ID: 1144843082

View in Genome Browser
Species Human (GRCh38)
Location 17:18200581-18200603
Sequence CTCTGTGCTAGTACCCGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 61}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144843076_1144843082 15 Left 1144843076 17:18200543-18200565 CCTTTGCCAAGTGGTAACCTAAG 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1144843082 17:18200581-18200603 CTCTGTGCTAGTACCCGGAATGG 0: 1
1: 0
2: 0
3: 3
4: 61
1144843075_1144843082 16 Left 1144843075 17:18200542-18200564 CCCTTTGCCAAGTGGTAACCTAA 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1144843082 17:18200581-18200603 CTCTGTGCTAGTACCCGGAATGG 0: 1
1: 0
2: 0
3: 3
4: 61
1144843078_1144843082 9 Left 1144843078 17:18200549-18200571 CCAAGTGGTAACCTAAGCTGGTG 0: 1
1: 0
2: 0
3: 7
4: 60
Right 1144843082 17:18200581-18200603 CTCTGTGCTAGTACCCGGAATGG 0: 1
1: 0
2: 0
3: 3
4: 61
1144843080_1144843082 -2 Left 1144843080 17:18200560-18200582 CCTAAGCTGGTGTGTGCTAGGCT 0: 1
1: 0
2: 0
3: 7
4: 154
Right 1144843082 17:18200581-18200603 CTCTGTGCTAGTACCCGGAATGG 0: 1
1: 0
2: 0
3: 3
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144843082 Original CRISPR CTCTGTGCTAGTACCCGGAA TGG Intronic
903348341 1:22702284-22702306 TTCTGTGATTGTACCCGGATAGG + Intergenic
903659719 1:24969688-24969710 CTCTGTGCTAGCCCTCGAAAGGG - Intergenic
905851174 1:41276173-41276195 GTCTGTGCTAGCTCCCGGCAGGG - Intergenic
905892468 1:41526029-41526051 CTCTGTGCTGGAACCAGGCAGGG - Intronic
911982333 1:104582878-104582900 CTCAGTAGTAGTACCAGGAATGG - Intergenic
920519237 1:206611295-206611317 CTCTGAGTTAGTACCTGGAAAGG - Exonic
921261499 1:213388684-213388706 CCCTGTGCTAGTTCCAGGCAAGG + Intergenic
922036199 1:221851102-221851124 CTCTGTGCTACCACCCTGGAAGG - Intergenic
1067745175 10:48930069-48930091 CTCTGTGCTAGGAACTGAAATGG - Intronic
1072829891 10:98646502-98646524 CTTTGTGATAGTTCCCAGAAAGG - Intronic
1076408592 10:130230427-130230449 CTCAGTGCTCTTACCTGGAAAGG + Intergenic
1076871785 10:133198177-133198199 CTCTGTGCTGGGCCCTGGAATGG - Intronic
1079154274 11:17929933-17929955 CTCTGTGCTCGTAACTGGAGAGG - Intronic
1083662642 11:64258953-64258975 CTCTGGACAAGTACCCGGTACGG + Exonic
1105540086 13:21308623-21308645 CACTGGGCTGGTACCAGGAAGGG + Intergenic
1110177693 13:72577174-72577196 CTCTGTACCAGTACCTGAAAAGG + Intergenic
1111902697 13:94219341-94219363 CTCAGTGCTAGTACCCACATGGG + Intronic
1116548116 14:46197451-46197473 CCCGGTGCTAGCTCCCGGAAAGG + Intergenic
1122787136 14:104168973-104168995 CTCTGTGCGTGTGCCCGGCACGG + Intronic
1134808458 16:17145974-17145996 CACTGTCCTAGGACCTGGAAGGG - Intronic
1135717428 16:24783720-24783742 CTCTGTGCTAGTAGGAAGAAAGG - Intronic
1141907647 16:87038127-87038149 CTCTGTGCTGGTTCCCAGTAGGG - Intergenic
1144843082 17:18200581-18200603 CTCTGTGCTAGTACCCGGAATGG + Intronic
1145117499 17:20225084-20225106 CTGGGAGCTAGGACCCGGAATGG + Intronic
1145405411 17:22586169-22586191 CTCTTTGCTAGATCCAGGAAAGG + Intergenic
1152936269 17:83138977-83138999 CTCTGGGCTGGAACCCAGAATGG + Intergenic
1155282938 18:24259251-24259273 CTGTATCCTAGTACCTGGAATGG + Intronic
1155668045 18:28335443-28335465 CTCTCTGCATGTACCAGGAAAGG + Intergenic
1158484060 18:57848973-57848995 CTTTGTGTTAGAACCCTGAAGGG + Intergenic
1162445382 19:10719333-10719355 CTGTGTTCTAGCACTCGGAAAGG - Intronic
932234958 2:70113417-70113439 CTCTGTGCCAGGAACTGGAAAGG - Intergenic
936072442 2:109380364-109380386 CCCTGTGCCAGGACCCAGAAGGG - Intronic
937111117 2:119367622-119367644 CTCTGTCCCAGTGCCCGGATTGG - Exonic
945620033 2:212124662-212124684 CTGTGTGCTGATACCTGGAAGGG - Intronic
948751724 2:240136890-240136912 CTCTGGGCTTGTGCCCGGAAGGG - Intergenic
1170830547 20:19835961-19835983 CACTGTGCTAGGACCGGGACTGG + Intergenic
1183323949 22:37181241-37181263 CTCTGTGCTGGGTCCCGGGAAGG - Exonic
951109378 3:18784126-18784148 CTCTGTATAAGTACCCTGAAGGG + Intergenic
951773226 3:26281765-26281787 CCCAGTGCTAGTTCCCGGATGGG + Intergenic
956761160 3:72446773-72446795 CTCTCTTCCAGTCCCCGGAAAGG - Exonic
961432810 3:126895228-126895250 CATTTTGCTAGAACCCGGAATGG + Intronic
971998177 4:33994165-33994187 CTCTTTGCTAGATCCAGGAAAGG - Intergenic
972349639 4:38224824-38224846 TTCTATGCTAGTAGCCTGAATGG - Intergenic
974101075 4:57417706-57417728 CTCTGTGCTAGCATCTAGAAAGG + Intergenic
975743329 4:77451911-77451933 CTCTGTGCTGGAACTCTGAATGG + Intergenic
982631837 4:157839930-157839952 CTCTGTGCTAGAAACCTAAATGG - Intergenic
983125150 4:163942335-163942357 ATCTGTGCTCTTACCCAGAAGGG - Intronic
983388884 4:167103050-167103072 CTGGGAGCTAGTACCTGGAATGG - Intronic
983908513 4:173209764-173209786 CTTTGTGCTGGCACCCGGAAAGG - Intronic
986948072 5:13048229-13048251 CTCTGTGCCAGTAATGGGAAGGG + Intergenic
1004744228 6:18493852-18493874 CATTGTGCTAATACCAGGAAAGG + Intergenic
1005244179 6:23862531-23862553 CTCTGAGCTGGTACTGGGAAGGG - Intergenic
1006560335 6:34905913-34905935 CTCTGTGCTTGAACTCTGAAGGG + Intronic
1017072371 6:150586875-150586897 ATCTGTGCCAGTCCGCGGAAAGG - Intergenic
1018630280 6:165816360-165816382 CACTCTGCTAGTTCCCGTAAGGG + Intronic
1028246902 7:88490205-88490227 CTCTGGGCTAGGACCTGTAATGG - Intergenic
1038214943 8:25553075-25553097 CTTTTTGCTAGTGCCTGGAATGG + Intergenic
1041441680 8:57903876-57903898 TTCTGTGCTTGTACCTTGAAAGG + Intergenic
1045495212 8:102702393-102702415 CTCTGTGCCAGCACCCAGCAAGG - Intergenic
1057019072 9:91681679-91681701 CTCTGTGCCAGCCCCCGGGAGGG - Intronic
1059658065 9:116374460-116374482 CTGTGTGCTAGAACTGGGAAAGG - Intronic
1188468401 X:30508980-30509002 CACTGTGCTAGGTCCTGGAAAGG + Intergenic
1189955408 X:46272436-46272458 CTCTGTGCAAATACCCTGTAGGG + Intergenic
1194229234 X:91301465-91301487 CTGGGTGCTTGTACCTGGAATGG - Intergenic
1199429063 X:147738264-147738286 CACTGTGCTAGAACCGGGATTGG + Intergenic