ID: 1144840917

View in Genome Browser
Species Human (GRCh38)
Location 17:18185008-18185030
Sequence GCTCAGGTAACCCACCCGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 110}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144840911_1144840917 8 Left 1144840911 17:18184977-18184999 CCCTGCCGGTGCGCAGGGGAAGC 0: 1
1: 0
2: 1
3: 14
4: 119
Right 1144840917 17:18185008-18185030 GCTCAGGTAACCCACCCGGGTGG 0: 1
1: 0
2: 0
3: 30
4: 110
1144840912_1144840917 7 Left 1144840912 17:18184978-18185000 CCTGCCGGTGCGCAGGGGAAGCG 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1144840917 17:18185008-18185030 GCTCAGGTAACCCACCCGGGTGG 0: 1
1: 0
2: 0
3: 30
4: 110
1144840907_1144840917 18 Left 1144840907 17:18184967-18184989 CCAGTGCTTTCCCTGCCGGTGCG 0: 1
1: 0
2: 0
3: 7
4: 95
Right 1144840917 17:18185008-18185030 GCTCAGGTAACCCACCCGGGTGG 0: 1
1: 0
2: 0
3: 30
4: 110
1144840913_1144840917 3 Left 1144840913 17:18184982-18185004 CCGGTGCGCAGGGGAAGCGTGAC 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1144840917 17:18185008-18185030 GCTCAGGTAACCCACCCGGGTGG 0: 1
1: 0
2: 0
3: 30
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144840917 Original CRISPR GCTCAGGTAACCCACCCGGG TGG Exonic
901491515 1:9598670-9598692 GTTCAGGAAACCCTCCCAGGAGG + Intronic
902790093 1:18761992-18762014 GCTCAGGTAAGCCCCCCGGTTGG - Intergenic
903552944 1:24170590-24170612 CCTCAGGTGACCCACCCGCTTGG + Intronic
903981167 1:27189305-27189327 GCTCAGGCAATCCACCCGCCTGG + Intergenic
905554621 1:38872830-38872852 GCTAGGCTACCCCACCCGGGCGG + Intronic
907312898 1:53549889-53549911 GCTCAGGTCACCCACCTAGGAGG + Intronic
914238496 1:145834432-145834454 GCTCAGGCAACCCACCAGCCTGG - Intronic
915224104 1:154399312-154399334 CCTCAGGTAATCCAGCCGCGTGG - Intergenic
916489876 1:165292510-165292532 GCACAGGTGACCCTCCCGGTTGG - Intronic
918043682 1:180928267-180928289 GCACAGGGAACCCAGCCTGGGGG - Intronic
919892166 1:201983180-201983202 CCTCACCTACCCCACCCGGGAGG + Intronic
921283505 1:213589079-213589101 CCTCAGGTGACTCACCAGGGAGG - Intergenic
921641955 1:217565867-217565889 CCTCAGGTGACCCACCCGCCTGG - Intronic
924541024 1:244980948-244980970 CCTCAGGTAATCCACCCGCCTGG - Intronic
1069414941 10:68190417-68190439 CCTCAGGTGATCCACCCTGGAGG + Intronic
1070214069 10:74357407-74357429 GCTCAGGTGACCCTCCCAGCTGG + Intronic
1072651791 10:97301688-97301710 CCTCAGGTGATCCACCCGTGTGG - Intergenic
1073270456 10:102258537-102258559 CCTCAGGTAATCCACCCGCCTGG - Intronic
1076559092 10:131349534-131349556 GCACAGGTGGCCCACCCAGGTGG - Intergenic
1080633805 11:34105787-34105809 GCGCAGGTACCCAACGCGGGAGG + Exonic
1085506540 11:77064017-77064039 GCCCAGGACACCCACCCTGGTGG - Intergenic
1088607891 11:111548777-111548799 GCTCAGGCAACTAACCAGGGAGG + Intronic
1091000620 11:131908078-131908100 GCTCAGGTAACTCACAGGGAGGG - Intronic
1095296689 12:40535061-40535083 ACTCAGGTAAAACACCAGGGTGG + Intronic
1102060218 12:109926062-109926084 CCTCAGGTAATCCACCCGCCTGG + Intronic
1103482351 12:121259073-121259095 GCTCAGGTGATCCACCCGCTCGG + Intronic
1105366646 13:19771368-19771390 GCTCAGGCAATCCACCCGCCTGG + Intronic
1105617124 13:22029023-22029045 TCCCAGGAAACCCACCTGGGTGG - Intergenic
1108200518 13:48038509-48038531 CCTCAGGTGATCCACCCGTGAGG + Intronic
1112976983 13:105332275-105332297 GCTCAGTAAACACAGCCGGGCGG + Intergenic
1120807510 14:88768642-88768664 CCTCAGGTGACCCACCCGCCTGG + Intronic
1124492770 15:30168251-30168273 TCTCATCTAACCCACCTGGGAGG + Intergenic
1124750764 15:32370074-32370096 TCTCATCTAACCCACCTGGGAGG - Intergenic
1133101239 16:3481455-3481477 ACTCAGGAAAGCCACCCGGAGGG - Intronic
1133262932 16:4563799-4563821 GCTCAGGTGATCCACCCGCCTGG + Intronic
1134590442 16:15448559-15448581 ACTCAAGTGACCCACCCGCGTGG - Intronic
1135139786 16:19911622-19911644 GCTCAGGCAATCCCCCCGGCCGG - Intergenic
1136527894 16:30844530-30844552 GCTCATTTAACCCACCAGTGTGG - Intronic
1138334354 16:56240883-56240905 GCTCAGGAAGCCCACCCCGATGG + Intronic
1140709060 16:77659453-77659475 ACTCAGGTAATCCACCCGCCTGG + Intergenic
1141334204 16:83139768-83139790 CCTCAGGTGATCCACCCGGTCGG - Intronic
1141490888 16:84371900-84371922 CCTCAGGTATCCCAACCAGGAGG + Intronic
1141863588 16:86734597-86734619 GCACAGGTCACCCACCCCCGGGG + Intergenic
1142004550 16:87683229-87683251 GCCCAGACAACCCACCCCGGCGG - Intronic
1142026612 16:87817804-87817826 CCTCAGGTAATCCACCCGCCTGG + Intergenic
1142185125 16:88691304-88691326 GCTCAGGTATCCAACTCGGCAGG - Intergenic
1142701711 17:1666314-1666336 GCTCAGGTAATCCACCCCCCTGG - Intronic
1143321463 17:6071321-6071343 GCTCAGGAAAACCACCAGCGAGG - Intronic
1143655464 17:8291146-8291168 GCTCAGGTACCCCTTCTGGGAGG + Intronic
1144840917 17:18185008-18185030 GCTCAGGTAACCCACCCGGGTGG + Exonic
1145766356 17:27460709-27460731 GCTCAGGTCCCCCACACGGTGGG - Intronic
1147422684 17:40330511-40330533 CCTCAGGTAACCCTCACTGGGGG + Intronic
1148056654 17:44801835-44801857 CCTCAGGTAATCCACCCGCCTGG + Exonic
1150641747 17:66954036-66954058 CCCCAGGTAAACCACCTGGGTGG + Intergenic
1160046249 18:75390092-75390114 GCTCAGGTAAGCCACCTCCGGGG - Intergenic
1160608613 18:80071207-80071229 GCACAGGGAACCCTCCCGGGGGG - Intronic
1160608637 18:80071280-80071302 GCACAGCGAACCCTCCCGGGGGG - Intronic
1160608705 18:80071498-80071520 GCACAGGGAACCCTCCCGGGGGG - Intronic
1160608718 18:80071535-80071557 GCACAGGGAACCCTCCCGGGGGG - Intronic
1160608777 18:80071717-80071739 GCACAGGGAACCCTCCCGGGGGG - Intronic
1160608790 18:80071754-80071776 GCACAGGGAACCCTCCCGGGGGG - Intronic
1160608849 18:80071936-80071958 GCACAGGGAACCCTCCCGGGGGG - Intronic
1160608862 18:80071973-80071995 GCACAGGGAACCCTCCCGGGGGG - Intronic
1160608897 18:80072082-80072104 GCACAGGGAACCCTCCCGGGGGG - Intronic
1160608910 18:80072119-80072141 GCACAGGGAACCCTCCCGGGAGG - Intronic
1160608971 18:80072302-80072324 GCACAGGGAACCCTCCCGGGGGG - Intronic
1160609019 18:80072448-80072470 GCACAGGGAACCCTCCCGGGGGG - Intronic
1160609032 18:80072485-80072507 GCACAGGGAACCCTCCCGGGGGG - Intronic
1160609045 18:80072522-80072544 GCACAGGGAACCCTCCCGGGGGG - Intronic
1160609080 18:80072631-80072653 GCACAGGGAACCCTCCCGGGGGG - Intronic
1160609093 18:80072668-80072690 GCACAGGGAACCCTCCCGGGAGG - Intronic
1160609141 18:80072814-80072836 GCACAGGGAACCCTCCCGGGGGG - Intronic
1160609154 18:80072851-80072873 GCACAGGGAACCCTCCCGGGGGG - Intronic
1160609272 18:80073231-80073253 GCACAGGGAACCCTCCCGGGGGG - Intronic
1160609317 18:80073375-80073397 GCACAGGGAACCCTCCCGGGAGG - Intronic
1160609328 18:80073412-80073434 GCACAGGGAACCCTCCCGGGGGG - Intronic
1160609361 18:80073521-80073543 GCACAGGGAACCCTCCCGGGAGG - Intronic
1160609372 18:80073558-80073580 GCACAGGGAACCCTCCCGGGGGG - Intronic
1161592313 19:5134393-5134415 GCCCAGGTACACCACCTGGGTGG + Intronic
1162142243 19:8591929-8591951 CCTCAGGACCCCCACCCGGGAGG - Intronic
1166839216 19:45686352-45686374 GCTCAGGTGATCCACCCGCCTGG + Intergenic
926198142 2:10775836-10775858 GCTCACGGAACCCTCCCTGGTGG - Intronic
928574231 2:32638609-32638631 CCTCAGGTGATCCACCCGCGTGG + Intronic
931021718 2:58052378-58052400 GCTCAGGCAATCCACCCGCCTGG - Intronic
934540963 2:95174654-95174676 GCTCACCTAACCCAGCAGGGAGG - Intronic
936039929 2:109142121-109142143 GCTCAGGGACCCCACCCGGTAGG - Intronic
936154518 2:110039595-110039617 GCTCAGGGACCCCACTGGGGCGG + Intergenic
941170840 2:162133903-162133925 GCTCAGGTGACCCACCCGCCTGG - Intergenic
1173221354 20:41135578-41135600 GCTCAGGCAACCCACTCAGCTGG - Intergenic
1174172048 20:48623844-48623866 GCACAAGTAAGCCACCCAGGAGG + Intergenic
1175326841 20:58135489-58135511 CCTCAGGTAAGCCAGCAGGGAGG + Intergenic
1175374830 20:58516820-58516842 CCTCAGGTGACCCACCCGTCTGG - Intergenic
1175540752 20:59746223-59746245 CCTCAGGGAAGCCACCCGGGAGG + Intronic
1175832053 20:61970037-61970059 GGCCAGGTGACCCACCTGGGTGG + Intronic
1176184188 20:63769233-63769255 GCTCAGGTAAGACACCAGGGTGG - Intronic
1178408896 21:32347763-32347785 CCTCAGGCACCCCACCCTGGAGG - Exonic
1181302821 22:21893528-21893550 CCTCAGGTAATCCACCCGCTCGG + Intergenic
1181660080 22:24340015-24340037 GCTCAGGTAATCCACCTGCCTGG + Intronic
1184275554 22:43407699-43407721 GCTCAGGCCACCCACAGGGGAGG + Intergenic
1184660974 22:45965389-45965411 GCCCTGATAACCCACCCGCGGGG + Intronic
955331486 3:58050931-58050953 GCTCAGGTAACTCACTCCGTGGG + Intronic
955539212 3:59956299-59956321 GCTCAGGTGATCCTCCTGGGAGG - Intronic
959377837 3:105606867-105606889 CCTCAGGTAATCCACCCGCCTGG + Intergenic
959378120 3:105609685-105609707 CCTCAGGTAATCCACCCGCCTGG - Intergenic
965783747 3:172315142-172315164 GCTCAGGCAATCCACCCGTCTGG - Intronic
967410590 3:189163037-189163059 CCTCAGGTGACCCACCCGCCTGG - Intronic
968636601 4:1684216-1684238 GCTCAGGTACCGAGCCCGGGCGG - Exonic
968770873 4:2505932-2505954 CCTCAAGTGATCCACCCGGGTGG + Intronic
978713126 4:111809538-111809560 GCTCAGGTAAACTCCCCGGTTGG + Intergenic
979693722 4:123588073-123588095 GCTCAGGCAATCCACCCGCCTGG + Intergenic
980648917 4:135684642-135684664 GCTCAGGCAATCCACCCCGCTGG + Intergenic
981531062 4:145754060-145754082 GCTGAGTTAACCCAGCAGGGTGG + Intronic
982712176 4:158768865-158768887 GCTCACGTAACCCCGGCGGGAGG - Intergenic
989149234 5:38282425-38282447 GCTCAGTTATCCCACCTGAGGGG + Intronic
991914015 5:71588034-71588056 TCTCAGGTAATCCACCCGCCAGG - Intronic
992404888 5:76447588-76447610 GCTTAGGGAACCCAGCTGGGAGG - Intronic
992612829 5:78522201-78522223 GCTCAGGTGATCCACCCGCCTGG - Intronic
999397785 5:151241248-151241270 GCTCAGGTTACACACCAGGGTGG - Intronic
1000866412 5:166519837-166519859 GCTCAGGCAATCCACCCGCCTGG + Intergenic
1005039620 6:21589121-21589143 GATCAGGTAACCCAACTCGGGGG - Intergenic
1010231704 6:73540787-73540809 CCTCAGGTGATCCACCCGGTTGG - Intergenic
1013155609 6:107489622-107489644 GCTCAGTCAACCCTCCCCGGGGG + Intergenic
1014374147 6:120651174-120651196 CCTCAGGTGATCCACCTGGGAGG + Intergenic
1018460089 6:163990120-163990142 CCTCAGGTAACCCACGTAGGAGG + Intergenic
1020459136 7:8408394-8408416 CCTCAGGTAAGCCACCCGCCTGG - Intergenic
1025054247 7:55752171-55752193 CCTCAGGTGACCCACCCGCCTGG + Intergenic
1025115995 7:56258654-56258676 GCTCAGAGAAGCCACCCGGATGG + Intergenic
1025166493 7:56716997-56717019 GATCAGGTAAACCTCCCGGGAGG - Intergenic
1027234100 7:76287528-76287550 GCTCAGGCAGCCCACCCCGTGGG - Intergenic
1030686254 7:112490059-112490081 GGTCAGGCAACCCACCCCTGGGG + Exonic
1036665314 8:10733591-10733613 GTTCAGGTGACTCACGCGGGAGG - Intronic
1044755211 8:95454442-95454464 GCTCAGGTCTCCCACCAAGGGGG + Intergenic
1046775750 8:118161925-118161947 CCTCAGGTAATCCACCCGCCTGG - Intergenic
1056773547 9:89496574-89496596 GCTCAGCATACCCACCAGGGAGG - Intronic
1059138895 9:111833590-111833612 GCTCAGGTGGCCCACCTGGCAGG - Intergenic
1060904146 9:127289599-127289621 GCTCAGGTCAGCCACGTGGGTGG - Intronic
1061792389 9:133065469-133065491 GCTCAAGTGACCCACCTGTGTGG - Intronic
1061918066 9:133767569-133767591 GCTTAGGTAGCCCACCTAGGGGG - Intronic
1187206805 X:17189517-17189539 GCTCAGGCAATCCACCCGCCTGG + Intergenic
1190955695 X:55191027-55191049 ACTCAGGTAATCCACCCGCCTGG - Intronic
1194764222 X:97830312-97830334 CCTCAGGTAATCCACCCGCCTGG + Intergenic