ID: 1144838760

View in Genome Browser
Species Human (GRCh38)
Location 17:18172735-18172757
Sequence TTGGATACACAGAGATACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 2, 1: 3, 2: 11, 3: 32, 4: 219}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144838760_1144838767 16 Left 1144838760 17:18172735-18172757 CCCTGGTATCTCTGTGTATCCAA 0: 2
1: 3
2: 11
3: 32
4: 219
Right 1144838767 17:18172774-18172796 ACATCTGTCATATTGGAGTAGGG 0: 1
1: 8
2: 85
3: 596
4: 1667
1144838760_1144838762 -7 Left 1144838760 17:18172735-18172757 CCCTGGTATCTCTGTGTATCCAA 0: 2
1: 3
2: 11
3: 32
4: 219
Right 1144838762 17:18172751-18172773 TATCCAAATTTCCTCTTATAAGG 0: 2
1: 12
2: 36
3: 113
4: 386
1144838760_1144838766 15 Left 1144838760 17:18172735-18172757 CCCTGGTATCTCTGTGTATCCAA 0: 2
1: 3
2: 11
3: 32
4: 219
Right 1144838766 17:18172773-18172795 GACATCTGTCATATTGGAGTAGG 0: 1
1: 7
2: 82
3: 545
4: 1519
1144838760_1144838765 9 Left 1144838760 17:18172735-18172757 CCCTGGTATCTCTGTGTATCCAA 0: 2
1: 3
2: 11
3: 32
4: 219
Right 1144838765 17:18172767-18172789 TATAAGGACATCTGTCATATTGG 0: 3
1: 62
2: 449
3: 1275
4: 2250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144838760 Original CRISPR TTGGATACACAGAGATACCA GGG (reversed) Intronic
900813626 1:4826687-4826709 ATGGAGACACAGACATTCCATGG - Intergenic
905003927 1:34695288-34695310 TTGGAGGCAAAGAGACACCAGGG - Intergenic
905276173 1:36819582-36819604 TTGGAGACATCGAGATACCCAGG - Intronic
912630429 1:111242189-111242211 AAGGATACACAGAGATTCGAAGG - Intronic
913397511 1:118388527-118388549 TAGGAAACTCAGAGATTCCAGGG + Intergenic
917145630 1:171887531-171887553 TTTGCTACACTGAGATACCCTGG - Intronic
917838011 1:178956101-178956123 TGGGACACACAGAGAGACCAGGG + Intergenic
918129498 1:181613088-181613110 TTTGATACAAAGAGATACAATGG - Intronic
918545039 1:185672761-185672783 TTGGTTACACAGTGTTATCAGGG - Intergenic
918630353 1:186710022-186710044 TTGGATTTCCAGAGATAGCAAGG - Intergenic
919348559 1:196418644-196418666 TAGGATATACAGAGATACCAGGG - Intronic
920712956 1:208312593-208312615 TTGGATAAACAGATATGCCCTGG + Intergenic
921554283 1:216578450-216578472 TTGGATAAACAGAGAGACTGTGG - Intronic
922653814 1:227363669-227363691 TTAAATACTCAGAGATCCCAGGG - Intergenic
922889991 1:229054570-229054592 TTGGTTACACAGGGAAACCTCGG - Intergenic
924102290 1:240617296-240617318 ATGGATACACACAGAAACAAAGG - Intergenic
1064006101 10:11700321-11700343 TTGGACACACAGAGACACCAGGG + Intergenic
1065990584 10:31006036-31006058 TAGGGTAGACAGAGATTCCAGGG - Intronic
1067297915 10:44985286-44985308 CTGGATACACAGTGTTCCCAGGG - Intronic
1068137927 10:52969225-52969247 TTGGATACACATAGACACAAAGG - Intergenic
1068719035 10:60221631-60221653 TTTGATAAATAGAGATTCCAAGG + Intronic
1069569961 10:69488459-69488481 GTAGATACTCAGAGTTACCAGGG - Intronic
1071018490 10:81025318-81025340 TTTGATACACAGATATACATGGG - Intergenic
1071379889 10:85047995-85048017 TTGGAGACCCAGAGAAAGCATGG - Intergenic
1071615493 10:87071598-87071620 TTTGGTACACAGAGATATAAGGG + Intronic
1072314912 10:94192551-94192573 TTGGATATACGTATATACCATGG - Intronic
1072473735 10:95738242-95738264 ATGCACACACAGAGATTCCAGGG - Intronic
1073993522 10:109290768-109290790 TTGGAGACACACAGTTACAAAGG - Intergenic
1074324705 10:112438485-112438507 TTCCATAGACAAAGATACCAAGG + Intronic
1075518475 10:123128920-123128942 TTGGAAACTCAGAGAGAGCATGG + Intergenic
1076045615 10:127292026-127292048 TTGGACACACAGACTTTCCAAGG - Intronic
1077952663 11:6977596-6977618 TTGGACCCACAGAGAGACCTAGG + Intronic
1078326508 11:10385916-10385938 ATGGATTCACAGAGCTGCCAGGG - Intronic
1081124417 11:39305313-39305335 TTGGGTACACAAAAATCCCATGG + Intergenic
1082781060 11:57287700-57287722 TTGGACACACGGACACACCAGGG + Intergenic
1083067011 11:59934765-59934787 GTGAACACACAGGGATACCAGGG + Intergenic
1083700371 11:64473488-64473510 GTGGAGCCACAGAGACACCAGGG - Intergenic
1083781965 11:64923422-64923444 TTGGACAGACAGGGACACCAAGG + Intronic
1086676088 11:89608664-89608686 CTGGACACACAGACATCCCAGGG - Intergenic
1087995951 11:104809463-104809485 TTGGATTCACACAGATGCCTGGG + Intergenic
1089496678 11:118911546-118911568 CTGGAGTCACTGAGATACCAGGG + Intronic
1089586544 11:119513183-119513205 CTGGAGGCACAGAGACACCAGGG - Intergenic
1090621330 11:128563614-128563636 TTGGATAAACAGCCACACCACGG + Intronic
1093291362 12:17326788-17326810 TTGAATACTCAGAGATAAGAGGG + Intergenic
1093338746 12:17944352-17944374 TTGGATACACTGAGTTAATATGG - Intergenic
1093825416 12:23679858-23679880 TTAGATACCCAAAGATATCAAGG + Intronic
1094444659 12:30516538-30516560 TTAGAGGCACATAGATACCAGGG - Intergenic
1097278657 12:57830600-57830622 TTGGTAAAACACAGATACCATGG + Intronic
1097947803 12:65391431-65391453 TTGGTTAAACAGAGATATCCAGG + Intronic
1100696115 12:97096002-97096024 ATTGAAACACAGTGATACCAAGG + Intergenic
1101002663 12:100372317-100372339 TTGGACACACAGAGACACCAGGG - Intronic
1101414461 12:104497304-104497326 TTGGATGCACGGAGGCACCACGG + Intronic
1103849493 12:123922760-123922782 TTGGACACACAGAGACACCAGGG - Intronic
1104526568 12:129529447-129529469 TTGGACACAGAGAGAGAGCATGG - Intronic
1104947688 12:132423919-132423941 CTGGATCCACAGAGAGAACATGG + Intergenic
1108564475 13:51681847-51681869 TTTGATTCACACAAATACCAAGG - Intronic
1110941365 13:81354115-81354137 GTGGATTCACAGAGATTCCAGGG - Intergenic
1110947005 13:81434694-81434716 TTGCAAACACAGAAATCCCAAGG + Intergenic
1111975754 13:94965700-94965722 TTGGGTACACAGATGTATCAAGG + Intergenic
1112694943 13:101937414-101937436 CTGGACACACAGAGATCCCAGGG + Intronic
1114396583 14:22368632-22368654 ATGTATACACATATATACCATGG + Intergenic
1114728200 14:24961834-24961856 TTGAACACAGAGAGAAACCAGGG - Intronic
1117065613 14:52010883-52010905 TTGGATCCACAGCGATGGCACGG + Exonic
1117410130 14:55442869-55442891 CTGGACACACAGAGACACCAGGG + Intronic
1117505997 14:56403604-56403626 TTGGATACACATGGACACAAAGG - Intergenic
1119731091 14:76951516-76951538 TTGGACACACAGAGAGAAAATGG - Intergenic
1119999425 14:79285635-79285657 TTGGACACACAAAGACACCAGGG - Intronic
1120547940 14:85832904-85832926 TTGGATACACATAAACACCTGGG + Intergenic
1121832815 14:97066470-97066492 TTGGATACACAGAGAAAGTCAGG - Intergenic
1123160062 14:106269465-106269487 TTACATACGCAGAGAAACCATGG + Intergenic
1123175285 14:106410795-106410817 CTGCAAACACAGAGACACCAAGG + Intergenic
1123186176 14:106518883-106518905 CTGCAAACACAGAGACACCAAGG + Intergenic
1123200420 14:106658030-106658052 CTGCAAACACAGAGACACCAAGG + Intergenic
1202943404 14_KI270726v1_random:4984-5006 CTGCAAACACAGAGACACCAAGG - Intergenic
1125071849 15:35564264-35564286 GTGGATACACAAAGAGACCCTGG - Intergenic
1125427937 15:39568310-39568332 TTGGACACTCAGGGACACCAGGG - Intergenic
1125444104 15:39735044-39735066 TTTGATACGCAGTGAGACCATGG + Intronic
1126332796 15:47551583-47551605 TTGGAAGCACAGAGATATGAAGG - Intronic
1127688317 15:61370123-61370145 TTGGATACACTGAGAGATAAGGG + Intergenic
1127719485 15:61685838-61685860 ATGGCTACACAGAGAGAACAGGG - Intergenic
1128084651 15:64877565-64877587 TTGAATCCGCAGAGATGCCAAGG + Intronic
1128888808 15:71312436-71312458 TAGGACATACAGAGACACCAGGG + Intronic
1129520911 15:76185907-76185929 TTGGACACACAGTGAAACCAAGG + Intronic
1131375705 15:91921225-91921247 TTGGATACACAGAGAGACCAGGG - Intronic
1131701507 15:94942108-94942130 TTGGAAATACAGAGATTCCCTGG + Intergenic
1131968944 15:97873472-97873494 TTGGACACACAGAGATACCAGGG - Intergenic
1134767912 16:16777869-16777891 CTGGATCTACAGATATACCAAGG - Intergenic
1135344798 16:21679934-21679956 CTGCATACAGACAGATACCAGGG + Intronic
1136689551 16:32019336-32019358 TTGCAGAGACAGAGTTACCAAGG - Intergenic
1136790138 16:32962894-32962916 TTGCAGAGACAGAGTTACCAAGG - Intergenic
1136879675 16:33891034-33891056 TTGCAGAGACAGAGTTACCAAGG + Intergenic
1137774660 16:51045035-51045057 TTGGACACACAGAGAGACACCGG + Intergenic
1137898833 16:52243323-52243345 GTGGATACACAGTGACAGCAGGG + Intergenic
1138585302 16:57965896-57965918 GTGCACACACAGACATACCAAGG + Intronic
1139638452 16:68273747-68273769 TTGCAGACACAGTGATACCCAGG + Intronic
1203092345 16_KI270728v1_random:1224348-1224370 TTGCAGAGACAGAGTTACCAAGG - Intergenic
1144169036 17:12640901-12640923 TTGGACATACAGAGTCACCAGGG - Intergenic
1144838760 17:18172735-18172757 TTGGATACACAGAGATACCAGGG - Intronic
1146888344 17:36487121-36487143 TCCGACACACAGAGACACCAGGG - Intronic
1147152396 17:38525477-38525499 TTGCAGAGACAGAGTTACCAAGG - Intergenic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1150312550 17:64140807-64140829 TTGGATACAGAGACACACGAGGG - Intergenic
1151121750 17:71800581-71800603 TTCCATACACAGAAATAACATGG - Intergenic
1153643067 18:7172280-7172302 CTGGAGACACAGGGCTACCAGGG + Intergenic
1155797693 18:30060398-30060420 AGGGATACACAGAGAAACCTCGG + Intergenic
1156260110 18:35438627-35438649 TGGGAGACACAGAGTTCCCAGGG - Intergenic
1157530465 18:48416145-48416167 TTGGAAACACAGAGACACACAGG + Intergenic
1157578069 18:48757118-48757140 TTTGACACACAGAGACACCAGGG - Intronic
1158119695 18:54035234-54035256 CTGTATAAACAGAGATATCATGG + Intergenic
1158518264 18:58148606-58148628 TTGGACACACAGAGAGACACTGG - Intronic
1159913412 18:74167218-74167240 CTGGGCACACAGAGACACCAGGG + Intergenic
1160017049 18:75152684-75152706 CTGGAGACAAAGAAATACCACGG + Intergenic
1161191375 19:2958889-2958911 ATGGATACACAGACTTACCCAGG - Intergenic
1161737216 19:5998757-5998779 TTGGGAACCCAGAGATACCGGGG - Intronic
1165403808 19:35618174-35618196 TTGGCGACACAGAGATATCCAGG + Exonic
1168570807 19:57467468-57467490 TAAGACACACAGAGACACCAGGG + Intronic
925472338 2:4175799-4175821 TTGCATACACAGAGAGGACAGGG + Intergenic
925679008 2:6397168-6397190 TTGGATACACAGAGATACCAGGG - Intergenic
926936732 2:18093352-18093374 TTTGACACACACAGATGCCAGGG + Intronic
929050419 2:37831753-37831775 TTGGAAACACTGAGATAAAAAGG - Intergenic
931503692 2:62900151-62900173 TTGGAGAAACACAGATATCATGG + Intronic
936415413 2:112304531-112304553 TTGGACACAGAGAAACACCAGGG - Intronic
936933780 2:117818237-117818259 TTGTATAAGCAGAGATATCAAGG + Intronic
937154978 2:119712494-119712516 TTGGATACACAGAGACACCAGGG + Intergenic
937888286 2:126915414-126915436 TTGGGTATACAGAGGCACCAGGG - Intergenic
938962215 2:136354068-136354090 TTGGACACACAGAGATATCAGGG + Intergenic
940089381 2:149898728-149898750 TGGGACACACAGAAATACCAGGG + Intergenic
944072724 2:195691210-195691232 ATAGATACACATATATACCATGG - Intronic
944161128 2:196661430-196661452 TTGGACACACAGAGACACCAGGG - Intronic
946809483 2:223508372-223508394 TTGGTGACTCAAAGATACCATGG + Intergenic
947070426 2:226282097-226282119 GTGCACACAGAGAGATACCAGGG + Intergenic
948653183 2:239461926-239461948 TTGGAGACACAGAGAGAGAATGG + Intergenic
1168827893 20:826184-826206 TTGGACAGACAGTGATACCTTGG + Intergenic
1169663865 20:8011910-8011932 TTGGAAATACAGAGACACGAAGG - Intronic
1169704425 20:8486239-8486261 AGGGATACACTGAGATACAAGGG + Intronic
1170204285 20:13781661-13781683 CTGGACACACAGAGCTCCCAGGG - Intronic
1172035286 20:32006345-32006367 TTGGACACACCGAGACAGCAGGG - Intergenic
1172677438 20:36683750-36683772 TTGGATACTGACAGCTACCAAGG - Intronic
1173646935 20:44639229-44639251 GTGGATAGAAAGAGATGCCAAGG + Intronic
1173691103 20:44961780-44961802 TTGGATAAACAAAGATAAAAAGG - Intergenic
1175634712 20:60570768-60570790 TTGGATATTCAGAGTTACCCTGG - Intergenic
1175984827 20:62759395-62759417 TTGGATGCACAGAGCTGCGAAGG + Intronic
1178142417 21:29699381-29699403 CTGGACACACAGATATACCAGGG + Intronic
1178942611 21:36919373-36919395 TTGGATACCTAGCAATACCATGG - Intronic
1179203900 21:39254930-39254952 TTGGTTATACTGAGAAACCAAGG + Intronic
1181479610 22:23190139-23190161 TTGGACACAGAGAGATGCCAGGG - Intronic
1182704487 22:32268194-32268216 TTATATACATAGAGATATCAGGG - Intergenic
949601980 3:5610157-5610179 TTGGATACCCAGAGAGAAAAAGG + Intergenic
949735226 3:7164042-7164064 TTTGATAAACATAGAAACCATGG - Intronic
950625582 3:14244334-14244356 TTGGACACACAGAGACCCCAGGG - Intergenic
952657010 3:35799045-35799067 TTGAACACACAGAGATAGGATGG + Intergenic
952726866 3:36595741-36595763 TTGGATCCAGAGAGAGACCGAGG + Intergenic
958163141 3:89843850-89843872 TTACCTACACAGAGATAGCAAGG + Intergenic
961658685 3:128457063-128457085 ATGGAGACACAGAGATGCCAAGG - Intergenic
962000390 3:131289222-131289244 TTGAACTCACAGAGACACCAGGG - Intronic
962014772 3:131428547-131428569 TTGGACACACAGAGAGACAGTGG + Intergenic
962476957 3:135763314-135763336 ATTGCTACACAGAGATATCAGGG + Intergenic
962643355 3:137411584-137411606 TTGGAAAGACAGAGACACCTAGG - Intergenic
967000058 3:185325753-185325775 TTTCATACACTGAGATGCCATGG - Intronic
967696548 3:192538395-192538417 TTGCATAAACAAAGATGCCAAGG - Intronic
967755118 3:193160010-193160032 TTGGACACTCAGAGATATCAGGG + Intergenic
968282413 3:197487029-197487051 TCAGGTACACAGAGATACAAAGG + Intergenic
971031814 4:22646013-22646035 TTGAAGACACAGGGATAACACGG - Intergenic
971612932 4:28749173-28749195 CTGGATGCCCAGAGATCCCAAGG - Intergenic
973113913 4:46430613-46430635 TTGGATACACAGAGATAATTTGG + Intronic
973925345 4:55731374-55731396 TTAAATACCCATAGATACCAGGG + Intergenic
974496580 4:62636132-62636154 TTGAGTACACAGAGATATAAAGG + Intergenic
975499836 4:75072571-75072593 TAGGATCCAAAGAAATACCAAGG - Intergenic
976201977 4:82587957-82587979 TAGGACACACAGAGACACCAGGG - Intergenic
977064014 4:92290394-92290416 ATTGATACACAGAAATACAAAGG - Intergenic
977303887 4:95299212-95299234 TTGGACACACAGAGACACCAGGG + Intronic
977384839 4:96325794-96325816 TTGTCAGCACAGAGATACCAGGG - Intergenic
978971183 4:114807867-114807889 TGGGATACACTGAGGTCCCACGG - Intergenic
979996449 4:127437510-127437532 TTTTATTTACAGAGATACCAAGG - Intergenic
980666002 4:135936349-135936371 TTGGGTACACACAGACACAAAGG + Intergenic
981276612 4:142906041-142906063 TTGGTAACACAGATATACCAAGG - Intergenic
981927774 4:150158217-150158239 GTGGACACACACAGATGCCAGGG - Intronic
982103446 4:151990910-151990932 TTGAATGCACAGAGACAGCAGGG - Intergenic
983916872 4:173301763-173301785 TTAAATCCACAGAGGTACCAAGG + Intronic
984958839 4:185074231-185074253 TTGTATAGACAGAGAAACTAAGG + Intergenic
986424476 5:7616903-7616925 TAGGACACACAGAGACACCAGGG + Intronic
986860342 5:11920147-11920169 TTGGATGCACAGAGACACCAGGG - Intergenic
987624524 5:20381064-20381086 TAGGATACACAGAGAAACACAGG + Intronic
987765778 5:22227309-22227331 CTAGATACTCAGAGATCCCAAGG + Intronic
989164251 5:38419115-38419137 TTGGACATACAGACATACCAGGG - Intronic
990362029 5:55030334-55030356 TTGTATACACAGAGAAACAAGGG - Intronic
990464076 5:56055938-56055960 ATGGATACACATAGAGAACAGGG - Intergenic
992764845 5:79988297-79988319 TTAGATATACAGAGATGCCAAGG - Exonic
993080853 5:83298560-83298582 GTGAATAAACAGATATACCAGGG - Intronic
993300192 5:86199152-86199174 TTGGACGCACAGAGATGCCAAGG - Intergenic
995590198 5:113691698-113691720 TTTGATACACAGAGATGGAAAGG - Intergenic
999942860 5:156563381-156563403 TCTGAGACACAGAGAGACCAAGG + Intronic
1000397136 5:160787780-160787802 TTTGATAGACAGGGAAACCAAGG - Intronic
1000478135 5:161737805-161737827 TTGGGTAAACAGGGATTCCAAGG + Intergenic
1000610265 5:163366026-163366048 TAGGATTTACAGAGATAACATGG + Intergenic
1001209270 5:169795078-169795100 TTAGAAACACAGAGACAGCAGGG - Intronic
1001345645 5:170895820-170895842 TTGGATACACAGAGCTAAATGGG - Intronic
1002665308 5:180819067-180819089 AGGGCTACACAGAGATGCCATGG + Intergenic
1002693430 5:181067113-181067135 ATGGATACACAAAGATAGCAGGG + Intergenic
1003705873 6:8528394-8528416 GTGGAATCACAGAGATACAATGG + Intergenic
1003716231 6:8649417-8649439 TGGGACACAGAGAGATACCAGGG - Intergenic
1005125915 6:22446609-22446631 TTGGAATCACAGAGTTACCTGGG - Intergenic
1005486964 6:26309693-26309715 TTTGTTATACAAAGATACCATGG - Intergenic
1007839987 6:44708245-44708267 TTGGATACACAGACAGACACAGG - Intergenic
1011850466 6:91621432-91621454 TTGAATAAAGAGAGATACAAGGG - Intergenic
1011973372 6:93258181-93258203 TTGGTTACACAGAAAAACAAAGG - Exonic
1012629703 6:101449670-101449692 CTGGAGACACAGAGACACAAAGG - Intronic
1013656234 6:112249621-112249643 TTTGATACACATAGAAACCGAGG - Intronic
1014660011 6:124158232-124158254 TAGGACACACAGCGACACCAGGG - Intronic
1015638370 6:135303643-135303665 TTGGAGGCCCAGAGTTACCAAGG + Intronic
1015789447 6:136951701-136951723 CCGGAGTCACAGAGATACCAAGG - Intergenic
1016516385 6:144897138-144897160 TTGGACACACAGAGACACTAGGG - Intergenic
1017017087 6:150110187-150110209 TTGGACACACAGAGATGCCAGGG + Intergenic
1019006170 6:168798592-168798614 TAGGATGCACAGAGAGACCCTGG + Intergenic
1019008672 6:168824741-168824763 TTGGACACACAGAGATACTGGGG + Intergenic
1019541686 7:1554540-1554562 TCAGATACACAGAGAGGCCAGGG - Intronic
1021213238 7:17882829-17882851 TAGGAGACACAGTGAGACCAAGG + Intronic
1021225403 7:18020610-18020632 TTGGAGAGACAGAGACACAAGGG - Intergenic
1023383593 7:39632937-39632959 TTGTATAAACTGAGAAACCATGG - Intronic
1024207229 7:47174219-47174241 TTGGGTGCACAGAGACAGCATGG - Intergenic
1024857523 7:53798721-53798743 TTGGAGATACACAGATGCCAAGG - Intergenic
1026481725 7:70785290-70785312 TCGGATTCCCTGAGATACCAAGG - Intronic
1026680683 7:72464353-72464375 ATTGATACTCAGAGATAGCACGG - Intergenic
1027730888 7:81871123-81871145 TTGGATACATTGTGATAACATGG + Intergenic
1028603117 7:92624381-92624403 TTGGACACAAAGAGACATCAGGG + Intronic
1029519244 7:101049671-101049693 TTGGATATGCAGAGACAGCAGGG - Intronic
1030045740 7:105493694-105493716 GGGGACACACACAGATACCAGGG + Intronic
1031518051 7:122725768-122725790 TAGGATACAGAGAGACACCATGG + Intronic
1031920079 7:127593868-127593890 GTGGATACACAGACATCCCAAGG + Exonic
1034066716 7:148144024-148144046 CTGGAAACACAGAGATTCCAGGG + Intronic
1035941380 8:3905061-3905083 TTGGATACACATAGGTCCTATGG - Intronic
1039174864 8:34792420-34792442 TTGGAGAAGCAGAGATAGCATGG - Intergenic
1039311883 8:36325224-36325246 TTGGATACACAGAGGCAGGATGG - Intergenic
1039846976 8:41332418-41332440 GTGGAGACACAGAGATCCCAAGG - Intergenic
1040616410 8:49042254-49042276 TTGGCAACAGAGGGATACCATGG + Intergenic
1040698568 8:50033676-50033698 TAGGACACACAGAGATACCAGGG - Intronic
1043692329 8:83169590-83169612 TTGAACACACATAGACACCAAGG + Intergenic
1045257134 8:100535713-100535735 ATGGATACACACAGCTACCCTGG - Intronic
1045828353 8:106428150-106428172 TGGGAAGCACAGGGATACCATGG + Intronic
1047372965 8:124271381-124271403 TTGGACACAGAGAGATACCAGGG + Intergenic
1047728970 8:127710195-127710217 TGGGAAAGACAGAGACACCAAGG - Intergenic
1048250490 8:132862941-132862963 CTGGATACTCAGAAATGCCAGGG - Intergenic
1048837992 8:138539478-138539500 TTGGATTCACAAAGATTTCAGGG + Intergenic
1049632688 8:143667101-143667123 TTGGATGCACAGAGAGACATGGG - Intergenic
1050967453 9:11824124-11824146 TTGGATCTAAAGAGATAACATGG - Intergenic
1051365306 9:16317491-16317513 TTGGATGCACAAGGATACTACGG - Intergenic
1053091111 9:35277805-35277827 TTGTGTACACAGTAATACCATGG + Intronic
1053091117 9:35277840-35277862 ATGGGTACACAGTAATACCATGG + Intronic
1053091123 9:35277875-35277897 ATGGGTACACAGTAATACCATGG + Intronic
1056070940 9:82985931-82985953 TTGGATATGCAGAGTCACCATGG + Intronic
1058595921 9:106615522-106615544 TAGGATACAGGAAGATACCAGGG + Intergenic
1058945555 9:109852300-109852322 TTGGGTACACACAGACACAAAGG - Intronic
1059397073 9:114042057-114042079 TTGGATTCCTAGAAATACCAAGG + Intronic
1059561885 9:115342859-115342881 TTGTGTATACAGAGATAGCATGG + Intronic
1061989841 9:134152904-134152926 TTGGACACACGGAGGCACCAGGG - Intronic
1185461801 X:336301-336323 ATGGACACACAGAGGAACCACGG + Intronic
1186979072 X:14939702-14939724 TTGGCTACACAGAATTACCTGGG - Intergenic
1187070959 X:15887988-15888010 TTGGATACAGGGAGTAACCAGGG + Intergenic
1189298172 X:39933766-39933788 TTGGATCCACATAGAGAACATGG + Intergenic
1190413545 X:50160213-50160235 TTCCACACACAGAGACACCAGGG - Intergenic
1195042124 X:101024170-101024192 GTGGACACACAGAGACACCAAGG + Intronic
1198431004 X:136566022-136566044 TTGGCTACACACAGACACAAAGG - Intergenic
1198868580 X:141152258-141152280 TTGGGCACACAGAGACACAAGGG - Intergenic
1199279147 X:145979081-145979103 TTGAGTACACAAAGGTACCATGG - Intergenic
1200203984 X:154302809-154302831 TTGGAGACACACAGACACCGTGG + Intronic
1200298665 X:154949741-154949763 GTGTACACACAGAGACACCAGGG - Intronic
1201336338 Y:12884388-12884410 TTGAGTACACAGGGATACAAAGG - Intergenic