ID: 1144847434

View in Genome Browser
Species Human (GRCh38)
Location 17:18227208-18227230
Sequence GAGCTGCCAGGACCCTCACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 1, 2: 2, 3: 12, 4: 216}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144847430_1144847434 7 Left 1144847430 17:18227178-18227200 CCTGCCTAGGTCTGCAGTGATTG 0: 1
1: 0
2: 1
3: 7
4: 115
Right 1144847434 17:18227208-18227230 GAGCTGCCAGGACCCTCACACGG 0: 1
1: 1
2: 2
3: 12
4: 216
1144847431_1144847434 3 Left 1144847431 17:18227182-18227204 CCTAGGTCTGCAGTGATTGCCGA 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1144847434 17:18227208-18227230 GAGCTGCCAGGACCCTCACACGG 0: 1
1: 1
2: 2
3: 12
4: 216
1144847429_1144847434 8 Left 1144847429 17:18227177-18227199 CCCTGCCTAGGTCTGCAGTGATT 0: 1
1: 0
2: 1
3: 24
4: 220
Right 1144847434 17:18227208-18227230 GAGCTGCCAGGACCCTCACACGG 0: 1
1: 1
2: 2
3: 12
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144847434 Original CRISPR GAGCTGCCAGGACCCTCACA CGG Intronic
900013247 1:133346-133368 GTGCGGTCAGGACCCCCACAGGG - Intergenic
900043312 1:489333-489355 GTGCGGTCAGGACCCCCACAGGG - Intergenic
900064749 1:724330-724352 GTGCGGTCAGGACCCCCACAGGG - Intergenic
900079502 1:845059-845081 GAGCTCCCACGAATCTCACATGG + Intergenic
900566934 1:3338189-3338211 AAGTTGCAAGGACCCTCGCAAGG + Intronic
902415654 1:16237162-16237184 GAGCTGCCAGCACGCGCAGAAGG - Exonic
902492450 1:16794346-16794368 GAGTTGCCAGGACTCTCATGGGG - Intronic
903273378 1:22206004-22206026 GCTCTGCCAGAACCCACACAGGG - Intergenic
903668174 1:25020747-25020769 GAGCAGCCAGGCCCCTCAGCAGG - Intergenic
904417302 1:30371214-30371236 GGGCTGCCAGGATTCTCCCAGGG + Intergenic
905223872 1:36466889-36466911 CAGCTGCCCGGACCCAGACAGGG - Exonic
907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG + Intronic
907504253 1:54906209-54906231 GAGCTTCCAGGTCACTCATAGGG - Intergenic
910214126 1:84825093-84825115 CAGCAGACAGGACCCTTACAGGG - Intronic
912301863 1:108526102-108526124 GAGCTGGCAGGTGCCTCAGAGGG + Intergenic
917984100 1:180297178-180297200 GAGCTGGAAGTACCCACACAAGG - Intronic
918117331 1:181508566-181508588 GAGCAACCAGGAACCACACAAGG - Intronic
918920552 1:190704099-190704121 GACCTGCCAGCATCCTCATAAGG - Intergenic
920516018 1:206585150-206585172 GAGCTCCCAGCACCCTCTCTTGG + Intronic
922261684 1:223949844-223949866 GTGCGGTCAGGACCCCCACAGGG - Intergenic
922500159 1:226091357-226091379 GAGCTGCAGGGACCCTGAAAGGG - Intergenic
922763864 1:228147807-228147829 GAGGTCTGAGGACCCTCACAGGG - Intronic
923527999 1:234788190-234788212 GAGTTGCCAGGACTCTCATGGGG + Intergenic
924342848 1:243052018-243052040 GTGCGGTCAGGACCCCCACAGGG - Intergenic
1062938241 10:1403602-1403624 CAGCTGCCGGGCCCCTCACGTGG - Intronic
1063799780 10:9561639-9561661 GAGGTGCCACAACTCTCACATGG + Intergenic
1065756995 10:28939840-28939862 CAGGAGCCAGGACTCTCACACGG - Intergenic
1068518613 10:58054694-58054716 TAGCTGCCAGAAACCTCACAGGG - Intergenic
1069923243 10:71830385-71830407 AAGCTGACAGGACCCTCAGGAGG - Intronic
1071369909 10:84940624-84940646 GAGGTGCCAGGATCCTAGCAGGG + Intergenic
1071762401 10:88623335-88623357 GAGCTGACAGGACACTCAGCTGG - Intergenic
1071937541 10:90548216-90548238 CAGCTGACAGAACCCCCACATGG + Intergenic
1075703432 10:124483992-124484014 GATCAGCCAGGACCCCCTCAGGG + Intronic
1075778258 10:125001708-125001730 GAGCTGCCCGTACACTCACAGGG - Intronic
1076539316 10:131204177-131204199 GAGCTGCCAAGACCCTAGCTAGG - Intronic
1076969584 11:125550-125572 GTGCGGTCAGGACCCCCACAGGG - Intergenic
1077104686 11:837075-837097 GTGGTGCCAGGACCGTCACCAGG - Intronic
1078463667 11:11534301-11534323 GATCTGCCAGAACCCTCTGAAGG + Intronic
1081874976 11:46402276-46402298 GGGCTCCCAGGCTCCTCACAGGG + Intronic
1083206458 11:61152543-61152565 GAGCTCCCATGGCCCTCCCATGG + Intronic
1083603161 11:63961398-63961420 TCACTGCCAGGACCCTCAGAGGG - Intergenic
1083744561 11:64728164-64728186 GAGCTGCCAGGACATTATCAGGG + Intronic
1083924447 11:65797552-65797574 GGCCTCCCAGGACCCTCCCAGGG + Intergenic
1084533466 11:69743091-69743113 GAGCTTCCCAGGCCCTCACATGG + Intergenic
1085869277 11:80330234-80330256 GAGCTCCCAGCAGCCTGACATGG - Intergenic
1088764641 11:112963157-112963179 GAGCTGCCAGGACAGTCTCCCGG + Intronic
1089681048 11:120119195-120119217 AAGCTGCCAGGGCACTCAGAGGG + Intronic
1090445913 11:126764542-126764564 GAGCTGCCAGGAACCTCATGAGG - Intronic
1091324465 11:134676073-134676095 GACCCTCCATGACCCTCACAAGG - Intergenic
1091641568 12:2241104-2241126 AAGCTGCCAGGAGCCTCGCAAGG - Intronic
1092208391 12:6630837-6630859 GAGCTGCCAGGCCCCTGGCCTGG + Intronic
1092591905 12:9959787-9959809 GAGCTACCAGTACCCTCAGCAGG - Intronic
1094558234 12:31524307-31524329 GAGCTTCCAGGACTCTCTTAAGG - Intronic
1096231156 12:49897619-49897641 GGGCTGACAGGTCCCTAACAGGG - Intronic
1101558659 12:105834632-105834654 GAGCTGCCAGCTCCCACACTAGG - Intergenic
1101588625 12:106107239-106107261 GACCTGCCAGGGCCAACACATGG + Intronic
1101747046 12:107550375-107550397 GACCTGCCTGGACCCTAACAAGG + Intronic
1104582119 12:130018731-130018753 GAGGTGTAAGGACCATCACACGG - Intergenic
1105293609 13:19070484-19070506 GAGACGCCAGGATCCTCACAGGG + Intergenic
1108731466 13:53239706-53239728 CCGCTGCCAGGACCCACACCCGG - Intergenic
1112972157 13:105273765-105273787 GAGCTCCCAGCACTCGCACACGG - Intergenic
1113478051 13:110599434-110599456 GAGGTGCCAGGCCTTTCACATGG + Intergenic
1113505669 13:110814014-110814036 GCGCTGCCCGGGCCCTCACTAGG + Intergenic
1114459177 14:22876032-22876054 GAGGTGCCAGCAGCCCCACAGGG - Exonic
1115972058 14:38955844-38955866 GAACTGACAGGACACTCAGAGGG - Intergenic
1117100004 14:52335846-52335868 GAGCTGTCAGGACCCAAGCAGGG + Intergenic
1118725197 14:68624076-68624098 GAGATGCCTGGACCTCCACAGGG - Intronic
1118818780 14:69331300-69331322 CAGCTGCCAGGAGCCTGCCAGGG + Intronic
1119756123 14:77120950-77120972 CACCTGCCAGGGCCCTCACAAGG - Intronic
1120864264 14:89282386-89282408 GAGTGGCCAGGAGCTTCACAGGG + Intronic
1121656284 14:95598164-95598186 GAGCTGCCAGGAGCCACATGTGG + Intergenic
1122325537 14:100879117-100879139 GAGCTGCCAGGGGTCCCACAGGG - Intergenic
1124901468 15:33827063-33827085 GATCTGCCATGACCCAAACATGG + Intronic
1125315461 15:38426611-38426633 CAGCTGCCAGGCCACTCACTGGG - Intergenic
1125363684 15:38891019-38891041 AAGCTGCCACAACCCTCACAAGG - Intergenic
1126108336 15:45161582-45161604 GTGCTGCCTGGGCCCCCACAGGG + Intronic
1127825850 15:62702133-62702155 GAGCTGCCAGGACCCTCGCTGGG + Exonic
1128758040 15:70196465-70196487 GAGCAACCAGGCCCCTCCCAGGG + Intergenic
1128798212 15:70479910-70479932 TCCCTGCCAGGACCCTGACAGGG + Intergenic
1131256090 15:90863339-90863361 GAGCTGCCAGTCCCCTTGCATGG - Intergenic
1131605011 15:93894336-93894358 GAGCTTCCAGGACTTTCTCAAGG + Intergenic
1132591826 16:729455-729477 GAGCCACCCAGACCCTCACAGGG + Exonic
1133125942 16:3646112-3646134 GAGCTGACAGGAAGCTCCCAGGG - Intronic
1133283444 16:4679833-4679855 GAGCTGCCGAGACGCACACATGG + Intronic
1136346734 16:29680585-29680607 GAGAAGCCAGGACCCACCCATGG - Intronic
1138423507 16:56915127-56915149 GAGCTGCAAATACCCTCACTTGG - Exonic
1138515335 16:57532981-57533003 GAGCTGCCAGGCCTGGCACAGGG + Intronic
1140048543 16:71459114-71459136 AAGCTACCAGAACCTTCACAAGG + Intronic
1141275514 16:82584301-82584323 GGGCTGCCAAGAGGCTCACAGGG - Intergenic
1142456467 17:60123-60145 GTGCGGTCAGGACCCCCACAGGG - Intergenic
1143248548 17:5505269-5505291 GAGCTCCCAGAAGCCTCTCAGGG - Intronic
1144847434 17:18227208-18227230 GAGCTGCCAGGACCCTCACACGG + Intronic
1145267177 17:21385522-21385544 GAGCGGCCAGGTCCCTCCCCAGG + Intronic
1146674065 17:34760908-34760930 GAGCTGCCAGGACTCTCACAGGG + Intergenic
1147262532 17:39217019-39217041 GTGCTGCCAGTACTGTCACATGG - Intronic
1147968396 17:44206675-44206697 GAGCTGCCTGGACCCGTTCATGG - Exonic
1148458057 17:47821478-47821500 GAGGGGCCAGGATCCCCACAGGG - Intronic
1148867221 17:50634944-50634966 GAGCTCCCCGGAACCGCACAGGG - Exonic
1149658504 17:58322819-58322841 GACCCACCAGCACCCTCACAGGG + Intronic
1152057421 17:78040951-78040973 GAGCTGCCAGGAAGCTCCCGGGG - Intronic
1152682123 17:81673964-81673986 GGGCCGCCAGGTCCATCACAAGG - Intergenic
1153057545 18:961919-961941 AAGATGACAGGACCCTCACGCGG - Intergenic
1153812270 18:8762648-8762670 CGGCTGCCAGAACCCCCACAGGG + Intronic
1153817383 18:8802215-8802237 TAGCTGCCCAGACCCCCACAAGG - Intronic
1154168405 18:12033419-12033441 GAGCTGACATGGCCCTCTCAAGG - Intergenic
1155652489 18:28158640-28158662 GAGTTCCCACGACCCTCTCAGGG + Intronic
1158649187 18:59271912-59271934 GAGGTGCCAGGCCCTTCGCAAGG + Intronic
1160102873 18:75939369-75939391 GAGCTGTCAGATCCATCACAGGG + Intergenic
1160413084 18:78688070-78688092 GACCTGCCAGGGCCCTGACCTGG + Intergenic
1160646388 19:195476-195498 GTGCGGTCAGGACCCCCACAGGG - Intergenic
1161028777 19:2048534-2048556 GAGCAGCCAGCATCCTCACTGGG - Intronic
1161861277 19:6800254-6800276 CAGCTGGCAGGAACATCACATGG - Intronic
1162718371 19:12647736-12647758 GAGCGGCCAGGGCCGTGACAGGG + Intronic
1164439232 19:28259423-28259445 GAGCTGCCTGTACCCTCACGGGG - Intergenic
1164593861 19:29520858-29520880 GCCCTGCCTGGACCCTGACAGGG - Intergenic
1166912361 19:46168217-46168239 GAGCTGCCAATACCCAGACAAGG + Intergenic
1167372073 19:49088835-49088857 GAGCTGCCTTGGCCCTCAGAGGG + Intronic
1168015018 19:53566000-53566022 GAGCTGTCAGGACCACCACCAGG + Intronic
929116196 2:38446425-38446447 GACTTTCCAGGACCATCACAAGG + Intergenic
931667125 2:64617591-64617613 GGGCTCCCAGGACCCTCACCAGG + Intergenic
932087215 2:68773101-68773123 GGGCTCCCTTGACCCTCACAAGG - Intronic
932163721 2:69486577-69486599 GGACTCCCAGGACTCTCACAGGG + Intronic
934623826 2:95832563-95832585 GAGTTGAAAGGACCCTCACTGGG + Intergenic
934809800 2:97269032-97269054 GAGTTGGAAGGACCCTCACTGGG - Intergenic
934827897 2:97438953-97438975 GAGTTGGAAGGACCCTCACTGGG + Intergenic
935689006 2:105713603-105713625 GAGGTGCTTGGACCCTGACATGG - Intergenic
939230380 2:139417304-139417326 GATCTGGAAGGACCCCCACATGG - Intergenic
940412928 2:153387416-153387438 CAGCTGCCAGGACCCTGAGTGGG - Intergenic
941002244 2:160214327-160214349 GTCCTGCCAGGAACTTCACAAGG + Intronic
941175531 2:162193454-162193476 GATCTGCCAGGAATCTAACAAGG + Intronic
941273976 2:163466950-163466972 GGGCTTCCAGGATCCTTACAGGG - Intergenic
944861184 2:203817317-203817339 GTGCTGACAAGACACTCACATGG - Intergenic
947722682 2:232379221-232379243 CAGCTGCCAGGATCCTAAAAGGG + Exonic
947727024 2:232407307-232407329 CAGCTGCCAGGATCCTAAAAGGG + Exonic
947749519 2:232525206-232525228 GATCTGCCAGGACCTACAGATGG - Exonic
948663912 2:239522983-239523005 GAGCTCCCAGGCCCGGCACAGGG - Intergenic
1170991074 20:21302555-21302577 GTGCTAACAGTACCCTCACAAGG + Intergenic
1171878204 20:30597881-30597903 GAGTCACCAGGATCCTCACAGGG + Intergenic
1172034239 20:32000412-32000434 GGGCTGCAAGGACCCTGGCAGGG - Exonic
1174419109 20:50388031-50388053 GAGCTGGCAGGAGCCTCAGCAGG + Intergenic
1175492461 20:59388477-59388499 GGGTGGTCAGGACCCTCACAGGG + Intergenic
1175516502 20:59573840-59573862 GAGCTGCCTGGACAGGCACAGGG - Intergenic
1175585116 20:60133024-60133046 GAGAAGCCAGCACCCCCACATGG + Intergenic
1176279124 20:64290740-64290762 GTGCGGTCAGGACCCCCACAGGG + Intergenic
1179190403 21:39117953-39117975 GGGCTGCCAGCTCCCTGACAGGG + Intergenic
1179994423 21:44967405-44967427 GAGCCACCAGGCTCCTCACAAGG - Intronic
1181427882 22:22855927-22855949 GAGCTCCTAGGACCCACCCAGGG - Intronic
1181437891 22:22921004-22921026 GGGCATCCAGGACCCTCCCAGGG + Intergenic
1181681566 22:24499124-24499146 GAGCTGTCAGGGCCGTCACATGG + Intronic
1183587198 22:38759750-38759772 GAGCTGGCTGTACACTCACAAGG + Intronic
1183720471 22:39558867-39558889 GAGCCCCCAGGGCCCTGACAAGG - Intergenic
1185142050 22:49108017-49108039 GAGCAGCCAAGACCCTTACCAGG - Intergenic
950143976 3:10634794-10634816 TGGCTGCCAGGAGGCTCACAGGG - Intronic
950645637 3:14374933-14374955 GAGGTGCCTAGACCCTCACCTGG - Intergenic
954277679 3:49553356-49553378 GAGGGGCCAGGACCCTCCCTGGG - Intergenic
954537439 3:51371788-51371810 GGCCTGCAAGGCCCCTCACACGG + Intronic
955108344 3:55922664-55922686 GACCTTCCAGGTCCCCCACAGGG + Intronic
961037429 3:123652432-123652454 GAGTGCTCAGGACCCTCACATGG + Intronic
961422123 3:126814784-126814806 GAGCTCCCATGACCCTCTCTTGG - Intronic
961442809 3:126962807-126962829 GGGCTGCGAGGACTCACACAGGG - Intergenic
962447138 3:135476432-135476454 GAGTTCCCATGACCCTCTCAGGG - Intergenic
963068171 3:141280375-141280397 GTGATGCCAGGACCCTCTAATGG + Intronic
967197672 3:187042901-187042923 CAGCACCCAGGACCCCCACAGGG + Exonic
967406824 3:189125672-189125694 GAGCTGGCAGAATCCTAACATGG - Intronic
968371293 3:198224050-198224072 GTGCGGTCAGGACCCCCACAGGG + Intergenic
968628420 4:1638185-1638207 GGGGGGCCAGGACCCTCACCAGG - Intronic
968894812 4:3393272-3393294 CAGCTGCCAGAACTCACACAGGG - Intronic
970065372 4:12087736-12087758 GTGTTGCCAGGAGACTCACATGG - Intergenic
970198924 4:13581915-13581937 GAGCTGCCAGGCCAGGCACATGG - Intronic
971006557 4:22380792-22380814 AAGCTTTCAGAACCCTCACAAGG + Intronic
973314888 4:48749522-48749544 GAGCTTCCAGGATCCCGACAAGG - Intronic
979495808 4:121380974-121380996 GAGGCGCCAGGACCCTCGCGTGG - Exonic
982751604 4:159168491-159168513 GGGCAGCCAGGCCCCACACATGG + Intronic
984269461 4:177533542-177533564 GAGATACCAGGCCCCTCAAAAGG + Intergenic
986796033 5:11212908-11212930 GAGGTGATAGGACCCACACATGG + Intronic
991960597 5:72040139-72040161 CAGCTGCCACCAACCTCACAAGG - Intergenic
1000107170 5:158071080-158071102 GAGCTTCCAGGGCCATCACCAGG - Intergenic
1001432936 5:171677649-171677671 GAGCTCCCAGTGCCCACACATGG + Intergenic
1002730531 5:181329596-181329618 GTGCGGTCAGGACCCCCACAGGG + Intergenic
1002753997 6:144508-144530 GTGCGGTCAGGACCCCCACAGGG - Intergenic
1004126398 6:12878179-12878201 GAGCAGCCAAGAACCTTACAGGG + Intronic
1004244891 6:13964869-13964891 GGGCTGCCAGGACCCTTCCAAGG - Intronic
1004842757 6:19605988-19606010 GAGGTGTCAGGACCTCCACACGG + Intergenic
1005666533 6:28063147-28063169 GAGTTTTCAAGACCCTCACAAGG - Intergenic
1006521666 6:34574529-34574551 GAGCTCCCTGGAGCTTCACACGG - Intergenic
1006829107 6:36958194-36958216 GAGCTGGCTGGGCCCTCATAGGG + Intronic
1007358256 6:41336148-41336170 GAGATGCCAGTACCCGCCCACGG + Exonic
1011660360 6:89589344-89589366 GAGGGGCCAGGACCCTCGGAAGG - Intronic
1016756496 6:147693359-147693381 CAGCTGTCAGGACGCTGACAGGG + Intronic
1017744431 6:157434333-157434355 CGGCTGGCAGGACCCTAACAGGG - Intronic
1018654557 6:166021911-166021933 GAGCTATTAGGACCTTCACACGG + Intergenic
1019524166 7:1473292-1473314 GAGAGGCCAGGACGCTCAGAGGG + Intronic
1019918937 7:4150661-4150683 GAGCTGCCAGGGGCTTCACCTGG - Intronic
1022305903 7:29146392-29146414 GAGCTGGCACGACCCACGCAGGG + Intronic
1022544460 7:31173257-31173279 GAGAGGCCAGGACCCACAGAGGG + Intergenic
1022817611 7:33928579-33928601 GAGCAGCCAGGACACTCTAATGG + Intronic
1023989159 7:45117825-45117847 GAGCTCCCAGGACTCTGATAAGG - Intergenic
1025093053 7:56078715-56078737 GAGCTGGCAGGAGAGTCACAAGG - Intronic
1026973079 7:74479599-74479621 GAGCTGCCGGGACCCTCCCAGGG - Intronic
1028076437 7:86521937-86521959 GAGCTTCCAAGACACGCACAAGG + Intergenic
1030944964 7:115707228-115707250 GAGCTGTCATGACACACACAGGG - Intergenic
1031193467 7:118585073-118585095 AAGCTTCCTGTACCCTCACAAGG - Intergenic
1032019727 7:128400633-128400655 GAGAAGCCAGGACCCTCAGTGGG + Intronic
1032052207 7:128656516-128656538 GTGCGGTCAGGACCCCCACAGGG + Intergenic
1032094293 7:128929891-128929913 GTCCTGCCAGGATCCTCACCTGG + Intergenic
1037629590 8:20641949-20641971 GAGCTGCTGGTGCCCTCACAGGG + Intergenic
1039389320 8:37164554-37164576 TATATGCCAGGATCCTCACACGG - Intergenic
1039659153 8:39444651-39444673 GAGCTGCCATGAACCTCAGGGGG - Intergenic
1040079957 8:43275671-43275693 GAGGTGGCAGGTCCCTCAAAAGG - Intergenic
1040315693 8:46259729-46259751 GAAATGCCAGGAGCCTCCCAAGG + Intergenic
1043458688 8:80437873-80437895 GAGTTCCCAGTACCTTCACAGGG - Intergenic
1047556618 8:125939005-125939027 GAGTTGCCAGGACCATGAGAAGG + Intergenic
1048321697 8:133405280-133405302 TAGCTGCCTGGAACCTCATATGG - Intergenic
1049202732 8:141349865-141349887 GAGCTCCCAGAACCCTAACTCGG - Intergenic
1049329157 8:142040766-142040788 GAGCTCCCAGAACCCTCGCTAGG - Intergenic
1053138163 9:35664773-35664795 GAGCTCCCAGGAGCCAAACAGGG + Exonic
1057266826 9:93622747-93622769 GAGACACCAGGATCCTCACAGGG - Intronic
1059517932 9:114913198-114913220 GAGTTGTCAGGACCCACACGAGG + Intronic
1060069612 9:120534642-120534664 CATCTGTCAGGACCCTCAGAGGG + Intronic
1060236200 9:121864520-121864542 GAGCTTCCATGACCTGCACAAGG - Intronic
1060791556 9:126488973-126488995 GAGCTGCCTCCACCCCCACAAGG + Intronic
1061091899 9:128431219-128431241 GGGCTACCAGGACCCTTACTCGG + Exonic
1061896807 9:133652499-133652521 GAGCAGACAGGACACTCCCAGGG + Intronic
1062122626 9:134841890-134841912 GAGGCGACAGGACCCTCCCAAGG - Intronic
1062754942 9:138282106-138282128 GTGCGGTCAGGACCCCCACAGGG + Intergenic
1185785741 X:2889554-2889576 GAGCTCCAAGGACCCTCTCTTGG - Intergenic
1186098984 X:6134875-6134897 GAGCTTCCAGTTCTCTCACAAGG - Intronic
1189134042 X:38531446-38531468 GAGCTGCCTGGACCCGCTTATGG - Intronic
1192552133 X:72062917-72062939 GAGCTGAGAGGACCCTCAGGAGG + Intergenic
1192988816 X:76428540-76428562 GAGGTGCCTGGTCCCTCACCAGG - Exonic
1195614264 X:106900422-106900444 GAGCTCCTAGAACCCTCCCATGG + Exonic
1199592081 X:149476835-149476857 CAGCTGCCTTGGCCCTCACATGG + Intergenic