ID: 1144845765

View in Genome Browser
Species Human (GRCh38)
Location 17:18218041-18218063
Sequence TGCCAAAGGAGGCCCCGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144845765_1144845771 20 Left 1144845765 17:18218041-18218063 CCAGACCGGGGCCTCCTTTGGCA 0: 1
1: 0
2: 1
3: 4
4: 101
Right 1144845771 17:18218084-18218106 GGTCCCAGTGTTTCCACTCCAGG 0: 1
1: 0
2: 0
3: 20
4: 176
1144845765_1144845775 25 Left 1144845765 17:18218041-18218063 CCAGACCGGGGCCTCCTTTGGCA 0: 1
1: 0
2: 1
3: 4
4: 101
Right 1144845775 17:18218089-18218111 CAGTGTTTCCACTCCAGGCTGGG 0: 1
1: 0
2: 3
3: 27
4: 305
1144845765_1144845769 -1 Left 1144845765 17:18218041-18218063 CCAGACCGGGGCCTCCTTTGGCA 0: 1
1: 0
2: 1
3: 4
4: 101
Right 1144845769 17:18218063-18218085 ACTGCCTAGAGTGTACTCTGTGG 0: 1
1: 0
2: 0
3: 7
4: 119
1144845765_1144845774 24 Left 1144845765 17:18218041-18218063 CCAGACCGGGGCCTCCTTTGGCA 0: 1
1: 0
2: 1
3: 4
4: 101
Right 1144845774 17:18218088-18218110 CCAGTGTTTCCACTCCAGGCTGG 0: 1
1: 0
2: 2
3: 16
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144845765 Original CRISPR TGCCAAAGGAGGCCCCGGTC TGG (reversed) Intergenic
900158530 1:1212883-1212905 TGCCAGAGGAGGCACCGGTGGGG + Intronic
900682655 1:3925356-3925378 TCCCAAAGCAGGCCCAGGTAGGG - Intergenic
902686028 1:18078231-18078253 TCCCAAAGGGGGCCCTGCTCTGG + Intergenic
905802037 1:40850547-40850569 TCCCAAAGGAGGGCGTGGTCAGG - Intergenic
906747565 1:48232408-48232430 TGCCAAGGGAGGCTCCGTGCTGG + Exonic
914753388 1:150550178-150550200 TGCCAGAGTAGACCCTGGTCTGG - Intronic
915279858 1:154814999-154815021 TGGCAGAGGAGGCCCCCATCTGG + Intronic
915955651 1:160217996-160218018 TGCCAAAAGAGGCCTAGTTCAGG - Intronic
918437734 1:184533775-184533797 TTCCACAGGAGGCCCTGGCCGGG + Intronic
920743093 1:208599874-208599896 TGTCAAAGGAGCCAACGGTCAGG + Intergenic
920947002 1:210539055-210539077 TGACAGAGGAGGACCCTGTCTGG + Intronic
922237783 1:223734673-223734695 TGCCAAATGTGGCCAAGGTCTGG + Intronic
922705942 1:227790019-227790041 TGCCACAGGAGGCTCTGGCCAGG + Intergenic
922734096 1:227970414-227970436 TGCCCCAGGAGGCCACGGTGAGG - Intergenic
1063376490 10:5557611-5557633 TCCAGAAGGAGGCCCCGGTGTGG + Intergenic
1071038884 10:81282540-81282562 TGCCAAAGGTTGCCCCGCTTAGG + Intergenic
1071290798 10:84187638-84187660 TGCCAAAGGAGTTCCTGGTGAGG - Intergenic
1071760896 10:88605358-88605380 TCCCAAAAGAGGCCCCCCTCTGG + Intronic
1075743834 10:124712705-124712727 TGCCAAAGGAGGGCTAGGTGAGG + Intronic
1076747516 10:132521864-132521886 TGCCAAAGGAGGCCTCGGACCGG + Intergenic
1081761050 11:45576639-45576661 TGCCCATGGCCGCCCCGGTCAGG - Intergenic
1085640647 11:78190595-78190617 TGCCAAGGGAGGTCCCAGCCTGG + Intronic
1087826685 11:102772546-102772568 TGCCATAGGAAGCCCAGGTGTGG - Intronic
1092259038 12:6942573-6942595 CGCCAGTGGAGGCCTCGGTCTGG + Intergenic
1094545638 12:31402124-31402146 TGCCAAAGGATGACCAGGTTTGG + Intronic
1105018632 12:132801794-132801816 TGGCACAGGAGGCCCGCGTCAGG - Exonic
1106840719 13:33682501-33682523 TGCCAGACGAGGCCCCGGTGTGG + Intergenic
1120906433 14:89625121-89625143 TGCCAAAGCAAGCCCGGGTTTGG - Intergenic
1122413143 14:101536098-101536120 TTCCTAAGGAGGCCCAGGGCAGG - Intergenic
1123684544 15:22787365-22787387 TGCAAAAGGAAGACCCGGGCGGG + Intronic
1129620566 15:77140752-77140774 TGACAAAGGAAGACCCTGTCTGG - Intronic
1131068451 15:89449028-89449050 TGCCAAAGGCATCCCCGGCCTGG + Intergenic
1139682388 16:68575148-68575170 GGCCAAGGGAGGCCCAGGTGGGG - Intronic
1141325158 16:83050170-83050192 GGCAGAAGGAGGCCCGGGTCTGG - Intronic
1142733740 17:1880949-1880971 TGCCAAAGGAGGGGACGGCCAGG + Intronic
1144845765 17:18218041-18218063 TGCCAAAGGAGGCCCCGGTCTGG - Intergenic
1147314201 17:39611868-39611890 TCCCAAGGGAGGCCACAGTCTGG + Intergenic
1150224144 17:63513827-63513849 TGCCCAAGGAGCCTCCGCTCAGG + Intronic
1151870486 17:76833455-76833477 TGCAACAGGAGGCCCCGCCCAGG - Intergenic
1152431208 17:80249070-80249092 GGCCAAAGGAGGCTCTGGCCAGG - Intronic
1162777091 19:12986260-12986282 GGCCACAGGAGGCCCTGGCCAGG + Intergenic
1162875471 19:13617972-13617994 GGCCAGAGGAGCCCCAGGTCGGG - Intronic
1165151602 19:33763901-33763923 TCCCAAAGCAGGCCCCGGCCTGG + Intronic
1165645128 19:37429531-37429553 TGCCAAAGGATGGCCAGATCTGG - Intronic
1165789900 19:38485134-38485156 TGCCAGAGGGGGACCCAGTCTGG + Intronic
1167772920 19:51531891-51531913 TGCCCCGGGAGGCCCTGGTCCGG - Intergenic
925041649 2:735802-735824 TTCCAAAAGAGGCCCTGGGCTGG + Intergenic
927591198 2:24359999-24360021 TGCCAGACGAGGCCGCGGCCAGG + Intronic
933902340 2:86859104-86859126 TGCCGAAGGAGACCCAGGACAGG + Intronic
935778205 2:106490164-106490186 TGCCGAAGGAGACCCAGGACAGG - Intergenic
938548146 2:132353339-132353361 TGGCAGAGGAGGACCCGGGCGGG + Intergenic
945560174 2:211330043-211330065 GGCCAAGCGAGGCCCGGGTCGGG - Intergenic
945668694 2:212775041-212775063 TACCAAAAGAGGCACCAGTCTGG + Intergenic
1168968318 20:1913519-1913541 AGGCAAAGGTGGCCCAGGTCAGG + Intronic
1170898866 20:20440726-20440748 TGCCAAGGAAGGCCCGGGCCGGG - Intronic
1171877017 20:30586111-30586133 TGGCAGAGGAGGACCCGGGCGGG + Intergenic
1172613539 20:36268322-36268344 TGCCAATGGAGCCCCCGCCCTGG - Intronic
1174419351 20:50389661-50389683 TGCCAAGGGAAGGCCTGGTCAGG - Intergenic
1175501563 20:59454585-59454607 TTCCAAAGGAGGCTAAGGTCTGG - Intergenic
1175749514 20:61485553-61485575 TGCCAGACGAGGCCCAGGTGTGG + Intronic
1178547207 21:33502311-33502333 GGCCAAAGGAGGGCCGGGTGCGG + Intergenic
1179423604 21:41255243-41255265 TGGCAATGGTGGCCCAGGTCTGG + Intronic
1180581958 22:16846123-16846145 TGCCACAGCAGTCCCCGGGCTGG - Intergenic
1180945740 22:19692134-19692156 TGCCAAAGGAGGCCAAGCTGAGG - Intergenic
1184105791 22:42366929-42366951 TGCCAGGGGAGGCCCAGGGCAGG - Intergenic
1184609110 22:45591100-45591122 TGCCAAAGGAAGACAAGGTCTGG - Intronic
1185389084 22:50549179-50549201 TGCCCGAGGAGGCCCCGCTTCGG + Exonic
950270644 3:11611891-11611913 ATCCAAAGGAGGCCCCAGCCTGG - Intronic
950405274 3:12800371-12800393 TGCCACAGGAGGCGGGGGTCAGG + Intronic
954083247 3:48224638-48224660 TGTCAAAGGAGCCCCTGGCCTGG - Exonic
955215174 3:56979414-56979436 TGCCACAGGAGGCCCAAGCCAGG + Intronic
961328948 3:126127721-126127743 TGCCAGAGGAGGGCCTGGCCAGG - Intronic
962575338 3:136751517-136751539 TTCACAAGGAGGCCCCCGTCGGG + Intronic
968835506 4:2961761-2961783 TGCCTTAGGAGATCCCGGTCAGG - Intronic
979259260 4:118633314-118633336 TGCCCCAGGAGGCCACGGTGAGG - Intergenic
979329087 4:119407245-119407267 TGCCCCAGGAGGCCACGGTGAGG + Intergenic
985919262 5:2956874-2956896 TGGCAGTGGGGGCCCCGGTCAGG + Intergenic
990983809 5:61623885-61623907 TGCCAAAGGAGGCGCTGATGTGG - Intergenic
993828184 5:92719913-92719935 TGGCAAAGGAGGTACCAGTCAGG - Intergenic
995525014 5:113043811-113043833 TGCAAAAGGAGCCAGCGGTCTGG - Intronic
1003076148 6:2985263-2985285 TGCCCAAGGAGGCACCCTTCTGG - Intergenic
1017490531 6:154941012-154941034 TCCCAAAGGAGGCTCCGTTCTGG + Intronic
1019160062 6:170063541-170063563 TTCCCAGGGAGGCCCCGCTCAGG - Intergenic
1022400077 7:30028495-30028517 TTCACAAGGAGGCCCGGGTCCGG - Exonic
1024489130 7:49957511-49957533 TGCTGAAGGAGGCCCCAGACAGG + Intronic
1025251597 7:57354822-57354844 TGCCAAGGGAAGGCCTGGTCAGG + Intergenic
1029352444 7:100023829-100023851 TGCCCAAGGAGCTCCAGGTCTGG + Exonic
1029728749 7:102425696-102425718 TGCACAAGGAGGCCCGGGCCAGG + Exonic
1032436835 7:131907649-131907671 TGCCATAGGATGCCCCTTTCTGG - Intergenic
1032718389 7:134530404-134530426 TGGCAAAGGAGACCCCAGTGAGG + Intronic
1034859252 7:154581965-154581987 TGCCAAGGGTGGCCCAGGACAGG - Intronic
1037150819 8:15633464-15633486 TTCCAAATGAGGCCACAGTCTGG - Intronic
1039063716 8:33592059-33592081 TGCCTCAGGAAGCCCCGGTTGGG + Exonic
1039470318 8:37809413-37809435 TGTCAATGGAGGCCCCTCTCTGG + Intronic
1040917323 8:52576091-52576113 TGCCAAATGAGGCATTGGTCTGG + Intergenic
1041005721 8:53495375-53495397 TGCCAAAGGACCCCCCCGTGGGG - Intergenic
1041200824 8:55451137-55451159 GGCCACAGGAAGCCCGGGTCGGG + Intronic
1041978875 8:63832098-63832120 TGCCAAGGGAGGGCCAGGTGGGG + Intergenic
1048796062 8:138151313-138151335 TGCCCAAGGAGACCCCTGCCAGG - Exonic
1048862744 8:138736242-138736264 TGCCAGGGGAGGCCCAGATCAGG + Intronic
1061149193 9:128819277-128819299 TGCCCAACGCGCCCCCGGTCAGG + Intronic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1062587010 9:137254006-137254028 TGACAAGGGAGGCCCCAGCCAGG - Intergenic
1185499400 X:585396-585418 TGCCACAGGTGGCCCAGGTGGGG - Intergenic
1185894136 X:3843429-3843451 TGGCAGAGGAGACCCCGGACTGG - Exonic
1185899255 X:3881853-3881875 TGGCAGAGGAGACCCCGGACTGG - Intergenic
1185904372 X:3920282-3920304 TGGCAGAGGAGACCCCGGACTGG - Intergenic