ID: 1144834302

View in Genome Browser
Species Human (GRCh38)
Location 17:18148898-18148920
Sequence CTCTGTGCCCACAATGAAGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 164}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144834302_1144834307 -4 Left 1144834302 17:18148898-18148920 CCTACTTCATTGTGGGCACAGAG 0: 1
1: 0
2: 3
3: 10
4: 164
Right 1144834307 17:18148917-18148939 AGAGGGGCCTGCAGCCAGCAGGG 0: 1
1: 0
2: 6
3: 40
4: 434
1144834302_1144834308 -3 Left 1144834302 17:18148898-18148920 CCTACTTCATTGTGGGCACAGAG 0: 1
1: 0
2: 3
3: 10
4: 164
Right 1144834308 17:18148918-18148940 GAGGGGCCTGCAGCCAGCAGGGG 0: 1
1: 0
2: 2
3: 66
4: 529
1144834302_1144834319 26 Left 1144834302 17:18148898-18148920 CCTACTTCATTGTGGGCACAGAG 0: 1
1: 0
2: 3
3: 10
4: 164
Right 1144834319 17:18148947-18148969 CAAAGTGTAGGTAGCTATGGGGG 0: 1
1: 0
2: 0
3: 3
4: 118
1144834302_1144834318 25 Left 1144834302 17:18148898-18148920 CCTACTTCATTGTGGGCACAGAG 0: 1
1: 0
2: 3
3: 10
4: 164
Right 1144834318 17:18148946-18148968 CCAAAGTGTAGGTAGCTATGGGG 0: 1
1: 0
2: 0
3: 10
4: 119
1144834302_1144834314 23 Left 1144834302 17:18148898-18148920 CCTACTTCATTGTGGGCACAGAG 0: 1
1: 0
2: 3
3: 10
4: 164
Right 1144834314 17:18148944-18148966 CCCCAAAGTGTAGGTAGCTATGG 0: 1
1: 0
2: 0
3: 2
4: 64
1144834302_1144834312 14 Left 1144834302 17:18148898-18148920 CCTACTTCATTGTGGGCACAGAG 0: 1
1: 0
2: 3
3: 10
4: 164
Right 1144834312 17:18148935-18148957 CAGGGGAGGCCCCAAAGTGTAGG 0: 1
1: 1
2: 0
3: 10
4: 218
1144834302_1144834309 0 Left 1144834302 17:18148898-18148920 CCTACTTCATTGTGGGCACAGAG 0: 1
1: 0
2: 3
3: 10
4: 164
Right 1144834309 17:18148921-18148943 GGGCCTGCAGCCAGCAGGGGAGG 0: 1
1: 1
2: 6
3: 74
4: 649
1144834302_1144834316 24 Left 1144834302 17:18148898-18148920 CCTACTTCATTGTGGGCACAGAG 0: 1
1: 0
2: 3
3: 10
4: 164
Right 1144834316 17:18148945-18148967 CCCAAAGTGTAGGTAGCTATGGG 0: 1
1: 0
2: 0
3: 9
4: 82
1144834302_1144834306 -5 Left 1144834302 17:18148898-18148920 CCTACTTCATTGTGGGCACAGAG 0: 1
1: 0
2: 3
3: 10
4: 164
Right 1144834306 17:18148916-18148938 CAGAGGGGCCTGCAGCCAGCAGG 0: 1
1: 1
2: 2
3: 70
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144834302 Original CRISPR CTCTGTGCCCACAATGAAGT AGG (reversed) Exonic
901184801 1:7366069-7366091 CTCTGTGACCCCAATGTACTTGG + Intronic
901924201 1:12555556-12555578 TTCTGGGCCCACAGTGAAGAGGG + Intergenic
902005267 1:13226826-13226848 CTCAGTTCCCACAGTGAACTTGG + Intergenic
902024545 1:13372923-13372945 CTCAGTTCCCACAATGAACCTGG + Intergenic
902212610 1:14914488-14914510 CTCAGTGGCTACAAGGAAGTTGG - Intronic
903140352 1:21335420-21335442 TTCTGTCCCCACAATGAGGCAGG + Intronic
903794679 1:25919809-25919831 CTCTGAGCCCCTAATGAACTTGG - Intergenic
905844846 1:41220258-41220280 CTGCCTGCCCACAATGCAGTTGG - Intronic
906320125 1:44810488-44810510 CCCTGTGCCCACAGTGTAATGGG - Intronic
906986142 1:50685785-50685807 CTCTTTCCCCTCAATGAAGTTGG + Intronic
913541926 1:119829566-119829588 TTCTGTGCCCACAATTCACTGGG + Intergenic
913545249 1:119861372-119861394 TTCTGTGCCCACAATTCACTGGG - Intergenic
914360043 1:146926787-146926809 CTCTGTTCCCACAGAGAAATAGG - Intergenic
914978203 1:152386923-152386945 CTGTGTGCCCAGAACTAAGTAGG + Intergenic
915150267 1:153825173-153825195 CTCTTTCTCCCCAATGAAGTGGG + Intronic
916214983 1:162386443-162386465 CTCTGTCCACATAAGGAAGTTGG + Intronic
916498161 1:165364098-165364120 CTCTGTGCACAGAAGGAAATGGG + Intergenic
919109259 1:193197406-193197428 CTCACTGCCCAAAATAAAGTTGG - Intronic
920060300 1:203222647-203222669 ATCTGTGTGCACACTGAAGTGGG - Intronic
921166988 1:212514698-212514720 CTCTGTGCCGGCCATGAAGCCGG + Intergenic
922678818 1:227572734-227572756 CTCTGTGGCCACAAGGAACCAGG - Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1066598563 10:37078959-37078981 CTCTGTGTCTACAATGAAAATGG - Intergenic
1067777281 10:49172738-49172760 CTCTGTGCACACACTCAATTTGG - Intronic
1072262804 10:93697207-93697229 CTAGGTGCCCCCAATGCAGTAGG + Intronic
1073104427 10:101024097-101024119 CTCTGTGCCCACAATGAACATGG - Intronic
1076012083 10:126997208-126997230 CTCTCTGCCCTCAATGAGCTTGG - Intronic
1076315180 10:129534778-129534800 CTCTGTTCCCACAATGAAGCAGG - Intronic
1077912781 11:6587443-6587465 CTCTTTGCCCCCAATGTGGTGGG - Intronic
1078893683 11:15579590-15579612 CTCTGTGCCCACCTTGAGGGAGG - Intergenic
1080446925 11:32345984-32346006 CTCTCTGCCCACAGGGAAGGTGG - Intergenic
1081972272 11:47207701-47207723 CTCTGTGCCCAAGGTGAGGTTGG - Intergenic
1082113824 11:48306527-48306549 CTCAGTGCCACCAAAGAAGTGGG - Exonic
1083228309 11:61298807-61298829 CTCTGTCCCCACGGTGGAGTAGG - Intergenic
1085891338 11:80583574-80583596 CTCTGTGTCAACAATGAAAATGG + Intergenic
1087744173 11:101924386-101924408 CTCTGTGACCACAATGTAAGTGG - Intronic
1090208322 11:124897843-124897865 CTCTGAGCTCACAGTGAAGAGGG + Exonic
1091769958 12:3145103-3145125 CTGTGTGCTCACAAGGGAGTGGG - Intronic
1092552270 12:9515661-9515683 CTCTGTGTCTGCAATGAAGAAGG - Intergenic
1095204798 12:39427297-39427319 TGCTGTGCCTACAATGAACTTGG + Intronic
1096795970 12:54077776-54077798 CTCTGTGCCCAGAGGGAATTAGG + Intergenic
1097268950 12:57762463-57762485 CTCTCTGGCCACTATTAAGTGGG - Exonic
1097426875 12:59456848-59456870 CACTCTGCCCTCAATGAAGTTGG - Intergenic
1098304865 12:69092711-69092733 CTCAGTGCCAACCATGCAGTGGG - Intergenic
1099612473 12:84891685-84891707 CTCACTTCCCACAAAGAAGTGGG + Intronic
1099979023 12:89577348-89577370 ATCTGTGCTCACTATTAAGTTGG - Intergenic
1102745317 12:115244345-115244367 CTCTGTGCCCAGCACTAAGTAGG + Intergenic
1104772910 12:131375446-131375468 CACTGTGCCCAGAAGGAAGATGG - Intergenic
1106544768 13:30720924-30720946 ATTTGTGCCCACAGAGAAGTGGG - Intronic
1107773758 13:43815697-43815719 CTCTTTGTCCACAATCAAATGGG - Intergenic
1107860116 13:44652611-44652633 ATCCCTGCCCACAATGAACTTGG - Intergenic
1110543830 13:76734786-76734808 CACTGTGCCCAGCCTGAAGTAGG + Intergenic
1111236093 13:85410254-85410276 GACTGTGACCATAATGAAGTAGG + Intergenic
1117438165 14:55737383-55737405 ATCTGTGACCACAAAGGAGTAGG - Intergenic
1118147297 14:63153537-63153559 CCCTGTGACAACAATGGAGTTGG - Intergenic
1122467274 14:101942679-101942701 CTCTGTGGCCACACTGGGGTAGG + Intergenic
1123744738 15:23311164-23311186 TTCTGTGCTGACAAGGAAGTCGG - Intergenic
1126021509 15:44406542-44406564 TTCTGTGGCCACATTCAAGTTGG + Intronic
1126257082 15:46640497-46640519 CTCTGGGCCCAAGATTAAGTTGG + Intergenic
1128655952 15:69462244-69462266 CTCCGTGTCCAGAAGGAAGTGGG - Intergenic
1129404721 15:75308401-75308423 CTCTGTGCCCAGTACGCAGTAGG - Intergenic
1130779329 15:87018128-87018150 CACTGTGCCTACAATGGATTGGG + Intronic
1131986886 15:98051725-98051747 CTCTGTGCCTATAATGTAGTAGG - Intergenic
1132389480 15:101427911-101427933 CGCTATGCCCACGATGCAGTAGG + Exonic
1134045445 16:11097869-11097891 CCCTGAGCCAACACTGAAGTTGG - Intronic
1135304025 16:21353725-21353747 CTCTGTCCCCACAGTAGAGTTGG - Intergenic
1136035799 16:27539099-27539121 CTCAGTGCGCAGAATGAATTTGG + Intronic
1136300759 16:29332862-29332884 CTCTGTCCCCACAGTAGAGTTGG - Intergenic
1136705052 16:32180373-32180395 TTCTGTGCTGACAAGGAAGTCGG + Intergenic
1136762859 16:32749032-32749054 TTCTGTGCTGACAAGGAAGTCGG - Intergenic
1136805241 16:33121354-33121376 TTCTGTGCTGACAAGGAAGTCGG + Intergenic
1138046700 16:53732505-53732527 CACAGTTCCCACACTGAAGTAGG - Intronic
1140738103 16:77916856-77916878 CTCTTTGCCAACAACAAAGTGGG - Intronic
1141087929 16:81110167-81110189 CTCTGTGCCCACCAGGATGAGGG + Intergenic
1142062484 16:88039652-88039674 CTCTGTCCCCACAATAAAGTTGG - Intronic
1203065013 16_KI270728v1_random:1009352-1009374 TTCTGTGCTGACAAGGAAGTCGG - Intergenic
1144834302 17:18148898-18148920 CTCTGTGCCCACAATGAAGTAGG - Exonic
1145881348 17:28354946-28354968 CTGTGTGCCTACAATGGACTAGG - Intronic
1146800084 17:35811927-35811949 CCCAGTGCCAAAAATGAAGTAGG + Intronic
1147044111 17:37740367-37740389 CCCTGATCCTACAATGAAGTAGG + Intronic
1148830335 17:50426637-50426659 CTCTGTGCCCATAAAGGAGAAGG - Intronic
1149466110 17:56880430-56880452 CTCAGTGTCCAGAATGAAGTGGG - Intergenic
1149565259 17:57636577-57636599 CTCTGTGCTCTCACTGAACTAGG - Intronic
1151468847 17:74305223-74305245 CTCGGTCCCCACCATGAACTTGG - Exonic
1153341606 18:3980445-3980467 ATTTGTGTCCAAAATGAAGTGGG + Intronic
1153504403 18:5780757-5780779 CTCTATGGGCACAATGAAGCAGG - Intergenic
1153978211 18:10287819-10287841 GTCTGTGCCCACTTTGAAGGAGG + Intergenic
1156478505 18:37421464-37421486 ATCTCTGCCTACAATGAAGAAGG + Intronic
1157103326 18:44749921-44749943 CTTTGAGCTCACAATGAAGAAGG + Intronic
1157572282 18:48721048-48721070 CCCTGTGCCCACCAGGCAGTGGG + Intronic
1158621243 18:59034408-59034430 CTTTGTGCCCACAATGTTGAAGG + Intergenic
1160143773 18:76348052-76348074 CTCTGAGCCCAAGATGAAGGGGG + Intergenic
1162736227 19:12748569-12748591 CTCTGAGCCTCCAAGGAAGTGGG - Intergenic
932969680 2:76525429-76525451 CTCTGTGTCAAGAATGAAGCAGG + Intergenic
933940239 2:87239163-87239185 CTGTTTGGCCACACTGAAGTTGG - Intergenic
934079573 2:88456168-88456190 CTCTGCGCCCAGCATGATGTTGG - Intergenic
934521452 2:95022645-95022667 CTCTGGGAACACAAGGAAGTGGG - Intergenic
935782463 2:106520075-106520097 TTCTAAGCCCACACTGAAGTTGG - Intergenic
936352899 2:111726613-111726635 CTGTTTGGCCACACTGAAGTTGG + Intergenic
939124472 2:138159638-138159660 CTCTGTGGGAACAATAAAGTAGG - Intergenic
942689111 2:178566423-178566445 GTCTGTGCCCTCAACAAAGTTGG - Exonic
943267034 2:185745150-185745172 CACTGGGCACAGAATGAAGTGGG - Intronic
944533801 2:200690040-200690062 CTCTGTGCCAACAACCAACTGGG + Intergenic
946061084 2:216942075-216942097 CTCTGTGCCAGGAATGAAGATGG - Intergenic
946702003 2:222424124-222424146 CTCTGAGCCCAAGGTGAAGTCGG - Intergenic
1170372249 20:15662047-15662069 CTCTTTACCCACGCTGAAGTTGG + Intronic
1170869850 20:20195560-20195582 CTCTGTCCCCACACTGCACTGGG - Intronic
1172956636 20:38764521-38764543 CTCTATGACCACAATGAACCTGG - Intronic
1174707657 20:52673693-52673715 CTCTGATCCTACAATCAAGTTGG - Intergenic
1175368397 20:58470814-58470836 CTCTGTGGCCACAGTGGGGTTGG - Intronic
1177500632 21:21950080-21950102 GTCTGGGCCCTCAATGAATTGGG + Intergenic
1180998658 22:19977799-19977821 CGCAGTGACCACACTGAAGTGGG - Intronic
950785261 3:15428530-15428552 CTCTTTACCCACAAGGAACTTGG - Intronic
951933279 3:27993828-27993850 CTCTGTGCCAGCATGGAAGTGGG + Intergenic
952593142 3:34981426-34981448 CTCTATACCCATATTGAAGTTGG + Intergenic
953718599 3:45336305-45336327 TGCTGTGCCCACCATGAAGAAGG - Intergenic
956613799 3:71151363-71151385 CTTTGTTCCCACATTGAACTAGG - Intronic
957934162 3:86920967-86920989 CTCTGTGACCAGAATGAGATTGG + Intergenic
962983790 3:140515702-140515724 CTCTCAGACCACAATGAAATTGG - Intronic
964956943 3:162370965-162370987 CTCTGTGACCACAAAGAAGAAGG - Intergenic
965648566 3:170909395-170909417 CTCTGGACCCACAATGCCGTAGG - Intergenic
965961044 3:174428988-174429010 CTCTGTGCCCATTATGTAGTAGG - Intergenic
969477576 4:7430175-7430197 CACTGTTCCCACATTGAAGGTGG + Intronic
969595723 4:8148362-8148384 CTCTGGGCCTACAGTGAAGCAGG + Intronic
969682381 4:8650438-8650460 CTGTGTGCCCACCGTTAAGTTGG + Intergenic
974082715 4:57229451-57229473 CTCTGTGCCTTCAATAAAATGGG - Intergenic
976426707 4:84912426-84912448 CCCTGTGCCCACAATAAAGCTGG - Intronic
977860090 4:101946996-101947018 CTCTTTGCCCAAAATGTAATTGG - Intronic
978244454 4:106556301-106556323 CTCAGTGCCAACCATGCAGTGGG - Intergenic
983134688 4:164065958-164065980 GTGTGCACCCACAATGAAGTTGG + Intronic
989524331 5:42435886-42435908 CTTTGTGCCCAGCATGATGTTGG - Intronic
990717238 5:58650978-58651000 CTCTGTGCCAAGACTGAACTGGG + Intronic
990792226 5:59495167-59495189 CTCCTTGACCACACTGAAGTCGG + Intronic
992170786 5:74099837-74099859 CTCTGTGCCCAGGAGGAAATGGG + Intergenic
992669563 5:79045306-79045328 CTCTGTGCTAACGGTGAAGTGGG - Intronic
994624314 5:102198868-102198890 TTAAGTGCCCACTATGAAGTAGG - Intergenic
994624367 5:102199870-102199892 TTAAGTGCCCACTATGAAGTAGG + Intergenic
997884742 5:137620110-137620132 CTCTGGTCTCACTATGAAGTGGG - Exonic
1001050960 5:168414151-168414173 CCATGTGCCAACAATGAAGTAGG - Intronic
1001194021 5:169655278-169655300 CTCTGTGCCCTCCATGCAGCAGG - Intronic
1003101039 6:3176767-3176789 CTCTGGACCCACCATGAAGCAGG + Intergenic
1005180424 6:23098073-23098095 CTCTGTGCCTACAATCAATGGGG + Intergenic
1010733168 6:79412417-79412439 CTCTGTGTACACAGTGACGTGGG - Intergenic
1011917224 6:92522148-92522170 CTCTGTGACCACACTGGAGATGG - Intergenic
1016989569 6:149919979-149920001 CTCTTTGCCCTCATGGAAGTGGG - Intronic
1019780942 7:2939323-2939345 CTCTGTGCCCACAAGTGACTCGG + Intronic
1027911612 7:84259376-84259398 TTCTGTTCTCAGAATGAAGTGGG - Intronic
1028177423 7:87674416-87674438 CTCTGTGCCCACACATCAGTGGG + Intronic
1032802780 7:135329741-135329763 CTGTGTCCCCACAAAGAAGAGGG - Intergenic
1036045511 8:5135611-5135633 CTCTGTGCCCAGGCTGCAGTGGG + Intergenic
1037661740 8:20933771-20933793 CTCTTTGCCCACTCTGAAGCCGG + Intergenic
1038291659 8:26255096-26255118 CTCTTTATCCACAAAGAAGTAGG + Intergenic
1041042883 8:53864616-53864638 CTCTGTGCCCACTATGTACGAGG - Intronic
1041483045 8:58344465-58344487 ACCTGTGTCCACAATGAAGATGG - Intergenic
1041564800 8:59264505-59264527 CTCTGTGCACACAAGGAATGAGG - Intergenic
1042810577 8:72821471-72821493 CTCCGTTTCCACTATGAAGTAGG + Intronic
1044274822 8:90286675-90286697 CTCTGTGCACACATAGAAATTGG - Intergenic
1045649101 8:104326388-104326410 CTCTGTGCCCCCACTAAATTAGG + Intergenic
1046733116 8:117747494-117747516 CTCTGTGTTCACATTAAAGTTGG - Intergenic
1047251237 8:123183167-123183189 CTCTGAGGCCACAGGGAAGTAGG - Exonic
1047510905 8:125514605-125514627 CTCTCTGCACACTATGAATTGGG - Intergenic
1048053206 8:130838882-130838904 CTCTGTACCCACATTGCATTTGG - Intronic
1052887084 9:33660159-33660181 CTCTGGGACCACATGGAAGTAGG - Intergenic
1056001723 9:82224685-82224707 CTCTGTGTCCACACAGAAGCAGG + Intergenic
1056690517 9:88804429-88804451 TTCTGTGCTCACCAGGAAGTAGG - Intergenic
1056889067 9:90472436-90472458 TTCTGTGATCACAATGAAGCTGG + Intergenic
1057568728 9:96187208-96187230 CTCTGTGCTGGCAATAAAGTTGG - Intergenic
1057722715 9:97545855-97545877 CTCTGTGCTCAGACTGGAGTCGG + Intronic
1058513727 9:105748168-105748190 CTTTGTGGCCACAATAAAGATGG - Exonic
1059015344 9:110509835-110509857 TTCTGTGCTCATAATGAATTTGG + Intronic
1185697877 X:2209005-2209027 CTGTGTGCTCACAAGGCAGTGGG + Intergenic
1190570944 X:51780650-51780672 CTGAGTGCCCACAATGTACTAGG - Intergenic
1192024602 X:67435871-67435893 CTCTGTGCCTCCACTGAAGGTGG - Intergenic
1196610068 X:117702704-117702726 CTGTGTACCAGCAATGAAGTAGG - Intergenic
1196737048 X:118989278-118989300 CTCTGTGTCCACTATGAGTTCGG + Intronic
1199608649 X:149595617-149595639 CTCTGTGCCCAGAATCGAGTCGG - Intergenic
1199630473 X:149773743-149773765 CTCTGTGCCCAGAATCGAGTCGG + Intergenic
1201334628 Y:12867378-12867400 CACTTTTCCCACAATTAAGTAGG - Intergenic