ID: 1144841200

View in Genome Browser
Species Human (GRCh38)
Location 17:18187098-18187120
Sequence CTCCTGTCTGAGGCCTCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 333}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144841200_1144841205 -1 Left 1144841200 17:18187098-18187120 CCCATGGAGGCCTCAGACAGGAG 0: 1
1: 1
2: 0
3: 16
4: 333
Right 1144841205 17:18187120-18187142 GGATAAGTTATAGCCCAGGAAGG 0: 1
1: 0
2: 0
3: 2
4: 108
1144841200_1144841208 22 Left 1144841200 17:18187098-18187120 CCCATGGAGGCCTCAGACAGGAG 0: 1
1: 1
2: 0
3: 16
4: 333
Right 1144841208 17:18187143-18187165 TAACTGCAGAAGCACACTGAAGG 0: 1
1: 0
2: 1
3: 11
4: 177
1144841200_1144841210 24 Left 1144841200 17:18187098-18187120 CCCATGGAGGCCTCAGACAGGAG 0: 1
1: 1
2: 0
3: 16
4: 333
Right 1144841210 17:18187145-18187167 ACTGCAGAAGCACACTGAAGGGG 0: 1
1: 1
2: 3
3: 23
4: 219
1144841200_1144841211 25 Left 1144841200 17:18187098-18187120 CCCATGGAGGCCTCAGACAGGAG 0: 1
1: 1
2: 0
3: 16
4: 333
Right 1144841211 17:18187146-18187168 CTGCAGAAGCACACTGAAGGGGG 0: 1
1: 0
2: 2
3: 28
4: 214
1144841200_1144841204 -5 Left 1144841200 17:18187098-18187120 CCCATGGAGGCCTCAGACAGGAG 0: 1
1: 1
2: 0
3: 16
4: 333
Right 1144841204 17:18187116-18187138 AGGAGGATAAGTTATAGCCCAGG 0: 1
1: 0
2: 2
3: 16
4: 167
1144841200_1144841209 23 Left 1144841200 17:18187098-18187120 CCCATGGAGGCCTCAGACAGGAG 0: 1
1: 1
2: 0
3: 16
4: 333
Right 1144841209 17:18187144-18187166 AACTGCAGAAGCACACTGAAGGG 0: 1
1: 1
2: 2
3: 15
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144841200 Original CRISPR CTCCTGTCTGAGGCCTCCAT GGG (reversed) Intronic
900396447 1:2455055-2455077 CTCCTCCCTGAAGCCTCCATGGG + Intronic
900720315 1:4171809-4171831 CTGCTGTCTGAGCCCTGCCTGGG + Intergenic
901840352 1:11950285-11950307 CTCCTGTCTGTGCCCTCACTGGG + Intronic
902717110 1:18280414-18280436 CTCCTGTTTGAAGCCTTCAATGG + Intronic
903004564 1:20290332-20290354 CTCCAGTCTGATGCCCCCAGGGG + Intergenic
903335871 1:22624057-22624079 CACCTTCCTGAGACCTCCATGGG - Intergenic
904266427 1:29320819-29320841 CGCCTGGGTGAGGCCTCCACTGG + Exonic
908077151 1:60532866-60532888 CTTTTGTCTCAGGCATCCATTGG - Intergenic
909403374 1:75258752-75258774 CTCCTGTATGAGGTGTCTATTGG - Intronic
910345164 1:86228190-86228212 CACTTATCTGAGGCCTGCATTGG - Intergenic
912135525 1:106656327-106656349 CACATGTCAGAGGCCTTCATGGG - Intergenic
913798652 1:122663165-122663187 CACCTCTTTGAGGCCTTCATTGG + Intergenic
913848965 1:123566627-123566649 CACCTCTTTGAGGCCTTCATTGG + Intergenic
914445730 1:147749224-147749246 CTCCTGCCTGAGCCCGACATGGG + Intergenic
914859645 1:151375342-151375364 GTCCTGCCTCAGACCTCCATGGG - Intergenic
915290186 1:154878376-154878398 CTCCGGTCTGGGCCCTCCCTTGG - Intergenic
916079628 1:161224304-161224326 TTCCTGCCAGAGCCCTCCATTGG - Intergenic
916317658 1:163468302-163468324 CATCTGTCTGTGGTCTCCATAGG - Intergenic
917034153 1:170728085-170728107 TTTCTGTCTGGGTCCTCCATAGG + Intronic
921651595 1:217685275-217685297 CTCTTGTCTGAGCCCTGAATAGG + Intronic
922486606 1:225977829-225977851 CATCTGTCAGAGCCCTCCATCGG - Intergenic
923514914 1:234688555-234688577 CTGCTGTTTCAGGCATCCATTGG - Intergenic
923721796 1:236473319-236473341 CTCCTGTCTTAGATCTCCACGGG - Intronic
1065417104 10:25500342-25500364 TGCCTGTGTGAGGCCTTCATTGG + Intronic
1066140752 10:32501754-32501776 CTCCTGTATGAGGTGTCTATCGG + Intronic
1066925009 10:41572757-41572779 GACCTCTCTGAGGCCTTCATTGG + Intergenic
1069048046 10:63763684-63763706 CTCCTGTCCGAGACCCACATTGG - Intergenic
1069822748 10:71237696-71237718 CTCCAGCCTGTGGCCTCTATAGG + Intronic
1075404001 10:122182325-122182347 CTCCTGAATGAGGCCTTCAGAGG - Intronic
1075454285 10:122574932-122574954 CTTCTGTCTGAGCTCTCCACTGG - Intronic
1076628078 10:131834103-131834125 CTGCCCCCTGAGGCCTCCATTGG + Intergenic
1076628099 10:131834177-131834199 CTGCTCCCTGAGGCCTCCATTGG + Intergenic
1076628117 10:131834251-131834273 CTGCCCCCTGAGGCCTCCATTGG + Intergenic
1077474797 11:2781311-2781333 CCCCTGTCTGTGTCCTCCTTGGG - Intronic
1078180589 11:9006678-9006700 CACCTGTCTGAGACCTTCCTTGG + Intergenic
1079016101 11:16870233-16870255 CTCCTATTTGAGGCTTCCCTGGG + Intronic
1079186810 11:18245592-18245614 CTCCTCTCTGAGCCCTCCCTTGG - Intronic
1079190032 11:18269618-18269640 CTCCTCTCTGAGCCCTCCCTTGG + Intronic
1082561315 11:54624162-54624184 CTCCTGTATGAGGTGTCTATTGG + Intergenic
1083966614 11:66047533-66047555 CCCCAGTCTGAGGCCTGCTTAGG + Intronic
1086449269 11:86899854-86899876 TTCATGGCTGAGGCCTCCCTTGG - Intronic
1087410596 11:97785987-97786009 CTCCTGTATGAGGCATCTGTTGG + Intergenic
1088078231 11:105878329-105878351 CTCCTGTATGAGGTGTCTATTGG + Intronic
1088653289 11:111976982-111977004 CTCCACTCTGAGCCCTCCCTTGG - Intronic
1089330547 11:117686117-117686139 CTCCTGCCAAAGACCTCCATGGG + Intronic
1089679389 11:120110871-120110893 CTCAGGTCTGAAGCCTCCAGTGG + Intergenic
1091556217 12:1575569-1575591 CTCCTGTCTGAAGCCCCTGTAGG + Intronic
1092581596 12:9849005-9849027 CTCCTGTCTGAGGTGTCTGTCGG + Intergenic
1093890925 12:24519743-24519765 CTCCTGTTTAAAGCCTCCAGTGG - Intergenic
1094270826 12:28612297-28612319 CACCTGCCTTAGGCTTCCATAGG - Intergenic
1094878442 12:34680908-34680930 CACCTCTTTGAGGCCTTCATTGG + Intergenic
1094880359 12:34718381-34718403 GTCCTCTTTGAGGCCTTCATTGG - Intergenic
1095613446 12:44160014-44160036 CTTCTCTCTGAGCCCTCCTTTGG - Intronic
1095957982 12:47817538-47817560 CTTCGGACTGAGGCCTCCAGTGG - Intronic
1096965079 12:55619643-55619665 TTCCTGTATAAGGCATCCATGGG + Intergenic
1098508055 12:71277943-71277965 TTCCTGACTAAGGCCACCATGGG + Intronic
1101847649 12:108375330-108375352 CTCCTGTCTGGGCCTTCCGTTGG - Intergenic
1105355191 13:19653156-19653178 CTCCTGTATGAGGCGTCTGTTGG - Intronic
1109741360 13:66560084-66560106 GTCCTGTGTGTGGACTCCATTGG + Intronic
1111843324 13:93476381-93476403 CTCCAGTCTTAGTCATCCATTGG + Intronic
1111862635 13:93727774-93727796 TTCCTGTCTGAGGCCCTCCTTGG + Intronic
1113185002 13:107678210-107678232 CTCCTGTCTGTGGAGTTCATTGG - Intronic
1113458574 13:110466027-110466049 CTCCTGTCTGTCACCTCCAACGG - Exonic
1113477024 13:110591126-110591148 CTCCTTTCTCAGGACTCCAATGG + Intergenic
1113846412 13:113394145-113394167 CTCCTGCCTGAGTCCGCCAGGGG - Intergenic
1114107216 14:19438459-19438481 CTCCTCCCTGAGGCCTGCACAGG + Intergenic
1114182153 14:20376319-20376341 CTCCTGTCTTTGGCCTCCCAGGG - Intronic
1114416519 14:22548464-22548486 CTCCTGTCCCAGGCCTCTATAGG - Intergenic
1115641496 14:35338298-35338320 GTCCTTTCTGAGGCCTCAAGGGG - Intergenic
1116417221 14:44693644-44693666 CTCCTGTGTGAGGCGTCTGTTGG - Intergenic
1116683720 14:48011237-48011259 CCCCTGTGTGAGGCACCCATGGG + Intergenic
1116743939 14:48793194-48793216 CTCCTGTATGAGGTGTCCGTCGG - Intergenic
1119160827 14:72451279-72451301 CTCCACTCTGTGGTCTCCATGGG + Intronic
1119526307 14:75325162-75325184 CTTCAGTGTGAGGTCTCCATTGG + Intergenic
1120538580 14:85727510-85727532 CTCCTGTCTGTACCTTCCATTGG + Intergenic
1120746114 14:88153407-88153429 CTCCTATATGAAGCCTCTATTGG + Intergenic
1121096263 14:91219991-91220013 CTGCTGTCTGAGGCCTCCATCGG - Intronic
1121812173 14:96900928-96900950 CTCCAGTGTGAAGCCACCATAGG + Intronic
1124150106 15:27169576-27169598 CTCTTGTGTGTGACCTCCATGGG - Intronic
1124965260 15:34428743-34428765 CTCCTGTCCACGGCCTCGATAGG - Intronic
1124981877 15:34574953-34574975 CTCCTGTCCACGGCCTCGATAGG - Intronic
1126845682 15:52758741-52758763 CTGGGGTCTGAGGGCTCCATTGG - Intronic
1128946676 15:71827946-71827968 CTTGAGTCTGAGGCCTCCATTGG - Exonic
1130017212 15:80196809-80196831 CTCCTGTCTGGGTCTTCCATTGG - Intergenic
1131146880 15:90019983-90020005 CTAGAGTCTGAGGCCTCCACAGG - Intronic
1132785523 16:1655197-1655219 CTCCTGTCTGTCGTCTCCGTAGG + Exonic
1134009882 16:10843938-10843960 CTCCTGTCTGGGCCCCGCATTGG - Intergenic
1137660911 16:50205422-50205444 CTCCTGCCTGTGCCCTCCACTGG + Intronic
1138641623 16:58392442-58392464 CTCCTGTCTGATGCGTCCCCGGG + Exonic
1140885734 16:79240770-79240792 CTCTTGTATGAGGTGTCCATTGG - Intergenic
1140903868 16:79394108-79394130 CTCCTTGCTGAGAACTCCATGGG - Intergenic
1142933463 17:3308214-3308236 CTAATTTCTGAGGCCTCCAGGGG + Intergenic
1143027747 17:3951060-3951082 CTCCTGTCTCAGGCTTCTGTAGG - Intronic
1144841200 17:18187098-18187120 CTCCTGTCTGAGGCCTCCATGGG - Intronic
1148170468 17:45515265-45515287 CTGCTGTCTGAGGGCTCCTCCGG + Intergenic
1148170945 17:45519258-45519280 CTGCTGTCTGAGGGCTCCTCCGG + Intergenic
1148278736 17:46330542-46330564 CTGCTGTCTGAGGGCTCCTCTGG - Exonic
1148300946 17:46548404-46548426 CTGCTGTCTGAGGGCTCCTCTGG - Exonic
1148365075 17:47049294-47049316 CTGCTGTCTGAGGGCTCCTCCGG - Intergenic
1149058246 17:52390360-52390382 TACCTGTCTGAGGGATCCATGGG - Intergenic
1150401561 17:64860859-64860881 CTGCTGTCTGAGGGCTCCTCCGG + Exonic
1151963319 17:77418880-77418902 CTCCTGGCTGTGGCTTCCAGGGG - Intronic
1152529912 17:80911922-80911944 CTCTGGTCTGGGGCCTCCGTGGG - Intronic
1153273368 18:3344759-3344781 CTCTAGTCTGATGCCTCCAGTGG - Intergenic
1153562168 18:6382727-6382749 CTCCTGTATGAGGTGTCTATCGG + Intronic
1153963707 18:10161508-10161530 CTGCTTTCTGGGGCCTCCAGAGG - Intergenic
1154380750 18:13848068-13848090 CTCCTCTCTGTGGCCTGCCTTGG - Intergenic
1157856437 18:51109504-51109526 CTCCTGTCTGAGTAGTCCTTTGG - Intergenic
1158357882 18:56640538-56640560 CTCCTGTCTCAGCCCGCCCTGGG + Intronic
1159905197 18:74083469-74083491 CACCAGTCAGAGGCCTCCCTTGG - Intronic
1160117192 18:76090397-76090419 ATGCTGGCTGGGGCCTCCATGGG + Intergenic
1160846739 19:1169337-1169359 CCCCAGGCTGAGGCCTCCGTGGG + Intronic
1161219487 19:3111799-3111821 CTCCTGCCAGTGGCCTCCCTGGG + Intronic
1161479511 19:4503561-4503583 GCCCTGTCTGATCCCTCCATAGG + Exonic
1161606639 19:5218747-5218769 CTCTTGCCTGAAGCCTCCACGGG + Intronic
1161738824 19:6007914-6007936 CTCCTCTCTGTGGCCTCCCTTGG - Intronic
1162438732 19:10679825-10679847 CTCCTGTGTGAGAAATCCATTGG + Exonic
1165448183 19:35868352-35868374 CTCCTGGCTGGGCCCTTCATGGG + Intronic
925600594 2:5605089-5605111 CTCCTGTCAGAAGCCTCCCAGGG + Intergenic
925736389 2:6967602-6967624 TGACTGTCTGAGTCCTCCATGGG + Intronic
926825504 2:16901804-16901826 CTCCTTTCTGACTCCCCCATCGG + Intergenic
927427141 2:22994219-22994241 CTCCTTACAGAGGCCTCCACTGG - Intergenic
928196661 2:29221185-29221207 CTTCTGCCTGAGGCCTTCCTGGG - Intronic
928360948 2:30661942-30661964 CTCCTGTCTGCTGTCCCCATGGG + Intergenic
929116230 2:38446645-38446667 CTCCTCTCTGTGGCCTCCTGGGG + Intergenic
929121027 2:38484244-38484266 TGCCTGGCTGAGGCCTTCATGGG + Intergenic
935171918 2:100616832-100616854 CTGCTATCTGAGGCCCCCTTAGG + Intergenic
936386868 2:112038612-112038634 CTCTTGCCTTAGGCATCCATGGG + Intergenic
937737848 2:125313358-125313380 CTCCAGGCTGAGGACTCCACCGG - Intergenic
938473347 2:131586096-131586118 TTCCTCCCTGAGGCCTGCATAGG - Intergenic
942779149 2:179620499-179620521 CTCATCTTTGTGGCCTCCATAGG - Intronic
945423528 2:209669601-209669623 ATCCTGTCTCAGGCCAGCATTGG + Intronic
946002273 2:216492467-216492489 CTCTTGTCTGTGGCCCCCAGGGG + Intergenic
946355183 2:219180068-219180090 CTGGTATCTGAGGCCTCCAGGGG + Intronic
947408553 2:229808324-229808346 CTCCTGTGTGGTGCCTCCAATGG - Exonic
1168823373 20:792382-792404 CTCCCGGCTGAGGCCGCCACAGG - Intergenic
1172962262 20:38807122-38807144 CTGCGGACTGAGGCCGCCATCGG - Intronic
1174914851 20:54643703-54643725 CTCGTGTGTGAGGCCTTGATGGG - Intronic
1175190723 20:57210741-57210763 ATCCTGTCTGCGCCCACCATCGG + Intronic
1175920619 20:62449047-62449069 CTCCTGGCTGGGGCCTCTCTGGG + Intergenic
1176170893 20:63695973-63695995 CGCCTGCCTGAGGCCTGCAGCGG - Exonic
1176722210 21:10402078-10402100 CTCCTCTCTGAGTCCTCCCAGGG + Intergenic
1177387998 21:20432758-20432780 CTGCTGTCGGAGGCTCCCATTGG + Intergenic
1179340560 21:40504407-40504429 CTCCTGCCTCAGCCCTCCCTCGG + Intronic
1180303395 22:11054840-11054862 CTCCTCTCTGAGTCCTCCCATGG + Intergenic
1180473809 22:15685869-15685891 CTCCTCCCTGAGGCCTGCACAGG - Intergenic
1181039993 22:20187586-20187608 CTCCTGTCTGAGGCCACTCTGGG + Intergenic
1181318743 22:21988589-21988611 CTCTTGACTGAGGCCTGCGTGGG + Intergenic
1181329579 22:22079592-22079614 CTTCTGCCTGAGGGCGCCATAGG - Intergenic
1181783549 22:25209481-25209503 CCCCTTCCTGAGGCCCCCATAGG - Intergenic
1182669983 22:31987591-31987613 CTGTTGCCTGAGGCTTCCATGGG + Intergenic
1183122580 22:35741701-35741723 GTTCTGGCTGAGGCCTCCAAAGG - Intronic
1185266632 22:49907402-49907424 CTCCTCCCTGAGGGCTGCATGGG - Intronic
950003494 3:9676061-9676083 TTCCTGTCTGAGGCCACCTCAGG - Intronic
958273550 3:91541885-91541907 GACCTCTCTGAGGCCTTCATTGG - Intergenic
959439497 3:106359090-106359112 AGCCTCTCTCAGGCCTCCATAGG + Intergenic
961070377 3:123918833-123918855 CTCTGGTCTGATGCTTCCATTGG - Intronic
964495451 3:157284979-157285001 CCCTTTTCTGAGGCCTCCCTTGG + Intronic
967193357 3:187004499-187004521 CTCCTGCTTGTAGCCTCCATAGG + Intronic
967994813 3:195158492-195158514 CTGGTGTCTTAGGCCTACATAGG - Intronic
969600656 4:8174111-8174133 CTCCTGGCTGTGGCCTCCCCCGG + Intergenic
972335971 4:38107257-38107279 CTTCTGTGGGAGGCCTCCCTGGG - Intronic
973143013 4:46792441-46792463 CTTCTGTTTGAGGCCTCAGTGGG - Intronic
975356994 4:73418683-73418705 CTCATGTGTGGGGCCACCATAGG - Intronic
976659189 4:87521536-87521558 CTCCAGTCTGAACCCTCCAGTGG + Intronic
977561257 4:98536417-98536439 CTCCTGTATGAGGTGTCCGTCGG + Intronic
981682183 4:147411784-147411806 CTCCTGTCTGAGGCCAATCTAGG + Intergenic
987072881 5:14354399-14354421 CTACAGCCAGAGGCCTCCATTGG + Intronic
991670851 5:69046063-69046085 CTCCTGCCTTAGGCCTCCCTGGG - Intergenic
992254797 5:74911180-74911202 CTCCTGTATGAGGTGTCCGTAGG + Intergenic
993345499 5:86777738-86777760 CTCCTGTATGAGGTGTCTATAGG + Intergenic
994106820 5:95959094-95959116 CTCCCTTCTGGGGCCTCCAGTGG + Intronic
994612089 5:102056151-102056173 CATCTGTATGAGGCCTCCACAGG + Intergenic
997658481 5:135572752-135572774 CTCCTCTGTGTGGCCCCCATGGG + Intronic
998007398 5:138666076-138666098 CTCCTGCCAGTGGCTTCCATTGG + Intronic
998882227 5:146655824-146655846 CTCCTTTCTGAGGTCTGCCTTGG - Intronic
999657840 5:153828099-153828121 CTCCTGTCTGGTACCTGCATTGG + Intergenic
1000252040 5:159504998-159505020 TTCCTGTCTGAGGCCTTGCTAGG - Intergenic
1003316739 6:5019944-5019966 CTCCTGTATGAGGTGTCCGTTGG + Intergenic
1003416811 6:5917261-5917283 CTCCTGTATGAGGTGTCTATCGG + Intergenic
1006392614 6:33767496-33767518 CTCCGGTCTGAGGCCTCAGGAGG - Intergenic
1006620037 6:35357432-35357454 CTCCAGTCTGAAGCCCCCAACGG - Intronic
1006677847 6:35776877-35776899 CTCCCCTCTGAGGCCACCAGGGG - Intronic
1007139934 6:39561802-39561824 TTCCTGTCTGGGGACTCCCTGGG - Intronic
1011342502 6:86332599-86332621 TTCATGTCTGGGGCCTCCATTGG - Intergenic
1013608325 6:111771648-111771670 CTGCTGTCTGAGGCAGCCTTGGG - Intronic
1017062836 6:150501427-150501449 TCCCTGTATGTGGCCTCCATTGG - Intergenic
1018765818 6:166932117-166932139 GTCCTGCCTCAGGCCTCCATAGG - Intronic
1019355960 7:579111-579133 CGCCCGTCCGGGGCCTCCATGGG - Intronic
1019504840 7:1385623-1385645 CTCCTGCCTCAGGCCTCAGTGGG + Intergenic
1019659619 7:2216856-2216878 CTCCTGTGGGAGGCCTTCCTGGG + Intronic
1019732501 7:2635668-2635690 CTCATTTCTGACTCCTCCATGGG + Intronic
1024512587 7:50215347-50215369 GTCCTCTCTGAGGGCTCCCTGGG - Intergenic
1024530170 7:50384671-50384693 CTCTTAGCTGAGGCCTCCATGGG - Intronic
1025007025 7:55363206-55363228 CTCCTGTCTCAGGCCCCACTTGG + Intergenic
1025323859 7:58183225-58183247 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025323917 7:58184246-58184268 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025324655 7:58197517-58197539 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025326144 7:58224090-58224112 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025327038 7:58240098-58240120 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025327210 7:58243163-58243185 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025328313 7:58262583-58262605 GACCTGTTTGAGGCCTTCATTGG + Intergenic
1025328952 7:58273900-58273922 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025330686 7:58304557-58304579 GACCTGTTTGAGGCCTTCATTGG + Intergenic
1025331632 7:58321254-58321276 GACCTGTCTGAGGCCTTCGTTGG + Intergenic
1025332300 7:58333175-58333197 CACCTGTTTGAGGCCTTCGTTGG + Intergenic
1025334330 7:58368858-58368880 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025334388 7:58369876-58369898 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025339563 7:58461508-58461530 CACCTGTTTGAGGCCTTCGTTGG + Intergenic
1025340065 7:58470367-58470389 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025340449 7:58477180-58477202 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025340835 7:58483995-58484017 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025341005 7:58487063-58487085 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025341088 7:58488426-58488448 GACCTGTTTGAGGCCTTCATTGG + Intergenic
1025341870 7:58502392-58502414 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025344203 7:58543611-58543633 GACCTGTTTGAGGCCTTCATTGG + Intergenic
1025344750 7:58553489-58553511 GACCTGTTTGAGGCCTTCATTGG + Intergenic
1025344807 7:58554512-58554534 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025345988 7:58575288-58575310 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025346731 7:58588579-58588601 GACCTGTTTGAGGCCTTCATTGG + Intergenic
1025350455 7:58654667-58654689 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025351260 7:58668971-58668993 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025352008 7:58682265-58682287 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025353584 7:58709859-58709881 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025353928 7:58715993-58716015 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025356716 7:58765147-58765169 GACCTGTTTGAGGCCTTCATTGG + Intergenic
1025360606 7:58834311-58834333 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025365177 7:58915398-58915420 GACCTGTTTGAGGCCTTCATTGG + Intergenic
1025367602 7:58958322-58958344 GACCTGTTTGAGGCCTTCATTGG + Intergenic
1025367892 7:58963431-58963453 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025368356 7:58971608-58971630 GACCTGTTTGAGGCCTTCATTGG + Intergenic
1025368433 7:58972970-58972992 GACCTGTTTGAGGCCTTCATTGG + Intergenic
1025368604 7:58976037-58976059 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025369243 7:58987280-58987302 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025374591 7:59082332-59082354 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025374823 7:59086420-59086442 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025375982 7:59106868-59106890 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025379527 7:59169889-59169911 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025380918 7:59194414-59194436 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025383788 7:59245510-59245532 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025386773 7:59298303-59298325 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025388681 7:59332369-59332391 GACCTGTTTGAGGCCTTCATTGG + Intergenic
1025388836 7:59335088-59335110 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025390556 7:59365743-59365765 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025391219 7:59377666-59377688 CACCTGTTTGAGGCCTTCGTTGG + Intergenic
1025393007 7:59409345-59409367 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025394162 7:59429795-59429817 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025396685 7:59474753-59474775 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025397895 7:59496214-59496236 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025397952 7:59497239-59497261 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025398809 7:59512091-59512113 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025399041 7:59516177-59516199 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025400020 7:59533548-59533570 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025400330 7:59538999-59539021 GACCTGTTTGAGGCCTCCATTGG + Intergenic
1025400388 7:59540021-59540043 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025401196 7:59554330-59554352 CACCTGTTTGAGGCCTTCGTTGG + Intergenic
1025401738 7:59563862-59563884 GACCTGTTTGAGGCCTTCATTGG + Intergenic
1025402800 7:59582595-59582617 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025407263 7:59661630-59661652 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025408010 7:59674922-59674944 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025409846 7:59707281-59707303 GACCTGTCTGAGGCCTTCGTTGG + Intergenic
1025412838 7:59760430-59760452 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025413989 7:59780876-59780898 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025414447 7:59789053-59789075 GACCTGTTTGAGGCCTTCATTGG + Intergenic
1025414849 7:59796207-59796229 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025414907 7:59797229-59797251 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025415365 7:59805406-59805428 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025415958 7:59815967-59815989 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025418049 7:59853107-59853129 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025419550 7:59879676-59879698 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025419815 7:59884444-59884466 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025421282 7:59910338-59910360 GACCTGTTTGAGGCCTTCATTGG + Intergenic
1025425080 7:59978136-59978158 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025426291 7:59999613-59999635 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025426960 7:60011540-60011562 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025429430 7:60055467-60055489 GACCTGTTTGAGGCCTTCATTGG + Intergenic
1025430142 7:60068069-60068091 GACCTGTTTGAGGCCTTCATTGG + Intergenic
1025432881 7:60116784-60116806 CACCTGTTTGAGGCCTTCGTTGG + Intergenic
1025433447 7:60127001-60127023 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025434078 7:60138251-60138273 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025434365 7:60143363-60143385 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025435002 7:60154603-60154625 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025435519 7:60163800-60163822 GACCTGTTTGAGGCCTTCATTGG + Intergenic
1025436433 7:60180149-60180171 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025437683 7:60202300-60202322 GACCTGTTTGAGGCCTTCATTGG + Intergenic
1025439313 7:60230922-60230944 GACCTGTTTGAGGCCTTCATTGG + Intergenic
1025441165 7:60263969-60263991 GACCTGTTTGAGGCCTTCATTGG + Intergenic
1025441971 7:60278279-60278301 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025444213 7:60318144-60318166 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025449389 7:60410139-60410161 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025450365 7:60427508-60427530 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025450889 7:60436710-60436732 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025451327 7:60444545-60444567 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025455412 7:60517117-60517139 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025456095 7:60529381-60529403 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025456419 7:60535173-60535195 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025457331 7:60551518-60551540 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025459580 7:60591723-60591745 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025461913 7:60633295-60633317 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025463155 7:60655447-60655469 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025464244 7:60674865-60674887 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025464361 7:60676909-60676931 GACCTGTTTGAGGCCTTCATTGG + Intergenic
1025465270 7:60693264-60693286 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025466004 7:60706548-60706570 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025466636 7:60717798-60717820 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025467494 7:60733128-60733150 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025472728 7:60826136-60826158 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1025537528 7:61973865-61973887 GACCTGTTTGAGGCCTCCGTTGG + Intergenic
1026661289 7:72304978-72305000 GTCCTGTCTGAGGGCTTCCTGGG - Intronic
1026767809 7:73171586-73171608 CTCCTGCCTCAGTCCTCCCTGGG + Intergenic
1027044275 7:74981294-74981316 CTCCTGCCTCAGTCCTCCCTGGG + Intronic
1027079366 7:75221064-75221086 CTCCTGCCTCAGTCCTCCCTGGG - Intergenic
1027173621 7:75889608-75889630 CTCATGTCTGAGGCCCCCCCAGG - Intergenic
1028805967 7:95026492-95026514 CTCCTGTGTGAGGTGTCTATTGG + Intronic
1029388591 7:100259645-100259667 CTCCTGCCTCAGTCCTCCCTGGG - Intronic
1030104455 7:105975176-105975198 GTCCTGTCTGAGGCATCCCAGGG + Intronic
1032462455 7:132122224-132122246 CTTCTGTCTGTGCCCTCCAGGGG + Intergenic
1036470770 8:9050576-9050598 TTCCTGTCTGAGTCCTCATTGGG + Intronic
1037940794 8:22949304-22949326 CTTCTGTCTGGGGCCTGCCTTGG + Intronic
1039037082 8:33371631-33371653 CTCCTGTCTGGGGCATCTACTGG - Exonic
1039430041 8:37519066-37519088 CTCCTGTTTGAGGCCTGGAGTGG - Intergenic
1039644677 8:39267720-39267742 CTACTGTGTCATGCCTCCATTGG + Intronic
1040143965 8:43965244-43965266 GACCTCTCTGAGGCCTTCATTGG + Intergenic
1040731921 8:50457724-50457746 TTGCTGTCTGAGGCCTGCAGTGG - Intronic
1041193820 8:55380106-55380128 CTGCTGTCTGAATGCTCCATTGG + Intronic
1041554680 8:59139944-59139966 TTCCTGTGTGATGCCTCCCTTGG - Intergenic
1048282438 8:133115218-133115240 CTTCTGAGTGAGGCCTCCCTTGG - Intronic
1048540059 8:135334218-135334240 CTGGTGTCTGATGCCTCCTTGGG + Intergenic
1048545430 8:135382232-135382254 CTCTTGTCTGAGACCTTAATAGG - Intergenic
1053024617 9:34719611-34719633 CACCTGCCTGAGGCCAGCATGGG - Intergenic
1057886001 9:98830256-98830278 CTCCTGTCTGGGGCCACCTTAGG - Intronic
1061207461 9:129173239-129173261 GTCCTGTCTGGGGGCTCCACTGG + Intergenic
1061279048 9:129586660-129586682 CTCCTGTCTGCTGCCCCCAGGGG + Intergenic
1061429262 9:130520939-130520961 CTCCTCTGTGAGGCTTCCAGGGG + Intergenic
1061475511 9:130863128-130863150 CTGCTGTCCGAGGGCTTCATTGG + Intronic
1062265993 9:135686761-135686783 CACCTGTCTGTGGCCTGCCTTGG + Intergenic
1185515324 X:695077-695099 CGCCTGTCTCAGGGCACCATTGG - Intergenic
1186600657 X:11033786-11033808 CTCCTGTGTGAGACACCCATGGG + Intergenic
1187256386 X:17646595-17646617 CTCTAGGCTGAGACCTCCATTGG - Intronic
1187763805 X:22617109-22617131 CTGCTGTCTGAGGTCACCAAGGG + Intergenic
1190989804 X:55535748-55535770 CTTTTGCCAGAGGCCTCCATTGG - Intergenic
1192204391 X:69086460-69086482 CTCCTGTCTGTGGCCACGGTGGG - Intergenic
1192688358 X:73331720-73331742 CTCCTGTTTGAGGTCTCTGTTGG - Intergenic
1193079424 X:77390926-77390948 CTCCTGTATGAGGTGTCCATTGG - Intergenic
1194552731 X:95321260-95321282 CTCCTGTCCCAGACCTCCAAGGG - Intergenic
1195415885 X:104619058-104619080 CTCCTGCCTGAGGCTTGCAATGG + Intronic
1197865738 X:131014824-131014846 CTCCTGCCTGAGGGCTGCAAAGG - Intergenic
1198575705 X:138008305-138008327 CTCCAGTCTGAGCCCTCTGTGGG - Intergenic
1200737427 Y:6814580-6814602 CACCTGTATGAGGTGTCCATCGG - Intergenic
1201490954 Y:14540550-14540572 CTCCTGTATGAGGTGTCCGTTGG - Intronic
1202080732 Y:21081484-21081506 CTCCTGCCTGGGTCCTCCCTGGG + Intergenic