73449176 GGCCCCTGGGGGACGCTCTGGGG + Intergenic
994433527 5:99699074-99699096 GGACCCTATGCAGACCTCTGAGG + Intergenic
997136048 5:131327483-131327505 GGGCTTTATGTGACCCTCTGAGG + Intronic
997195204 5:131974632-131974654 GACCCCTATGGTACCTTCTGAGG + Intronic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1002871175 6:1168565-1168587 GGACCTTGTGGTAACCTCTGGGG - Intergenic
1004169925 6:13287925-13287947 GGACCCTATTGAATCCTGTGGGG + Exonic
1007118386 6:39360657-39360679 GGACCCTATAGGAGCTTCGGAGG + Intronic
1007145086 6:39621379-39621401 GAAGCCTATAGCACCCTCTGTGG + Intronic
1011188696 6:84707562-84707584 GGACCCTGAGGGACACTCTTGGG + Intronic
1011481245 6:87796109-87796131 GGACCCAATGGGACCCGAAGAGG - Intergenic
1014868128 6:126557082-126557104 GGACACTATGGGACATTCTAAGG - Intergenic
1016797204 6:148130923-148130945 GGGCCCTCTGGGCCCCTCTAGGG + Intergenic
1019498511 7:1352602-1352624 GGCTCCTTTGGGGCCCTCTGGGG - Intergenic
1020064138 7:5174683-5174705 GGACCCAAGGGGACCCTCCTAGG - Intergenic
1020261136 7:6531305-6531327 GGACCCTTTTGGTCGCTCTGGGG + Intronic
1022638500 7:32159895-32159917 GGAGCTTGTGGGAGCCTCTGGGG - Intronic
1023998229 7:45174984-45175006 AGACCCTGTGGGACCATGTGGGG + Intronic
1024554565 7:50592414-50592436 GGACCCTCTGGGAACATTTGGGG + Exonic
1026772758 7:73212645-73212667 GGTCCCTCTGGGACTCACTGAGG - Intergenic
1027013622 7:74766045-74766067 GGTCCCTCTGGGACTCACTGAGG - Intergenic
1027074416 7:75179988-75180010 GGTCCCTCTGGGACTCACTGAGG + Intergenic
1029635839 7:101783264-101783286 GGACTCTTGGGGGCCCTCTGGGG - Intergenic
1033022162 7:137736687-137736709 TGACCATATGGGATCTTCTGTGG + Intronic
1034511495 7:151539060-151539082 GTGCCCTAAGGGTCCCTCTGGGG + Intergenic
1034969489 7:155410249-155410271 GCACCCTTTGGGACTCCCTGAGG + Intergenic
1035203771 7:157281832-157281854 GGAACCGACGGGCCCCTCTGCGG + Intergenic
1036702335 8:11021033-11021055 GGACCCTAGGGGGTCCTATGAGG + Intronic
1037758613 8:21727411-21727433 GGGCCCTGTGTGACCCACTGGGG + Intronic
1037812483 8:22095251-22095273 GAAATCTGTGGGACCCTCTGAGG + Intronic
1038282967 8:26182331-26182353 AGACCCTATGGGGCCATCTAGGG - Intergenic
1039843945 8:41312443-41312465 GGGCCCTCTGTGACCCTCTGTGG - Intergenic
1041186945 8:55310884-55310906 TGACCCTATAACACCCTCTGTGG - Intronic
1042703013 8:71637423-71637445 GGACCCTATCAGACCATCTGTGG - Intergenic
1044203712 8:89466995-89467017 TGACCCAATGGTACCCTTTGGGG - Intergenic
1045172492 8:99686670-99686692 GGACCTTGTGGGAACATCTGTGG - Intronic
1045274867 8:100694687-100694709 GGACCCAAGGGAGCCCTCTGAGG + Intronic
1048636452 8:136301105-136301127 TGACCCTATGTGACCCTGTGTGG - Intergenic
1049280083 8:141739865-141739887 GGGCCTTGTGAGACCCTCTGGGG - Intergenic
1049517480 8:143068940-143068962 GGACCCTTGGGGTCCCCCTGGGG - Intergenic
1056810396 9:89759431-89759453 GGACCCTTTGGGATGCTTTGTGG + Intergenic
1056845075 9:90030549-90030571 GGACAATTAGGGACCCTCTGAGG + Intergenic
1060765664 9:126293665-126293687 AGACCCTGAGGAACCCTCTGTGG + Intergenic
1060913176 9:127367023-127367045 TGAAGCTATGGGAACCTCTGAGG - Intronic
1062321028 9:135990648-135990670 GCTCCCTGTGTGACCCTCTGAGG - Intergenic
1186190651 X:7064579-7064601 GGACCCTCTGGGCACCTCTCAGG - Intronic
1190877548 X:54470552-54470574 GGTCCCTAGGGCACCCTCTAGGG - Intronic
1198306729 X:135391100-135391122 GGACCCTGTGGGAGACTGTGTGG - Intergenic