ID: 1144846532

View in Genome Browser
Species Human (GRCh38)
Location 17:18222819-18222841
Sequence TGCTTGAACCCGGCGGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144846532_1144846540 9 Left 1144846532 17:18222819-18222841 CCTCCGCCCGCCGGGTTCAAGCA No data
Right 1144846540 17:18222851-18222873 CCTCAGCCTCCCGAGTAGCTGGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
1144846532_1144846538 8 Left 1144846532 17:18222819-18222841 CCTCCGCCCGCCGGGTTCAAGCA No data
Right 1144846538 17:18222850-18222872 GCCTCAGCCTCCCGAGTAGCTGG 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
1144846532_1144846542 17 Left 1144846532 17:18222819-18222841 CCTCCGCCCGCCGGGTTCAAGCA No data
Right 1144846542 17:18222859-18222881 TCCCGAGTAGCTGGGATTACAGG 0: 44204
1: 206428
2: 253404
3: 185491
4: 423321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144846532 Original CRISPR TGCTTGAACCCGGCGGGCGG AGG (reversed) Intergenic
No off target data available for this crispr