ID: 1144847818

View in Genome Browser
Species Human (GRCh38)
Location 17:18229203-18229225
Sequence CTGTGAAAGGGGCAGGGGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1058
Summary {0: 1, 1: 0, 2: 4, 3: 92, 4: 961}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144847809_1144847818 10 Left 1144847809 17:18229170-18229192 CCAAAGACAGGAGACTGGTGCAG 0: 1
1: 0
2: 3
3: 25
4: 204
Right 1144847818 17:18229203-18229225 CTGTGAAAGGGGCAGGGGAGCGG 0: 1
1: 0
2: 4
3: 92
4: 961
1144847807_1144847818 15 Left 1144847807 17:18229165-18229187 CCAGGCCAAAGACAGGAGACTGG 0: 1
1: 0
2: 1
3: 25
4: 235
Right 1144847818 17:18229203-18229225 CTGTGAAAGGGGCAGGGGAGCGG 0: 1
1: 0
2: 4
3: 92
4: 961
1144847805_1144847818 30 Left 1144847805 17:18229150-18229172 CCAGGGAGGGCACAGCCAGGCCA 0: 1
1: 1
2: 2
3: 55
4: 539
Right 1144847818 17:18229203-18229225 CTGTGAAAGGGGCAGGGGAGCGG 0: 1
1: 0
2: 4
3: 92
4: 961

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144847818 Original CRISPR CTGTGAAAGGGGCAGGGGAG CGG Intronic
900385233 1:2407559-2407581 CTGTGACAGGGGCATGGAAGTGG - Intronic
900401555 1:2474883-2474905 CCGTGTAAGGGGCAGCGCAGGGG - Intronic
900486092 1:2923540-2923562 CTGGGGAAGGGGGAAGGGAGTGG - Intergenic
900542901 1:3212878-3212900 CTGTGCCAGGAGCAGGGAAGAGG - Intronic
900543451 1:3215665-3215687 GTGGGAAAGGGCCAAGGGAGGGG - Intronic
900617164 1:3570701-3570723 CTGGCACAGGGGCAGGGCAGGGG - Intronic
900808990 1:4786941-4786963 TTGTGGAAGGGGCAGGGGTAGGG - Exonic
901388926 1:8929951-8929973 CTGGGAAGGGGGCAAGGGAAGGG + Intergenic
901941517 1:12665982-12666004 CTTGGAAAAGGGCAGGGGAATGG - Exonic
902331295 1:15732327-15732349 CTGGCAGCGGGGCAGGGGAGAGG - Intronic
902361315 1:15943948-15943970 TTGTGGGAGGGGCAGGTGAGGGG - Intronic
902409736 1:16205895-16205917 CTCTGAAAGGGGCGGGGGCGTGG - Intronic
902441554 1:16433436-16433458 ATGAGAAAGAGGCTGGGGAGGGG - Intronic
902454387 1:16521439-16521461 CTGGGAAAGAAGCCGGGGAGCGG + Intergenic
902718809 1:18290827-18290849 CGGGGAAAGGGGCAGGGAGGGGG - Intronic
902906007 1:19557861-19557883 AAGTGAAAGGGGAAGGGGAAGGG - Intergenic
903026191 1:20431140-20431162 GTGTGAAAGGGGTGGGGGTGGGG - Intergenic
903138474 1:21324577-21324599 GTGGGAAAGGGGCGGGGGTGGGG - Intronic
903168666 1:21538624-21538646 CTCTGCTAGGGGGAGGGGAGTGG + Intronic
903314714 1:22493628-22493650 AAGTGGAAGGGGCAGGAGAGAGG - Intronic
903320228 1:22538727-22538749 CTGTGAAATGGGGAGGGTAGGGG + Intergenic
903458960 1:23507691-23507713 GTGTGAAAGGGACAGTAGAGGGG + Exonic
903496697 1:23773233-23773255 CCGAGTCAGGGGCAGGGGAGGGG + Intergenic
903853025 1:26319621-26319643 CTGTGAAAGGGGGTGGACAGGGG + Intronic
904008109 1:27374335-27374357 AGGTGAGAGGGGCTGGGGAGCGG - Exonic
904344425 1:29858642-29858664 ATGTGAAAAGGACAGGGTAGAGG + Intergenic
904626943 1:31811722-31811744 CTGTGACAGGGACAGGCGGGTGG - Intronic
905037015 1:34925131-34925153 CAGTGGGAGGGGCAGGGGAGAGG - Intronic
905226357 1:36481725-36481747 CTGTGAGGGAGGCAGGGGTGAGG - Intronic
905945906 1:41901232-41901254 CTGAGGAAGGGGCTGGGGTGTGG + Intronic
906472674 1:46144262-46144284 CTCTGAAAGGAGCAGAGGTGAGG + Intronic
906790966 1:48658576-48658598 CTGTGAAATGGGCAGAGTTGGGG - Intronic
906795255 1:48691793-48691815 TTCTGAGAGGAGCAGGGGAGAGG - Intronic
907159549 1:52360386-52360408 CTGGGAGCAGGGCAGGGGAGGGG - Intronic
907479386 1:54734313-54734335 CTTTGAAAGGCGGAGGTGAGTGG - Intronic
907538990 1:55194967-55194989 CTTTGGAGGGGGCACGGGAGTGG - Intronic
907902128 1:58750637-58750659 CTGAGAAAGCAGAAGGGGAGGGG - Intergenic
908049331 1:60210609-60210631 CTGTGATGGGGTCGGGGGAGGGG + Intergenic
908121683 1:60991790-60991812 CTGGGCAAGGGGCAGAGCAGTGG - Intronic
908486572 1:64600089-64600111 CTGTGAAATGGGTAGGAGAAAGG + Intronic
908734082 1:67257484-67257506 ATGTGAGGGGGGCTGGGGAGAGG + Intronic
908883459 1:68759520-68759542 TGGTGGAAGGGGCAGTGGAGTGG - Intergenic
909149787 1:71987417-71987439 CTGTGGAAGGGGTAGGTGAAGGG + Intronic
909229077 1:73062303-73062325 CTGTGAAAGCAGCTGGGAAGGGG + Intergenic
910605450 1:89078747-89078769 CTGGGAAAGGCAGAGGGGAGAGG + Intergenic
910607662 1:89104767-89104789 TTGTGAACGGGGCAGGGGGAGGG + Intergenic
911041560 1:93594884-93594906 CTGAGAAAGGAGCCGGGGAGAGG - Intronic
911104121 1:94116806-94116828 ATGTGTAAAGGGCAGGGTAGGGG - Intronic
911513452 1:98837386-98837408 TTGTGGAAGGGGCAGTGGAAAGG + Intergenic
912569954 1:110614103-110614125 CTCTGCAAGGTGCAGGGGAGGGG - Intronic
912695706 1:111840561-111840583 TTCTGAATGGGGCAGTGGAGGGG - Intronic
912745598 1:112243206-112243228 CTGGGGAGTGGGCAGGGGAGGGG - Intergenic
913059185 1:115189063-115189085 CTGTTAGAGGGGGAGGGGAGAGG - Intergenic
913072050 1:115308242-115308264 CAGTGACAGGGGCATGGCAGTGG - Intronic
913644735 1:120845127-120845149 CGGTGAAAGAAGCCGGGGAGCGG + Intergenic
914747872 1:150512694-150512716 GTGTGAAAGGGGCAGGGGTTAGG - Intronic
914748055 1:150513714-150513736 CAGTGAAGGGGGCAGGGCCGTGG - Intronic
914757816 1:150574913-150574935 TTGGGAAAGGAGGAGGGGAGTGG - Exonic
914817222 1:151071770-151071792 CTGTGAAAGAAGCAGAGGCGAGG - Intronic
914844476 1:151274306-151274328 CAGAGAAAAGGGCAGTGGAGAGG + Intergenic
914869080 1:151458688-151458710 CTGGGGAAGGGGCGGGGGCGGGG - Intronic
914884968 1:151577285-151577307 CTGGGAAAGGGACAGGGGATAGG - Intronic
914944440 1:152051539-152051561 CTGTGCCTGTGGCAGGGGAGGGG + Intergenic
914997941 1:152561159-152561181 CTGGGTAAGTGGCAGGGCAGTGG - Intronic
915088643 1:153406046-153406068 CGGTGAGAGGGACAGGGCAGAGG - Intergenic
915096252 1:153464786-153464808 CGGTGAGAGGGACAGGGCAGAGG + Intergenic
915099597 1:153489810-153489832 CTGTGGTAGTGGCAGCGGAGTGG + Intergenic
915164091 1:153939055-153939077 ATGAGAATGGGGCAGAGGAGGGG + Intronic
915458823 1:156057590-156057612 CACTGAGAGGGGCATGGGAGTGG - Intronic
915462193 1:156076837-156076859 CCGCGGAAGTGGCAGGGGAGCGG + Exonic
915596325 1:156898354-156898376 GCGGGAAAGGGGCAGGGGTGAGG - Intronic
916501599 1:165392372-165392394 CAGTGGAAGGAGCAGGGGACAGG - Intergenic
916508027 1:165445500-165445522 CTGTGAAAGGAGGAGGGGGTGGG + Intergenic
916585058 1:166143210-166143232 CTGGGACAGTGGCAGGGAAGAGG + Intronic
916600717 1:166290719-166290741 ATGTGAAAGGGGAAGGGGTCTGG + Intergenic
917497832 1:175557490-175557512 CTGTCCAAGGTGCTGGGGAGAGG - Intronic
917675091 1:177311329-177311351 GAGGGAAAGGGGCTGGGGAGGGG + Intergenic
917678296 1:177340826-177340848 CCGGGAAAGGGAAAGGGGAGCGG + Intergenic
917977353 1:180248674-180248696 CTCTGCATGGGGCAGGGGTGAGG + Intronic
918216016 1:182392171-182392193 CCGTGAAGGCGGCAGGGCAGAGG - Exonic
918614230 1:186525987-186526009 CTGTGGGAGGAGCAGGGGAAGGG - Intergenic
919751216 1:201039441-201039463 CTGGGGAAGGGACTGGGGAGGGG + Intergenic
919808117 1:201392802-201392824 CATTGAAAGGGCCAGGGGAGAGG + Intronic
919811782 1:201413193-201413215 CTTGCAAAGGGGCTGGGGAGAGG - Intronic
919989801 1:202702011-202702033 ATGGGGAAGGGGCAGAGGAGAGG - Intronic
920074269 1:203325420-203325442 CTGGGAAAGGGACAGGGATGAGG - Intergenic
920922289 1:210308201-210308223 CTTTGGATGGTGCAGGGGAGTGG - Intergenic
921318771 1:213917278-213917300 CCATGAAAGGAGCAGGGCAGGGG + Intergenic
921324545 1:213977898-213977920 CAGTGAAGGGGGCAGTGGTGAGG - Intergenic
921324937 1:213980357-213980379 GTGTGGGAGGGGCAAGGGAGTGG - Intergenic
921707902 1:218345461-218345483 AAGTGAAAGAGGCAGGGGAGGGG + Intergenic
921891239 1:220355967-220355989 ATTTGAGAGGAGCAGGGGAGAGG + Intergenic
922613165 1:226944622-226944644 ATGTGAGAGGGCCAGGGGTGGGG + Intronic
923018468 1:230145183-230145205 CTGAGAATGGGGTTGGGGAGGGG - Intronic
923290574 1:232541089-232541111 CAATGAGAGGGGCAGGGGAAGGG + Intronic
923592112 1:235328244-235328266 CCGGGAAAGAGGTAGGGGAGGGG - Intronic
923732003 1:236560615-236560637 CAGTGGAAGGGGCAGGACAGTGG + Intronic
924049299 1:240064152-240064174 TTATGAAAGTGGGAGGGGAGGGG + Intronic
924867841 1:248005012-248005034 GTGGGAAGGGTGCAGGGGAGGGG + Intronic
1063313387 10:4978119-4978141 CTGGGAAAGGGGCAGGTGACAGG + Exonic
1063314565 10:4989598-4989620 CTGGGAAAGGGGCAGGTGACAGG - Exonic
1063925075 10:10969594-10969616 CAGAGAATGGGGAAGGGGAGAGG - Intergenic
1063996945 10:11628574-11628596 AAGTGGAGGGGGCAGGGGAGAGG - Intergenic
1064008264 10:11714952-11714974 CAGTGAGAAGGGCAGGAGAGGGG + Intergenic
1064444123 10:15378704-15378726 CTGCGAAGGGGACAGAGGAGGGG + Intergenic
1064723720 10:18256570-18256592 CTGTGGAGGAGGCGGGGGAGTGG - Intronic
1067168239 10:43882436-43882458 GGGAGTAAGGGGCAGGGGAGAGG - Intergenic
1067371039 10:45682815-45682837 CCGTGAAAGAGGGAGGAGAGAGG + Intergenic
1067388743 10:45843335-45843357 CCGTGAAAGAGGGAGGAGAGAGG - Intronic
1067417322 10:46113621-46113643 CCGTGAAAGAGGGAGGAGAGAGG + Intergenic
1067445521 10:46341232-46341254 CGGTGAAAGAGGGAGGAGAGAGG + Intergenic
1067767195 10:49095726-49095748 GTGTGAAAGGGCCAGACGAGGGG - Intronic
1067798356 10:49337570-49337592 CTCTGCAAGGGTCAGGGGTGGGG + Intergenic
1067874512 10:49992719-49992741 CGGTGAAAGAGGGAGGAGAGAGG + Intronic
1068528954 10:58163357-58163379 TTATGAAAGGAGCAAGGGAGAGG + Intergenic
1069620176 10:69832626-69832648 CTGTGGACAGGGCAGGGGAAGGG + Intronic
1069629950 10:69891567-69891589 CTGGGAATGGGGTAGGGGCGGGG - Intronic
1069698565 10:70405309-70405331 CTGTGGAAGGGGCTAGAGAGAGG + Intronic
1069781248 10:70957107-70957129 CTGAGAAGGGGGCAGGGGGTGGG - Intergenic
1069831646 10:71285528-71285550 CTGCGAAAGGGGCAGGGCTCTGG - Intronic
1069958986 10:72068582-72068604 GGGTGACAGGGGCAGGGGAGGGG - Intronic
1069958995 10:72068602-72068624 GGGCGACAGGGGCAGGGGAGGGG - Intronic
1069991989 10:72321742-72321764 TAGGGAAAGGGGGAGGGGAGGGG - Intergenic
1070135958 10:73693739-73693761 CAGTGAAAGAGGGAGGAGAGAGG - Intronic
1070448340 10:76531094-76531116 CTGTGACAGTGGCGGGGTAGGGG - Intronic
1070604914 10:77891931-77891953 CTGAGAGAGGGGCAGGGCTGGGG - Intronic
1070752874 10:78974179-78974201 CTGGGGAGGGGGCAGGGGGGAGG - Intergenic
1070767585 10:79065645-79065667 CTCTGAAAGGGGGATGGTAGCGG + Intergenic
1070782136 10:79143776-79143798 GTGTGATAGGGGCTGGGGGGTGG + Intronic
1070791962 10:79195013-79195035 CTGTGAAAGGGGCAGCGTCTTGG + Intronic
1071140671 10:82505958-82505980 CTGTGCAAGGGCCAGGCGCGTGG + Intronic
1071197172 10:83175221-83175243 CTTTGAAAAGGGTAGGGAAGAGG - Intergenic
1071480469 10:86061345-86061367 CTGGGAAGGGGCCAGGGAAGAGG - Intronic
1071494050 10:86155677-86155699 CAGTGAAAAAGGCAGGGGAGTGG - Intronic
1071571454 10:86699627-86699649 CTGTGCAGAGGGCAGGGGATTGG - Intronic
1072109720 10:92307011-92307033 CTCAAAAAAGGGCAGGGGAGGGG + Intronic
1072323471 10:94273394-94273416 CTGTGAAGGGGGCAGGAGCAGGG + Intronic
1073143565 10:101264643-101264665 CTGGGAAGGGGGCTTGGGAGGGG + Intergenic
1073502142 10:103949870-103949892 CAGTGGAAGGGGCAGGGGAAAGG + Intergenic
1073529288 10:104216640-104216662 CTGTGGGTGGGGAAGGGGAGAGG - Intronic
1074037331 10:109753565-109753587 CAGTGGAGGTGGCAGGGGAGTGG + Intergenic
1074110568 10:110419850-110419872 CTGGGCAAGGGGCAGGGATGGGG + Intergenic
1074144495 10:110704618-110704640 CTGTGTAAGAGGAAAGGGAGAGG + Intronic
1075420865 10:122299293-122299315 CTGTGTGTGGGGCTGGGGAGAGG + Intronic
1075545184 10:123350026-123350048 CAATGACAGGGGCAGGGGATTGG - Intergenic
1075963876 10:126593541-126593563 CTGTCAAAGAGGCATGGGGGAGG + Intronic
1076319462 10:129567215-129567237 CTGTGAGAGGTGGAGGGGACGGG - Intronic
1076344511 10:129771242-129771264 CTGTAATGGGGGCAGGGGTGGGG + Intergenic
1076369371 10:129941697-129941719 CAGAGAAAGGGGCAAGGCAGAGG + Intronic
1076478786 10:130770256-130770278 CTGAGAGAGGGCCAGGCGAGGGG - Intergenic
1076495632 10:130895876-130895898 TTGTGCAAGCGGCAGGGAAGGGG - Intergenic
1076668949 10:132108611-132108633 AGGTGAATGAGGCAGGGGAGGGG - Intronic
1076760939 10:132605420-132605442 ATGGGAAAGGGGCTGGGGATGGG + Intronic
1076762360 10:132611868-132611890 AGGTGAAGTGGGCAGGGGAGAGG + Intronic
1076762378 10:132611913-132611935 AGGTGAGGGGGGCAGGGGAGAGG + Intronic
1076839865 10:133040634-133040656 CTGTGGGCGGGGCAGGGGCGGGG + Intergenic
1077073705 11:690219-690241 CTGTCAAAAAGGAAGGGGAGGGG + Intronic
1077111519 11:864168-864190 CAGGGATGGGGGCAGGGGAGGGG + Intronic
1077144771 11:1040001-1040023 CTGGCCAAGGGGCAGGGAAGGGG - Intergenic
1077268931 11:1666107-1666129 CTGTCAGAGGGGCAGTGCAGGGG + Intergenic
1077271821 11:1685073-1685095 CTGTCAGAGGGGCAGTGCAGGGG - Intergenic
1077355337 11:2114258-2114280 GGGTGGAGGGGGCAGGGGAGAGG - Intergenic
1077504085 11:2922226-2922248 CAGTGAGAGGGTCAGGTGAGTGG - Intronic
1077571040 11:3338889-3338911 ATGTGAAAGTGGTAGGGGAGGGG + Intergenic
1077874681 11:6294117-6294139 CAGGGGAAGGGGCAGGGGTGGGG + Intergenic
1077889243 11:6406787-6406809 CTGTGAGAGTGGTGGGGGAGAGG - Intronic
1077922556 11:6652591-6652613 CTGTGGAAGAGGAAGGGGATGGG + Intronic
1078096120 11:8298314-8298336 GTGTTAAGGGGGCAGGGCAGAGG - Intergenic
1078881250 11:15450957-15450979 GAGTGCAAGGGGCAGGGAAGTGG + Intergenic
1079214353 11:18494697-18494719 CTGTGAAAGGTGTGGGGAAGAGG + Intronic
1079519954 11:21314686-21314708 CTGTGAAACAGGCAGAGGACAGG + Intronic
1080009847 11:27447029-27447051 CTGTCATGGGGTCAGGGGAGGGG + Intronic
1080906545 11:36551754-36551776 CTGTGGTGGGGTCAGGGGAGGGG - Intronic
1081364398 11:42216682-42216704 CTGTGGTGGGGTCAGGGGAGGGG + Intergenic
1081660854 11:44887632-44887654 CTATGCAAGGGTCAGGAGAGGGG - Intronic
1081750382 11:45506324-45506346 CTGTGGTAGGGTCAGGAGAGAGG - Intergenic
1081814239 11:45929643-45929665 CTGGGGAAGGGGTAGGGGGGTGG + Intronic
1082067341 11:47911404-47911426 CTGTGGCAGAGGGAGGGGAGAGG - Intergenic
1082634937 11:55583926-55583948 ATGTGAAAGGGGCAGAAGATTGG - Intergenic
1082715156 11:56603241-56603263 CTGTGGAAAGGGAAGGGGAGAGG - Intergenic
1083085435 11:60138503-60138525 GGCTGAAAAGGGCAGGGGAGAGG + Intergenic
1083192119 11:61059739-61059761 CTGTGAAGTGGGCAGGGCAGAGG - Intergenic
1083300927 11:61739331-61739353 ATGGCAAAGGGGCAGGGGAAGGG - Intronic
1083427026 11:62593530-62593552 TTGTGAAAGGGGATGGGGAGGGG - Exonic
1083570951 11:63762273-63762295 ATATGAAAGGGGGAGGGGCGGGG - Exonic
1083742839 11:64720289-64720311 GTGTGGAAGGGGCAGGGGCGAGG + Intronic
1083947390 11:65931903-65931925 CTGGGAATGGGGCCAGGGAGAGG - Intergenic
1084033754 11:66495607-66495629 CTGTGAGAGGGGCAGGCAGGTGG - Intronic
1084172331 11:67406604-67406626 CTGGGGAAGGGGCAGGGCACAGG - Intronic
1084213145 11:67633104-67633126 CTGTGGAAGGGACAGAGCAGGGG + Intronic
1084383531 11:68828455-68828477 CGATGAAAGGTGCTGGGGAGGGG - Intronic
1084735842 11:71104727-71104749 CTGTTAGAGGGGCAGGGAAGTGG - Intronic
1085083679 11:73652799-73652821 ATGTGACTGGGGCAGGGGAGGGG + Intronic
1085128231 11:74016554-74016576 CTGTGTACAGGGCAGGGGCGGGG + Intronic
1085402694 11:76244135-76244157 CTGGGAAAGGAACAGGGCAGGGG + Intergenic
1085507283 11:77067524-77067546 CTGGGGAAGGGGCAGGGCCGAGG + Intronic
1086509259 11:87538899-87538921 CTGTTAAAAGAGTAGGGGAGGGG + Intergenic
1087188919 11:95231652-95231674 TCGAGAAAGGGGGAGGGGAGTGG + Intronic
1087733007 11:101799648-101799670 CTGGGAAAGGAAGAGGGGAGAGG + Intronic
1088596494 11:111444877-111444899 CTCTGTGAGAGGCAGGGGAGTGG + Intronic
1089300055 11:117493079-117493101 GTGTGCAAGGGGTAGGGGTGAGG + Intronic
1089312089 11:117565117-117565139 AGGTGAGAAGGGCAGGGGAGGGG - Intronic
1089384011 11:118056292-118056314 CAGGGCAAGGGACAGGGGAGAGG + Intergenic
1089533651 11:119148292-119148314 CTGAGAAAGGGGCAGAGCAGGGG + Intergenic
1089560426 11:119340656-119340678 AGGGGAAAGGGGCTGGGGAGGGG - Intronic
1089603255 11:119627613-119627635 CTTTCACAGGGGCTGGGGAGGGG + Intronic
1090194173 11:124800533-124800555 CGGAGAAAGGCCCAGGGGAGTGG - Exonic
1090383781 11:126344817-126344839 CTGTGGAAGGGGTATGGGAGGGG - Intronic
1090697560 11:129263614-129263636 CGGGGAGAGGGGGAGGGGAGAGG + Intronic
1091227306 11:133965231-133965253 CTGTGAAAGAGGCCGGGCAGCGG - Intergenic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1091780829 12:3213644-3213666 CTGAGAAAGGGACAGGTGAAGGG - Intronic
1091785607 12:3241876-3241898 GTGGGGAGGGGGCAGGGGAGAGG - Intronic
1092322166 12:7487714-7487736 CTGTGAAAGGGACAGGGTTAGGG - Intronic
1092924087 12:13258170-13258192 CTGGGCAAGGGGCTGGGGACAGG + Intergenic
1093711840 12:22336192-22336214 CTGGAAAAGGGGAAGGGAAGGGG + Intronic
1094473759 12:30825621-30825643 CTGGGAATGAGGCAGGGGAATGG + Intergenic
1094499954 12:31012326-31012348 GTTTCCAAGGGGCAGGGGAGAGG - Intergenic
1094546853 12:31412398-31412420 CTGTCGCAGGGGCTGGGGAGGGG + Intronic
1094626886 12:32132696-32132718 ATGTGAGAGGGGCAGTGGAGAGG + Intronic
1095236388 12:39801090-39801112 CTGTGGTGGGGTCAGGGGAGGGG + Intronic
1096091450 12:48904510-48904532 CAGTGACAGGGCCAGGGCAGGGG - Intronic
1096183955 12:49566314-49566336 GTGTCAAGGAGGCAGGGGAGGGG - Intronic
1096385607 12:51193023-51193045 CTGTGACACAGGCAGGCGAGAGG + Intronic
1096498151 12:52050568-52050590 CCCTGTAAGGGGCTGGGGAGGGG + Intronic
1096779983 12:53986069-53986091 CGGGGAGGGGGGCAGGGGAGAGG + Intronic
1096783712 12:54005327-54005349 CTGACAAAGGAGCAGAGGAGAGG - Intronic
1096983480 12:55742524-55742546 CTGGGAAAGGGGTGGGGGGGGGG - Intergenic
1097114563 12:56687999-56688021 TTGTGAACGGGGCAGGGGGACGG + Exonic
1097167686 12:57094288-57094310 TTGGGAAGGGGGGAGGGGAGAGG + Intronic
1098056331 12:66509791-66509813 CTGTCACGGGGGCAGGGGAAGGG + Intronic
1098345715 12:69501216-69501238 CTTTTAAAGGGGGAGGGGGGAGG - Intronic
1098564389 12:71916160-71916182 GTCTGTATGGGGCAGGGGAGGGG - Intronic
1100436871 12:94579173-94579195 CAGTGAGAGGGGCAGGGCACAGG - Intronic
1100542054 12:95566961-95566983 CTGTGTGTGGGGCGGGGGAGAGG - Intergenic
1101316719 12:103635606-103635628 CTGTGCATGGGGCTGAGGAGAGG - Intronic
1101584439 12:106072685-106072707 ATGTGTATGGGGCAGGGGAGGGG - Intronic
1101613784 12:106316381-106316403 CTGAGATGGGGTCAGGGGAGTGG - Intronic
1101755815 12:107619944-107619966 CAGGGAAGGTGGCAGGGGAGGGG - Intronic
1101968379 12:109296039-109296061 CAGAGAAAGGGGAAGAGGAGAGG - Intronic
1101969699 12:109304528-109304550 CTGATGAAGGGGCAGGGGACTGG - Intronic
1101996401 12:109528302-109528324 CTGAGAAAGGGGGAGAGGAAGGG - Intronic
1103079355 12:118011083-118011105 CTGTAAAATGGGCAGGGGTAGGG - Intergenic
1103373853 12:120439881-120439903 CTGTGATGGGGGCGGGGGAGGGG - Intronic
1103459128 12:121089878-121089900 CTGTGACAGGAGCTGGGGACGGG - Intergenic
1103703123 12:122858273-122858295 ATGGGAAGGAGGCAGGGGAGCGG - Intronic
1103706838 12:122879481-122879503 CTGCGGGAGGGGCAGAGGAGAGG - Intronic
1103873254 12:124106462-124106484 GAGGGGAAGGGGCAGGGGAGAGG + Intronic
1103926379 12:124425726-124425748 TTGTGAATGGGGCCAGGGAGGGG - Intronic
1103987286 12:124776309-124776331 GTGTGAAAGGGGGAAGAGAGAGG - Intergenic
1104009603 12:124920574-124920596 GAGGGAAAGGGGAAGGGGAGGGG - Intergenic
1104435025 12:128748835-128748857 CTGTGAAGTGGGCAGGACAGTGG + Intergenic
1104496562 12:129246044-129246066 CTGTGAAGTGGGCCGGGGTGGGG - Intronic
1104763438 12:131311860-131311882 CTAAGAAACGGGGAGGGGAGGGG - Intergenic
1104770911 12:131363731-131363753 CTCTAAATGGGACAGGGGAGAGG - Intergenic
1104816061 12:131646212-131646234 CTAAGAAACGGGGAGGGGAGGGG + Intergenic
1105755501 13:23459943-23459965 CTGGGAATGGGGCGGGGGTGGGG - Intergenic
1106372844 13:29153418-29153440 CTGAGAAACAGGCAGAGGAGGGG - Intronic
1106742910 13:32665989-32666011 CTGGGAAAGGAACTGGGGAGGGG + Intronic
1106841070 13:33685504-33685526 TTGTGGAAGGGGCAGTGGTGGGG - Intergenic
1107556143 13:41518089-41518111 GTGTGTAGGGGGCAGGAGAGAGG + Intergenic
1108422663 13:50266659-50266681 GTGTCAACAGGGCAGGGGAGGGG - Intronic
1109475620 13:62876974-62876996 CTGTGAAAGCAGCCGGGAAGGGG - Intergenic
1109836395 13:67863028-67863050 CTCTGAAAGGGTAAGGAGAGTGG + Intergenic
1109837919 13:67883171-67883193 CTGGGAAGGGGGCAGAGGAAGGG - Intergenic
1110510873 13:76348577-76348599 CTGTCGTAGGGTCAGGGGAGGGG + Intergenic
1110597682 13:77337171-77337193 CTGTAAAAGAGGTAGGTGAGTGG + Intergenic
1110903787 13:80860230-80860252 CTGTGGGAGGAGCAGGTGAGAGG - Intergenic
1112205700 13:97321346-97321368 CTGTGGAAGAGGCACTGGAGTGG + Intronic
1112579838 13:100669203-100669225 CTGTGTGTGTGGCAGGGGAGAGG + Intronic
1112825003 13:103382086-103382108 CTGTGAAAGGAGCTGGGAGGGGG - Intergenic
1113458544 13:110465859-110465881 CTTTGAAATGGGCAGGGAACGGG - Intronic
1113541757 13:111115111-111115133 AAGGGAAAGGGGAAGGGGAGCGG - Intronic
1113767959 13:112892741-112892763 CTGTGCAGGGGACAGGAGAGGGG - Intergenic
1114201075 14:20520556-20520578 CTGGGAGTGGGGAAGGGGAGAGG - Intergenic
1114675343 14:24436522-24436544 CTGAGAGAGGGCCAGGGGTGGGG - Intronic
1115387361 14:32813392-32813414 CTGGGAAAGGGGTTGGGGGGGGG - Intronic
1116011132 14:39353711-39353733 CTGTTATAGGGTCAGGGGAGAGG - Intronic
1116131047 14:40855973-40855995 CTGTTATAGGGGCAGCTGAGAGG - Intergenic
1116785812 14:49287707-49287729 CTGTGGAAAGGGTAGGGGAGAGG - Intergenic
1116840943 14:49820628-49820650 CCGTGGAAGGGGGAGGAGAGAGG - Intronic
1117224967 14:53647226-53647248 CAGTCAAAGGGGCAGGGGCTTGG - Intergenic
1117478556 14:56119690-56119712 CAGTGAAAGGGGAGGGGGAAGGG + Intronic
1117875854 14:60249522-60249544 CTGGGGAAGGGGCGGAGGAGGGG - Intronic
1117890243 14:60413491-60413513 CTGTCATGGGGGCAGGGGAAGGG - Intronic
1117950057 14:61073858-61073880 CTGAGAAGAAGGCAGGGGAGGGG - Intronic
1117974188 14:61281286-61281308 CTGTGACGGAGGCAGAGGAGGGG - Exonic
1118241299 14:64061046-64061068 CTCTGAAAGAGGCATGGAAGAGG - Intronic
1118457428 14:65957732-65957754 CTGTGCAAGGGCTAGGGGATGGG - Exonic
1118785005 14:69038425-69038447 CTGGGAATAGGGCAGGGAAGAGG + Intergenic
1118809468 14:69262308-69262330 CTCTGGAAGGAGCAGGAGAGAGG - Intronic
1118822156 14:69352625-69352647 CTGGGAAGAGGGAAGGGGAGAGG + Intronic
1119322710 14:73741096-73741118 CAGTGGAAGGGGCAGGGGTCAGG - Intronic
1119438787 14:74614343-74614365 CTAGCAAAGGGACAGGGGAGAGG - Intergenic
1119622025 14:76138581-76138603 TTGGGGAGGGGGCAGGGGAGGGG - Intergenic
1119884871 14:78131728-78131750 CAGTGACAGTGGGAGGGGAGGGG + Intergenic
1120486659 14:85122551-85122573 CTGTGAAAGGAAGAGAGGAGAGG - Intergenic
1120736967 14:88064274-88064296 CTGAGAAATGGGGTGGGGAGAGG + Intergenic
1121505249 14:94472246-94472268 CTGAGCAAGGGGTAGGTGAGTGG - Intronic
1121650533 14:95554710-95554732 CTTTGAAAGGGGCAGGGTTTTGG - Intergenic
1121729720 14:96178062-96178084 CAGAGAAACAGGCAGGGGAGGGG + Intergenic
1121791236 14:96701333-96701355 AGGTGGGAGGGGCAGGGGAGGGG - Intergenic
1122211836 14:100178559-100178581 CTGTGGCTGGGGAAGGGGAGTGG + Intergenic
1122298278 14:100717660-100717682 CTGTCAAGGGGGGAGAGGAGAGG + Intergenic
1122414527 14:101542631-101542653 CACTGCAAGGGGGAGGGGAGGGG - Intergenic
1122774095 14:104109649-104109671 GTGTGAGAGGGGCTGGGGTGTGG + Intronic
1122820552 14:104342746-104342768 TCGTCAAAGGGGCAGGTGAGGGG - Intergenic
1122830757 14:104394504-104394526 CAGGGAAAGGGGCTGGGGACGGG - Intergenic
1122901868 14:104785331-104785353 CTGGGGTGGGGGCAGGGGAGGGG + Intronic
1123785117 15:23663661-23663683 TGGTGAAAGGTGAAGGGGAGTGG + Intergenic
1124899075 15:33805901-33805923 GGGTGAAAGGGGAGGGGGAGAGG - Intronic
1125375090 15:39020240-39020262 GTGTGAAGGGGGCAGGAAAGGGG + Intergenic
1125507542 15:40275734-40275756 CTGTGGAAGGGGCAGAGGATTGG - Intronic
1125534257 15:40434378-40434400 CTGTGAAAGGGGAGAGGTAGAGG + Intronic
1125953948 15:43776683-43776705 CTGGAGAAGGTGCAGGGGAGAGG - Intronic
1126782171 15:52148316-52148338 GTATGAATGGGTCAGGGGAGGGG + Intronic
1126923052 15:53549149-53549171 CTGTCCAAGGTGCTGGGGAGAGG + Intronic
1127155254 15:56117622-56117644 CTGGGAAAGGGGATGGGGATAGG - Intronic
1127214802 15:56813020-56813042 CTCTGAAAAGGACAGTGGAGAGG - Intronic
1127375624 15:58382029-58382051 CTGGGAAGGAGGGAGGGGAGAGG + Intronic
1128233324 15:66050488-66050510 ATGTGCAAGGGGCAGGAGGGAGG + Intronic
1128257090 15:66204895-66204917 CTGTGAAAGGTAGAGGGAAGAGG + Intronic
1128557366 15:68641044-68641066 CTTTGAAAGGGCCAGGGGAAGGG - Intronic
1128618321 15:69127829-69127851 CAGTGCAGGGGGCAGGGGAGGGG - Intergenic
1128746699 15:70119928-70119950 CTGAGCTGGGGGCAGGGGAGTGG - Intergenic
1128758563 15:70199253-70199275 CTGGGAATGGGGCAGAGGAGAGG + Intergenic
1128802913 15:70508364-70508386 CTCTGGAAGGGGCAGGGGAGGGG + Intergenic
1129245277 15:74275411-74275433 ATGTGAAAAGGGCAGTGGTGAGG - Intronic
1129252389 15:74316092-74316114 GTGGGCAAGGGGCAGGGGTGGGG + Intronic
1129394230 15:75235544-75235566 CTGTGTCAGAGGCTGGGGAGGGG - Intergenic
1130033359 15:80335468-80335490 AAGGGAAAGAGGCAGGGGAGGGG + Intergenic
1130112495 15:80977262-80977284 GTATGAAAGGGGCAGGGTAGGGG - Exonic
1130232904 15:82110062-82110084 CAGTGAAGGGGGAACGGGAGTGG - Intergenic
1130441096 15:83955247-83955269 CTGTGGAAAGGGGAGGGAAGAGG - Intronic
1130531451 15:84749807-84749829 CAGTGAAAGGGGCAGAAGTGTGG + Intronic
1130612838 15:85377379-85377401 CTATTAGAGGGGCAGGAGAGAGG + Intergenic
1130843995 15:87727032-87727054 GTGGAAAAGGGGCATGGGAGGGG + Intergenic
1131112775 15:89776050-89776072 CAGTGGACGGGGCAGGGGCGTGG + Intronic
1131229212 15:90647605-90647627 GTGTGAAGGGGGAGGGGGAGGGG - Intergenic
1131967764 15:97862633-97862655 TTGTGAAGGGGGCAGGTAAGAGG - Intergenic
1132057364 15:98662445-98662467 CTGTGGAAGGGGAGTGGGAGTGG + Intronic
1132150807 15:99456975-99456997 GAGTGAATGGGACAGGGGAGAGG + Intergenic
1132152783 15:99474394-99474416 AAGTGAAAGGGGAAGGGAAGGGG + Intergenic
1132692402 16:1187469-1187491 CTGAGCCAGGGGCAGGGGTGTGG - Intronic
1132748516 16:1446845-1446867 CTGAGCACGGGGCTGGGGAGGGG + Intronic
1132967970 16:2670101-2670123 CCGGGAAAGGGGCGGGGGGGGGG - Intergenic
1132995697 16:2821308-2821330 GAGTGAGTGGGGCAGGGGAGGGG - Intronic
1133388193 16:5387642-5387664 CTCTGAGAGAGGGAGGGGAGTGG + Intergenic
1133723435 16:8516177-8516199 CTTTGGTAGGGGCAGGGGATAGG + Intergenic
1133813201 16:9177267-9177289 ATGGGAAAGGGGAAGGGGAGAGG - Intergenic
1134048893 16:11123195-11123217 CTGAGAAAGGGACAGGGGCTGGG - Intronic
1134057900 16:11181692-11181714 CTGGGACAGCGGCAGAGGAGGGG - Exonic
1134061722 16:11203195-11203217 CCGTGGAAGGGGCCAGGGAGGGG + Intergenic
1134133970 16:11668063-11668085 CCGGGGCAGGGGCAGGGGAGAGG - Intergenic
1134203253 16:12216319-12216341 CAAGGAAAGGGTCAGGGGAGGGG - Intronic
1134509002 16:14831345-14831367 AGCTGAAGGGGGCAGGGGAGGGG - Intronic
1134696703 16:16230179-16230201 AGCTGAAGGGGGCAGGGGAGGGG - Intergenic
1134892547 16:17853864-17853886 CTGTGCAAGGAGCTGGGAAGTGG - Intergenic
1134975130 16:18564526-18564548 AGCTGAAGGGGGCAGGGGAGGGG + Intergenic
1135114290 16:19712332-19712354 CGGTTAGAGGGGGAGGGGAGTGG - Intronic
1135131934 16:19860284-19860306 CTGTGTGTGTGGCAGGGGAGGGG + Exonic
1135821715 16:25691874-25691896 CTGCGAAGGGGGCGGGGGAGCGG - Intergenic
1135965014 16:27028400-27028422 CTTAGAAAGGAGCTGGGGAGAGG - Intergenic
1136025473 16:27465585-27465607 CTGTGCATTGGTCAGGGGAGGGG - Intronic
1136478663 16:30527734-30527756 CTGGGGAAGGTGGAGGGGAGAGG - Intronic
1137056796 16:35749923-35749945 CGGTGAAAGCGGAAAGGGAGCGG - Intergenic
1137306719 16:47207782-47207804 CTGTGGAAGGGGCGGGAGGGTGG - Intronic
1137507545 16:49067459-49067481 CTGGGGATGGGGCAGGAGAGTGG + Intergenic
1137725885 16:50656319-50656341 CAGTGGAAGGTGAAGGGGAGCGG - Intergenic
1138161769 16:54761197-54761219 CCGTTCAAGGGGCAGGGGTGGGG + Intergenic
1138212238 16:55173305-55173327 CTGTGAAGGGGGAAGGAGTGGGG + Intergenic
1138532777 16:57643803-57643825 GTGGGAATGGGGGAGGGGAGTGG + Intronic
1138914405 16:61445763-61445785 TTGTGAATGCGGGAGGGGAGTGG - Intergenic
1139365469 16:66429707-66429729 GGGTGAATGGGGAAGGGGAGGGG - Intronic
1139381985 16:66538354-66538376 GTTTGAGAGGGGCAGGGGAAGGG - Intronic
1139513301 16:67439435-67439457 CCTTGAAAGGGGCTAGGGAGGGG - Intronic
1141181079 16:81753853-81753875 CTGGGAGAGGGCCTGGGGAGTGG + Intronic
1141506320 16:84480805-84480827 CTGAGACAGGGGCGGGTGAGTGG + Intronic
1141594046 16:85086737-85086759 GTGGGAAAGCGGGAGGGGAGAGG + Intronic
1141657207 16:85422611-85422633 GAGAGAAAGGGGCAGGAGAGAGG + Intergenic
1141671955 16:85496806-85496828 CAGTGACAGGAGCAGGTGAGGGG - Intergenic
1141752482 16:85968072-85968094 CTGGGAACGGGGCATGGGGGTGG + Intergenic
1141802876 16:86323089-86323111 CTGGGGAGTGGGCAGGGGAGAGG - Intergenic
1141928006 16:87181905-87181927 CTGTGAAGGGGGCCGGGGCCGGG + Intronic
1141942493 16:87286904-87286926 AGGAGGAAGGGGCAGGGGAGGGG + Intronic
1142287571 16:89177632-89177654 CTGGGGGAGAGGCAGGGGAGAGG - Intronic
1142483500 17:232580-232602 CTGAGACAGGGCGAGGGGAGGGG - Intronic
1142512969 17:409488-409510 CTGGGTAAGGGACAAGGGAGAGG + Intergenic
1142696961 17:1639108-1639130 CCGTGAAATGGGCAGCGGGGTGG - Intronic
1142990869 17:3730037-3730059 CTGTGGGAGGGGCAGGGTTGGGG - Intronic
1143101962 17:4509463-4509485 CTGTGAAAGGAGGAGAGGAAAGG + Intronic
1143128161 17:4657721-4657743 GTGTGAAAGGTGCAGTGGAAAGG + Intergenic
1143485599 17:7251995-7252017 GTGTCAAAGGGGAAGAGGAGGGG - Exonic
1143610902 17:8016788-8016810 ATGAGATAGGGCCAGGGGAGGGG - Intronic
1143761120 17:9104973-9104995 CTCTGAGTGGGGCAGGGGTGGGG + Intronic
1143898754 17:10157219-10157241 CTAGGAAAGGGGCTGGGGACAGG + Intronic
1144043747 17:11436170-11436192 CTTTGAAAGTGCAAGGGGAGAGG - Intronic
1144209731 17:13003918-13003940 CTGTGAGAGAGGAAGGAGAGAGG - Intronic
1144331596 17:14229110-14229132 CTGTGAGAGAGTCAGAGGAGAGG - Intergenic
1144343796 17:14332469-14332491 CTGCGAATGGGGGAGGGTAGAGG - Intronic
1144454418 17:15407255-15407277 CAGTGAATGGAGCAGGGGATGGG - Intergenic
1144758370 17:17693772-17693794 CTGTGGTAGGGGGAAGGGAGAGG + Intronic
1144847818 17:18229203-18229225 CTGTGAAAGGGGCAGGGGAGCGG + Intronic
1145221199 17:21090579-21090601 TTCTGAAAAGGGCAGGAGAGAGG - Intergenic
1146434780 17:32834362-32834384 CTGGTTATGGGGCAGGGGAGTGG - Intronic
1146624342 17:34424439-34424461 CTGTTATGGGGGCAGGGCAGGGG - Intergenic
1146944376 17:36863954-36863976 GGGGGAGAGGGGCAGGGGAGGGG - Intergenic
1146955065 17:36932663-36932685 CTGGGCATGGGGCAGGGGCGTGG - Intergenic
1147168471 17:38605339-38605361 GTGTGGAAGGGGGAGGGGTGAGG - Intronic
1147184759 17:38707052-38707074 GTGTGGGAGGGGCAGGGGAGTGG - Intronic
1147250343 17:39149460-39149482 CTGTGAAAAGGGCACCGGACTGG + Intronic
1147646714 17:42038544-42038566 CTGAGGCAAGGGCAGGGGAGGGG + Intronic
1147650509 17:42059191-42059213 GTGGGAGTGGGGCAGGGGAGGGG - Intronic
1147728128 17:42579547-42579569 CTGTGAACTGAGGAGGGGAGGGG - Exonic
1147932927 17:43994377-43994399 CTGTGAGTGGGGCAGGGGAAGGG - Intronic
1148186840 17:45650543-45650565 CTGTGCCAGGCGCTGGGGAGGGG + Intergenic
1148617881 17:49014034-49014056 AGGTGAGAGGGGCTGGGGAGGGG + Intronic
1148742838 17:49902396-49902418 CAGAGAAAGGGGGAGGGCAGGGG - Intergenic
1148846388 17:50532513-50532535 CTGTTGAAGAGGCAGGGGAAGGG + Intergenic
1149293791 17:55242204-55242226 ATATGAATGGGGCAGGGGAGGGG + Intergenic
1149309534 17:55380616-55380638 CTTTGCAAGAGGCAAGGGAGCGG + Intergenic
1149387848 17:56159642-56159664 CTTGGAAAGGGGGAGGGTAGAGG - Intronic
1149551631 17:57544821-57544843 CTTTGAAAGGGGGAGGGTAGAGG - Intronic
1149858239 17:60104002-60104024 CTTTGAGAAGGGCAGAGGAGGGG + Intergenic
1150129964 17:62663765-62663787 CAGTGCAAGGGGCAGGGGGAAGG + Intronic
1150551038 17:66210427-66210449 CTGAGAAAGAGGCATGGGTGGGG + Intergenic
1150842153 17:68618772-68618794 CTCTGAAAGTGGCAATGGAGGGG - Intergenic
1151351580 17:73535051-73535073 CTATGAGATGGGCAGGGAAGAGG - Intronic
1151508064 17:74542285-74542307 CTGCGAGAGAGGCAGGGGAGAGG + Intronic
1151564716 17:74891620-74891642 TGGTGAGAGGGGCAGGGGAGGGG + Intronic
1151606762 17:75142553-75142575 CCGTCAAGGGGGGAGGGGAGGGG + Intronic
1151717027 17:75836169-75836191 CTGGGCAAGGGGGAGGGCAGGGG - Intronic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1152031840 17:77847576-77847598 CTGTGGCAGGAACAGGGGAGTGG - Intergenic
1152134802 17:78497574-78497596 CTGTGCTGGGGGCAAGGGAGAGG + Intronic
1152228470 17:79103337-79103359 GTGGGAGGGGGGCAGGGGAGTGG + Intronic
1152659282 17:81534992-81535014 CTGGGTAGGGAGCAGGGGAGGGG - Intronic
1152806211 17:82357555-82357577 CTGGGATAGGGGCAGGTGTGGGG - Intergenic
1152830930 17:82496725-82496747 CTGTGGAAGGCGCAGGGGCCAGG + Intergenic
1152929885 17:83104106-83104128 CTGGGAATGGGGCCAGGGAGTGG - Intergenic
1152933063 17:83120101-83120123 CGTTGGAAGGGGCTGGGGAGGGG + Intergenic
1153035762 18:760793-760815 CATTGAGAGGGGCAGGGGTGGGG + Intronic
1153666314 18:7370198-7370220 CTGTGACAGGGGAAGAGGAGAGG - Intergenic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1153991140 18:10401747-10401769 AGGAGAAAGGGGAAGGGGAGGGG + Intergenic
1154012042 18:10582560-10582582 CTGTGCATGGGGCCTGGGAGAGG + Intergenic
1154072819 18:11168699-11168721 CTGGGAAGGGGAAAGGGGAGAGG - Intergenic
1154193270 18:12247656-12247678 CTGAGGACGGGGCAGGAGAGGGG + Intergenic
1154197732 18:12278824-12278846 CCGGGAAGGGGGTAGGGGAGGGG - Intergenic
1154272772 18:12934114-12934136 CTGTGGCAGGGGGAGAGGAGAGG - Intergenic
1154506532 18:15045861-15045883 CTGTGATAGAGACAGGGAAGGGG - Intergenic
1155389020 18:25313439-25313461 ATATGAAAGGGAAAGGGGAGGGG + Intronic
1155440007 18:25852198-25852220 CTGAGAAGGGGGCAGTGGTGAGG + Intergenic
1155640431 18:28007216-28007238 CTGAGAACTGGGCTGGGGAGAGG - Intronic
1157194087 18:45606237-45606259 ATGAGATTGGGGCAGGGGAGAGG - Intronic
1157294305 18:46431520-46431542 CTGTGGAGGGTGCAGGGGAGGGG + Intronic
1157312166 18:46560546-46560568 CTGTTCAAAGGGCAGGGCAGCGG + Intronic
1157483884 18:48073509-48073531 CTGGGACAGGCGCAGGGGTGCGG + Intronic
1157698430 18:49743745-49743767 CTGTGAAAGGGGTCAGGGTGGGG + Intergenic
1157722295 18:49934571-49934593 CTGTGCAGGGCCCAGGGGAGAGG - Intronic
1158258957 18:55587621-55587643 CTTTGAAAAGCGGAGGGGAGTGG - Intronic
1158892699 18:61887874-61887896 ATGCGATAGTGGCAGGGGAGAGG + Intronic
1160270553 18:77379666-77379688 CTTTAAAAGGAGCAGGGCAGAGG - Intergenic
1160286539 18:77548520-77548542 CTGTGAAAGTGGCACAGAAGAGG - Intergenic
1160488899 18:79320316-79320338 CTCTGCCAGGGGAAGGGGAGGGG + Intronic
1160674637 19:383346-383368 CTGAGAGAGGGACAGGGGAGGGG - Intergenic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1161135697 19:2618279-2618301 CTTTGCAAGGGGCATGGGTGAGG - Intronic
1161327853 19:3672036-3672058 CTGTGATGGGGCCAGGAGAGAGG - Intronic
1161437164 19:4270529-4270551 CTGAAAAAGGGGGAGGGGGGTGG + Intergenic
1161746235 19:6061806-6061828 CTGAGAAAGGGGCTGGGAGGGGG + Intronic
1161821600 19:6533698-6533720 CTCTGGAGGGGGCAGGGAAGGGG - Intronic
1161993652 19:7699258-7699280 CTGGGAAAGTGGCTGGGGAGTGG - Intronic
1162068257 19:8138454-8138476 CTGTGACAGGGGCAGGTGCTGGG - Exonic
1162070165 19:8148392-8148414 CTGTGAAATGGGCACAGAAGCGG - Intronic
1162142735 19:8594554-8594576 TTTACAAAGGGGCAGGGGAGGGG - Intronic
1162150370 19:8640806-8640828 CCTTGCAAGGGGCAGGGGTGAGG + Intergenic
1163018718 19:14471786-14471808 CAGGGGCAGGGGCAGGGGAGGGG - Exonic
1163102924 19:15108506-15108528 GGGTAAAAGGGGCAGGGGACTGG + Intronic
1163147169 19:15387957-15387979 CTGGGAGAGGGGGCGGGGAGGGG + Intronic
1163282991 19:16328404-16328426 CTGAGAATGGGGAAGGTGAGGGG - Intergenic
1163720541 19:18896281-18896303 CTGGGAAACGGGCAGGGGCGCGG - Intronic
1163790045 19:19301301-19301323 CAGTGAATGGGGACGGGGAGAGG - Intronic
1164594799 19:29525972-29525994 CGGGGAGAGGGGGAGGGGAGGGG - Intergenic
1164601553 19:29566591-29566613 CTGTGATAGGCACAGGGGAATGG + Intergenic
1164601714 19:29567196-29567218 GTGTGATAGGTACAGGGGAGGGG + Intergenic
1164601726 19:29567248-29567270 CTGTGATAGGCACAGGGGAGTGG + Intergenic
1164706752 19:30325538-30325560 CTGTGAAAGGCTGAGGGCAGCGG + Intronic
1164872065 19:31654369-31654391 CTGTGGTGGGGTCAGGGGAGGGG + Intergenic
1165063549 19:33216470-33216492 GTGGGAAAGTGGCAGGAGAGTGG - Intronic
1165331438 19:35142967-35142989 CTGGGGAAGGGGCGGCGGAGGGG - Exonic
1165364753 19:35358701-35358723 CTGGGGAAGGGACAGGGGACAGG + Intronic
1165366571 19:35371170-35371192 CTGGGGAAGGGACAGGGGACAGG + Intronic
1165384419 19:35502026-35502048 CTGGGAAAGTGGGAAGGGAGGGG + Intronic
1165393295 19:35550429-35550451 TTGGGAATGGGGGAGGGGAGTGG + Exonic
1165737243 19:38184476-38184498 CTGTAAAAGGGGGAGGACAGGGG - Intronic
1165985366 19:39764056-39764078 CTGTCAGGGGGGCAGGGGAAGGG + Intergenic
1166294478 19:41882418-41882440 CTGAGAAAGGGAGAGGAGAGAGG + Intergenic
1166342942 19:42149777-42149799 TGGTGTGAGGGGCAGGGGAGAGG - Intronic
1166619630 19:44284531-44284553 CTGTTAAAGGGTCCTGGGAGAGG - Intronic
1167097149 19:47380578-47380600 CAGTGACAGGGGCAGAAGAGGGG + Intronic
1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG + Intronic
1167353893 19:48992061-48992083 CTGGGATAGGGTCATGGGAGAGG - Intronic
1168271750 19:55253810-55253832 CTGCGAATGGAGCAGGAGAGTGG + Intronic
1168316914 19:55488544-55488566 GGGTGAAAGGGGAAGGAGAGCGG - Intronic
1168373526 19:55856388-55856410 CACTGGAAGGGGAAGGGGAGTGG - Intronic
1168650025 19:58086854-58086876 CTGCGGAAGGGGATGGGGAGTGG + Intronic
925041964 2:739513-739535 CTGTGCAGGAGGCAGGGGAATGG + Intergenic
925585649 2:5461494-5461516 CTGCGAGAGGTGCAGAGGAGGGG + Intergenic
925641104 2:5986597-5986619 CTGTGAAGAGGACAGGGGACAGG - Intergenic
925659973 2:6191748-6191770 CTGTGAGTGGGGCATGGGAAGGG + Intergenic
925989866 2:9246010-9246032 CTGTGAAAAGGACAGGAGGGTGG + Intronic
926210417 2:10865217-10865239 ATGTGGAAGGGGCCGGGGTGGGG + Intergenic
926704401 2:15826542-15826564 CTGGGAAAAGGGGAGGGGTGTGG - Intergenic
927144919 2:20157272-20157294 CTTTGAAAGGAGCAGGAGGGAGG + Intergenic
927681980 2:25145808-25145830 CTGTGCATGTGTCAGGGGAGGGG - Intronic
927765043 2:25799032-25799054 CTGTGCATGTGGCGGGGGAGGGG + Intronic
927852183 2:26506400-26506422 GTGGGGAAGGGGCAGGGGAGAGG - Intronic
928106974 2:28476796-28476818 ATGAGAAAGGAGGAGGGGAGAGG + Intronic
928179010 2:29054513-29054535 CTTTTAAAGGGGCGGGGGGGGGG + Exonic
928243414 2:29606197-29606219 CTGTGAGGGAGACAGGGGAGGGG - Intronic
929233331 2:39581912-39581934 CTGAGAAAGGAAGAGGGGAGAGG - Intergenic
929411767 2:41704783-41704805 GGGTGAAAGTGGGAGGGGAGAGG + Intergenic
929487041 2:42363943-42363965 CTGTGAAAGCGCCTGGGGAATGG + Intronic
929598643 2:43191517-43191539 CTGTGGAAGGGGCAGTGCACAGG - Intergenic
929667118 2:43841698-43841720 CTGGGTAAGAGGAAGGGGAGAGG - Intronic
929906105 2:46048110-46048132 CTATGGAAGGGGCAGGGGGTGGG - Intronic
929931509 2:46259737-46259759 CTGGGCAGGGTGCAGGGGAGAGG + Intergenic
930025204 2:47025377-47025399 CTCCAAAAGGGTCAGGGGAGCGG - Intronic
930027862 2:47040332-47040354 CTGGGAAAGGGGAAGGAGCGTGG - Intronic
930288525 2:49465351-49465373 GAGGGAAAGGGGAAGGGGAGAGG - Intergenic
930288545 2:49465408-49465430 GAGGGAAAGGGGAAGGGGAGAGG - Intergenic
931068651 2:58618817-58618839 GTGTGTGGGGGGCAGGGGAGAGG + Intergenic
931705466 2:64943054-64943076 CTGTGCAAGGCTCAGGGGATAGG - Intergenic
931952599 2:67381997-67382019 CTGAAGAAGGGGAAGGGGAGGGG + Intergenic
932124926 2:69136232-69136254 CTGTGAATGGGGGTGGGCAGTGG - Intronic
932143287 2:69297907-69297929 CTGTGCAAGGGGATTGGGAGAGG + Intergenic
932344679 2:70987951-70987973 ATGGGAAGGGGGCAGGGGTGAGG - Exonic
932392747 2:71411622-71411644 CTGTGGTGGGGTCAGGGGAGGGG - Intronic
932400158 2:71474930-71474952 CTGTGATAGGGGAGGGGAAGTGG + Intronic
932574726 2:72956328-72956350 CTGAGGAAGGGGCTGGGCAGTGG - Intronic
932723410 2:74157133-74157155 CTGTGATCTGGGAAGGGGAGAGG - Intronic
932823860 2:74922983-74923005 TTGTGATGGTGGCAGGGGAGAGG - Intergenic
932848296 2:75157128-75157150 CTGTGGTAGTGGCAGGGCAGGGG + Intronic
932864349 2:75325727-75325749 CTGGGGAAGGGCCAGGGCAGTGG - Intergenic
933419972 2:82032237-82032259 CTGGGAAAGATACAGGGGAGAGG + Intergenic
933465699 2:82648162-82648184 CTGTCAGAGGGGGTGGGGAGAGG + Intergenic
933993935 2:87654122-87654144 GGGTGAGAGGGGCAGGGAAGGGG - Intergenic
934525502 2:95049330-95049352 CTGAGGAAGGGTCAAGGGAGAGG - Intronic
934539032 2:95159513-95159535 CTCTGTAAGGGGCCGGGGCGCGG + Exonic
935064834 2:99638510-99638532 CTGGCTAAGGAGCAGGGGAGGGG + Intronic
935156407 2:100487350-100487372 CTGTGCAATGGGCTGGGGTGTGG - Intergenic
935503820 2:103873872-103873894 CTTTGACAAGGGCAGGAGAGCGG + Intergenic
936299930 2:111296792-111296814 GGGTGAGAGGGGCAGGGAAGGGG + Intergenic
936377668 2:111955962-111955984 CTGTCATAGGGTGAGGGGAGGGG + Intronic
936618081 2:114068623-114068645 GAGAGAAAGGGACAGGGGAGAGG + Intergenic
936834683 2:116694305-116694327 CTATGAAAGGGGAAGGGATGAGG + Intergenic
937330125 2:121021397-121021419 AAGTGGAAGGGGCAGGGCAGAGG + Intergenic
937342309 2:121099057-121099079 CTGGGAGAGGGGCTGGGGACAGG + Intergenic
937353523 2:121184079-121184101 CTGGGATGGGGGCAGGGGTGAGG - Intergenic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
937705682 2:124918181-124918203 CTGAGAAAAGGGAAGGAGAGGGG - Intergenic
938044619 2:128106791-128106813 CTTTGGAAGGGGCAGGTGGGTGG - Intronic
938548599 2:132359003-132359025 CTGTTATGGGGTCAGGGGAGGGG - Intergenic
938579894 2:132636339-132636361 CTGTGACTGAGGCAGAGGAGTGG - Intronic
939015018 2:136892508-136892530 CTGAAAAAAGGGCAAGGGAGTGG + Intronic
939594837 2:144110385-144110407 CTGTCATAGGGTGAGGGGAGGGG + Intronic
939666835 2:144963258-144963280 CTCTCAAAGGGGCTGGGGTGGGG - Intergenic
940004385 2:148997985-148998007 CTGTGCAGTGGGCAGGGCAGGGG + Intronic
940346767 2:152636813-152636835 AAGTGAAAGGGGAGGGGGAGGGG - Intronic
940985699 2:160049953-160049975 CTGTGGCAGGGGCAGGGGAAGGG + Intronic
941268603 2:163396422-163396444 CTGTGAAACTGGTAGTGGAGTGG - Intergenic
941645496 2:168036034-168036056 CTGTCAAAGATGGAGGGGAGAGG + Intronic
942042150 2:172078016-172078038 ATGTGCAGGGGGCAGGGGAGGGG + Intronic
942448214 2:176092499-176092521 CCCTGCAAGGGGCAGGAGAGGGG + Intergenic
942531758 2:176917617-176917639 GTGAGCAAGGGGCAGGGGACTGG + Intergenic
942579413 2:177401421-177401443 CTGTGAAATGGGCAGTTGTGAGG - Intronic
943670444 2:190654501-190654523 CTGGCACAGGGGCAGGGAAGTGG + Intronic
943688669 2:190846024-190846046 TTTTTAAAAGGGCAGGGGAGCGG + Intergenic
944509597 2:200451618-200451640 ATGTGAAAAGGGGAGGGGAGGGG - Intronic
945984671 2:216344005-216344027 CAGAGGATGGGGCAGGGGAGAGG + Intronic
946192738 2:218016047-218016069 CAGGGAAAGGGGGAGGGCAGGGG + Intergenic
946249794 2:218405240-218405262 CCAGGAAAGGGGCAAGGGAGGGG - Exonic
946252933 2:218424352-218424374 GTGAGTCAGGGGCAGGGGAGGGG + Intronic
946299228 2:218812431-218812453 CTGGGAGAGGGGCTGGGGAAGGG + Intronic
946861125 2:224001264-224001286 CTGTGAGAGGAGCTGGGAAGGGG - Intronic
947221460 2:227796824-227796846 TTGTGAAAGGTGCAGGGAAATGG + Intergenic
947403969 2:229755552-229755574 CTGTGGGAGGGCGAGGGGAGTGG + Intergenic
947737836 2:232466344-232466366 AGGTGAACGGGGAAGGGGAGAGG - Intergenic
947935017 2:233997354-233997376 CTGGGAATGGGGCAGGGAGGAGG - Intronic
948171702 2:235908787-235908809 CTGTGAAAGTCCCAGGGAAGAGG + Exonic
948575536 2:238947185-238947207 CTGTGCCTGGGGCAGGGGCGGGG + Intergenic
948934158 2:241151342-241151364 ATGTGAAAGGGGTAGGGAAGAGG + Intronic
1168847540 20:955677-955699 CTGTGAAGGTGGCAGGAGATAGG + Intergenic
1168951247 20:1803509-1803531 CTGGGAAAGGGGCGGAGAAGGGG + Intergenic
1168999276 20:2155373-2155395 CTGTGGATGGGGCCTGGGAGAGG + Intronic
1169143023 20:3236758-3236780 CTGTGTGAAGGGCAGTGGAGGGG - Intronic
1169160526 20:3373805-3373827 CTGAGAATGGGGTAAGGGAGAGG + Intronic
1169286940 20:4316862-4316884 GTGTGAAAGAGGGAGGGGAAAGG + Intergenic
1169360824 20:4947277-4947299 ACGTGAAAGGGGAAAGGGAGGGG + Intronic
1169565411 20:6848393-6848415 GTGGGAAAGGGGCAGTGAAGAGG + Intergenic
1169858917 20:10131882-10131904 GAGTAAAAGGGGCAGGGTAGAGG + Intergenic
1170576742 20:17668805-17668827 CTGGGACAGGGGTAGGGGTGCGG - Intronic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1171370122 20:24656999-24657021 CTGTGACAGGGCCAGAGCAGGGG - Intronic
1172049843 20:32109162-32109184 CTGTGAAATGGGAAGGGGGTTGG - Intergenic
1172054466 20:32144535-32144557 CTGTGCATGGGGGAAGGGAGGGG - Intronic
1172178692 20:32987618-32987640 ATGGGACAGCGGCAGGGGAGTGG - Intronic
1172502053 20:35434448-35434470 CTGGGAACGGGGCAGGGCCGTGG - Exonic
1172625256 20:36343008-36343030 CTGAGTGAGGGGGAGGGGAGAGG + Intronic
1172638211 20:36424160-36424182 CTGTGACAGGTGAAGGGGACAGG + Intronic
1172650098 20:36496672-36496694 ATGAGAGAAGGGCAGGGGAGAGG - Intronic
1172670234 20:36630071-36630093 CAGAGAATGGGCCAGGGGAGGGG + Intronic
1172692927 20:36803072-36803094 CAGGGAAGGGGGCCGGGGAGCGG - Exonic
1172816380 20:37690420-37690442 GTGGGATAGGGGCAAGGGAGAGG - Intergenic
1172840868 20:37902213-37902235 GTGTGAGTGTGGCAGGGGAGGGG - Intergenic
1173155610 20:40606024-40606046 ATGTGGAGGGGCCAGGGGAGAGG + Intergenic
1173179848 20:40797746-40797768 GTGTCAAAGGGCCAGGGGTGAGG + Intergenic
1173192520 20:40887261-40887283 GTGTGAAAGGGGCTGGGGCCTGG - Intergenic
1173313076 20:41917684-41917706 GTGGGGAAGGGGGAGGGGAGGGG + Intergenic
1173564964 20:44032076-44032098 CGGTGTGAGGGGCAGGGGAGCGG + Intronic
1173731676 20:45333245-45333267 CTGTGAAAGAGCCAGGGGGTGGG - Intronic
1173821962 20:46025480-46025502 TTGAGAAAAGGGGAGGGGAGAGG - Intronic
1173823403 20:46032321-46032343 GTGTGAAAGGCAGAGGGGAGGGG + Intronic
1173842326 20:46166030-46166052 CTGGGAGAGGGACAGGGGTGGGG - Intergenic
1173851640 20:46222327-46222349 CTGTGAGAGGGGCAGTGGAGGGG - Intronic
1174038398 20:47682433-47682455 CTGCGTCTGGGGCAGGGGAGCGG - Intronic
1174180629 20:48672188-48672210 CTATGAAAGAGGCAGGTGTGCGG - Intronic
1174407199 20:50310171-50310193 CTGAGCAAAGGGCAGGGGCGGGG - Intergenic
1175170129 20:57074439-57074461 CTGGGAACGGGGCAGGGGTCAGG + Intergenic
1175376044 20:58524713-58524735 ATGTAAAAGGGGCAGGGGACGGG + Intergenic
1175899607 20:62354839-62354861 GTTTGAGAGGGGCTGGGGAGGGG - Intronic
1175941964 20:62541520-62541542 CTGGGAGAGGGGCAGGGAATAGG + Intergenic
1176018569 20:62951412-62951434 TAGTGAAAGGGGTAGGGAAGGGG - Intergenic
1176246710 20:64100910-64100932 CTTTCCAGGGGGCAGGGGAGAGG - Intergenic
1176428984 21:6564693-6564715 ATGGGAAAGGGACTGGGGAGCGG + Intergenic
1176791332 21:13323246-13323268 CTGTGATAGAGACAGGGAAGGGG + Intergenic
1177249383 21:18572288-18572310 TGGTGGAAGGGGAAGGGGAGGGG + Intergenic
1177990463 21:28030126-28030148 CTGTGATAGAGACAGGGAAGGGG - Intergenic
1177999967 21:28150050-28150072 CTGAGAAAGAAGCAAGGGAGAGG + Intergenic
1178282918 21:31299262-31299284 CTGCGAAAGGCATAGGGGAGGGG - Intronic
1178826046 21:36017810-36017832 CTCTGAAAGGGGAAGAAGAGAGG - Intergenic
1179136415 21:38683854-38683876 TTGTGTAAGGGGCAGAAGAGAGG - Intergenic
1179572328 21:42285008-42285030 CAGCGAAGGGGGCTGGGGAGTGG + Intronic
1179916177 21:44479678-44479700 CCGGGAAAGCGGCAGGGGGGCGG - Intergenic
1180002595 21:45002065-45002087 CTGAGAAGGGAGCTGGGGAGGGG + Intergenic
1180071437 21:45438596-45438618 AAGGGAAAGGGGCAGTGGAGAGG + Intronic
1180110090 21:45643485-45643507 CAGTCAAAGGGGCGGGGGTGGGG - Intergenic
1180175478 21:46085114-46085136 CTGTCACAGGGGCAGGGTCGGGG - Intergenic
1180175533 21:46085370-46085392 CTGTCACAGGGGCAGGGTCGGGG - Intergenic
1180685633 22:17664416-17664438 CTGTGAAAGGAGCCGGGGGGGGG - Intronic
1180742125 22:18061123-18061145 CTGGAAAAGGGGCAGGGGCACGG + Intergenic
1180844707 22:18974799-18974821 GTGTGAAAGAGGGAGAGGAGAGG - Intergenic
1180979030 22:19870070-19870092 CTCTCACAGGGGCAGGGCAGAGG - Intergenic
1181056764 22:20263913-20263935 GTATGAAAGAGGCAGGGGAGAGG + Intronic
1181097753 22:20517534-20517556 CTGTGAAAAGAGCAGCGGGGTGG - Intronic
1181108184 22:20586873-20586895 CTGGGATAGGCGCAGTGGAGCGG + Exonic
1181136881 22:20773621-20773643 CAGTGAAAGGTGGAGGAGAGAGG - Intronic
1181802774 22:25358255-25358277 CTGTGAAAGAGGAAGGGACGGGG - Intronic
1181919073 22:26305837-26305859 CTGGGCAAGGGGCAGGGGTGGGG + Intronic
1182286916 22:29254155-29254177 CCGTGAAGGGGGCAGGGGAGGGG - Intronic
1182300836 22:29335976-29335998 CTGAGAGAGGGCCAGGGGAAAGG - Intronic
1182310581 22:29402800-29402822 CTGAGAAAAGTGCAGGGGGGCGG - Intronic
1182321315 22:29480062-29480084 CAGTGAGAGGGGCGGGGCAGGGG - Intergenic
1182690469 22:32157946-32157968 CTGAGAAAAGTGCAGGGGGGCGG + Intronic
1182864092 22:33586820-33586842 CTGTGAAAGGAGCAGAGGGAGGG - Intronic
1182917049 22:34043635-34043657 CTGGGAGATGGGGAGGGGAGTGG + Intergenic
1183278854 22:36921650-36921672 CGGTAAAAGGAGCAGGGGTGGGG + Intronic
1183341475 22:37284122-37284144 CTATGGAGAGGGCAGGGGAGGGG + Intronic
1183350723 22:37333229-37333251 CCCAGAAAGGGGCTGGGGAGGGG + Intergenic
1183639457 22:39084176-39084198 CTCTGAGAGGGTCAGGGCAGAGG + Intronic
1183683609 22:39349672-39349694 CTGCGACCGGGGCAGGGGACCGG + Intergenic
1183892289 22:40939702-40939724 CTGTGAAAGGGCCAGTTAAGAGG - Intergenic
1184335293 22:43849272-43849294 CTGTGATAGGGACAGGGGGCAGG + Intronic
1184414869 22:44346395-44346417 ATGTGTAGGGGACAGGGGAGTGG - Intergenic
1184423600 22:44396110-44396132 CTGTGAGATGGGCAGAGGTGGGG + Intergenic
1184557605 22:45241406-45241428 CTGTGCCAGGTGCAGAGGAGGGG - Intergenic
1184799547 22:46751369-46751391 CTGGGAGAGGGGCAGGACAGTGG + Intergenic
1184858358 22:47158714-47158736 CTGTGGAAGGGACAGGGCAGCGG + Intronic
1185055418 22:48576283-48576305 CTGGGCAGGGGGGAGGGGAGCGG - Intronic
949830597 3:8210254-8210276 CTGTAAAAGGGGCAGAGGGCTGG - Intergenic
949877786 3:8637740-8637762 CTGTGAAATGGTCATGGAAGGGG + Intronic
950549968 3:13660280-13660302 CTGTGAAAGGGGCAGGTGTTGGG + Intergenic
950653846 3:14424523-14424545 CTGGGCAATGGGGAGGGGAGAGG + Intronic
951063744 3:18240020-18240042 CTCTGAAAAGGGAAAGGGAGTGG + Intronic
952105932 3:30069401-30069423 GTCTGAAAGGGGCAGGGGATTGG + Intergenic
952126412 3:30305837-30305859 CTTTGAAAGGGGCAAGGGAAGGG + Intergenic
952749943 3:36816960-36816982 GTGGGAAAGGGGAAGGGGAAGGG - Intergenic
953357081 3:42265021-42265043 CTCTGGAATGCGCAGGGGAGCGG - Intronic
954412463 3:50376798-50376820 CTGTGGAAGGGGGAGAGGTGTGG - Intronic
954625413 3:52019636-52019658 CTGTGTGAGGGGCAGAGGGGTGG + Intergenic
954846738 3:53565960-53565982 CAGAGAAAGGGTCATGGGAGAGG - Intronic
955687472 3:61561770-61561792 TTGCGAGAGGGGAAGGGGAGGGG - Intronic
956121352 3:65969341-65969363 CTGTGTTAGGGGCTGGGGGGTGG + Intronic
956211767 3:66808998-66809020 CTGTGAACAGGGAAGGAGAGCGG - Intergenic
957267162 3:77982567-77982589 CTGTGAAAGGAGCCGGGGGAGGG - Intergenic
957453323 3:80408506-80408528 CTGTGTAAGTGACAGGGGAAAGG - Intergenic
957788727 3:84913820-84913842 CTGAGAAAGGGGGTGGGGTGGGG - Intergenic
958083789 3:88780371-88780393 CTGTGAAAGGAGCCTGGAAGGGG - Intergenic
959389347 3:105755175-105755197 CTGTGGTGGGGTCAGGGGAGGGG - Intronic
959526256 3:107380790-107380812 CTGTGTAAGGGACATGTGAGGGG - Intergenic
960269583 3:115659101-115659123 CTCTAACAGGGCCAGGGGAGTGG + Intronic
960614397 3:119583666-119583688 CTGTGAAAGGCCAAGGTGAGAGG + Intronic
960879820 3:122332927-122332949 CAGGGAAAGGGGCAGAGTAGGGG - Intronic
961372621 3:126440787-126440809 CTGGGAAGGGGGCAGGGAAGAGG - Intronic
961424745 3:126836214-126836236 CTGGGAATGGAGTAGGGGAGTGG - Intronic
961648598 3:128406005-128406027 CTGTGAGAGTGGCATGGGACAGG - Intronic
961871645 3:129992850-129992872 CTCTGACAGGGGCTGGGCAGGGG + Intergenic
962232033 3:133674384-133674406 CTGGGAAGGGGGCGGGAGAGAGG + Intergenic
962510713 3:136097779-136097801 GTACAAAAGGGGCAGGGGAGTGG - Intronic
962604691 3:137023728-137023750 CGGAGCCAGGGGCAGGGGAGCGG - Intergenic
962738630 3:138347487-138347509 TTTTGTGAGGGGCAGGGGAGGGG + Intergenic
963062010 3:141232951-141232973 CTGTGAATGGGGAAGTGTAGGGG + Intronic
963638040 3:147824085-147824107 CACAGAAAGGAGCAGGGGAGTGG - Intergenic
963956902 3:151263990-151264012 CTGTTAAGTGGGTAGGGGAGAGG - Intronic
964146492 3:153470397-153470419 GAGGGAAAGGGGAAGGGGAGAGG - Intergenic
964708483 3:159646551-159646573 CTGTGAAAGGTTAAGGGGAGAGG - Intronic
965316963 3:167204388-167204410 CTGTGATGGGGTCAGGGGAGGGG - Intergenic
966131605 3:176647131-176647153 CTGTTAAAGGGGGAAGGGTGGGG + Intergenic
966314759 3:178633119-178633141 CTGTGAAAGGAGCTGGCGGGGGG - Intronic
967652957 3:192008981-192009003 CTGAGGCTGGGGCAGGGGAGTGG - Intergenic
968271216 3:197405097-197405119 CTGGTAAAGTGGCAGGGGTGGGG + Intergenic
968272652 3:197416453-197416475 CTGGGACAGGGTAAGGGGAGAGG - Intergenic
968468594 4:765731-765753 GGGAGAAGGGGGCAGGGGAGTGG + Intronic
968570631 4:1338616-1338638 ATGTGAGGGGGGCAGGGCAGGGG + Exonic
968730879 4:2268703-2268725 TTGTGCAGGGGGGAGGGGAGAGG - Intergenic
968794682 4:2694847-2694869 CTGTGAAATGGGCAGGACAGTGG + Intronic
968865743 4:3210097-3210119 CTCTGAATGGGGCCGGGAAGTGG + Intronic
968912348 4:3482737-3482759 TTGGGGAAGGGGCAGGGGGGCGG + Intronic
969436209 4:7191160-7191182 CAGTGAAGGGTGGAGGGGAGGGG - Intergenic
969482996 4:7456765-7456787 CTGTGGCAGGGGTAGGGGGGTGG + Intronic
969548735 4:7849935-7849957 ATGTAAAAGGGGCTGGGGATGGG + Intronic
969659668 4:8519080-8519102 CTGTCAAATGGACAGGGGTGCGG + Intergenic
969680290 4:8639618-8639640 GTGGGTAAGGGGGAGGGGAGAGG + Intergenic
970671254 4:18398980-18399002 TTGGGAAAGGGGCGGGGCAGGGG - Intergenic
970775444 4:19669006-19669028 CTGGGAAGGTGTCAGGGGAGGGG + Intergenic
971398835 4:26256026-26256048 GTGAGAAAGGGAGAGGGGAGAGG - Intronic
971506359 4:27370267-27370289 GTGAGAAAAGGGAAGGGGAGGGG - Intergenic
971506835 4:27375836-27375858 CTGTGGTGGGGTCAGGGGAGGGG - Intergenic
971890630 4:32516983-32517005 CTGTGGTGGGGTCAGGGGAGGGG - Intergenic
972271217 4:37512148-37512170 CTCTGAAAGAGGCAGTGAAGAGG - Intronic
972656308 4:41066875-41066897 ATTTGAAGGGGGCAGGGTAGAGG + Intronic
973552990 4:52053637-52053659 CTGTGGTTGGGGCATGGGAGAGG - Intronic
974114350 4:57562464-57562486 CTGTGGTGGGGTCAGGGGAGGGG - Intergenic
974525260 4:63042933-63042955 CTGTGAAAGCAGCAGGTCAGGGG - Intergenic
974925403 4:68292082-68292104 CTGTGAAAGCAGCAGGGAAGGGG - Intergenic
975146814 4:70976975-70976997 GTGTGAAAGAGGCTCGGGAGAGG - Intronic
975269967 4:72420018-72420040 AAGAGAAAAGGGCAGGGGAGTGG + Intronic
975780395 4:77833209-77833231 CTTTAAAAGGGGCTGGGGTGGGG - Intergenic
975829457 4:78353842-78353864 CTGTGGTGGGGTCAGGGGAGGGG + Intronic
975985302 4:80197079-80197101 CCGTGAAAGGGAGAGGGGTGCGG - Exonic
976220607 4:82754066-82754088 CTGAGAAAGGGGCAAGGCTGAGG + Intronic
977253056 4:94709853-94709875 CTGTGAGTGGGAAAGGGGAGGGG + Intergenic
977770675 4:100854704-100854726 TTGTGAGTGGGGCAGGAGAGGGG + Intronic
978441231 4:108736167-108736189 CTTTGGAAGGCGAAGGGGAGAGG - Intergenic
978537807 4:109780991-109781013 CTGTCATGGGGTCAGGGGAGCGG + Intronic
978979013 4:114918655-114918677 CTTTCAAATGGTCAGGGGAGGGG - Intronic
979441502 4:120755696-120755718 CAGTGTCAGGGACAGGGGAGAGG - Intronic
979443868 4:120787279-120787301 ATGTGAAATGGGCAGAGAAGTGG + Intronic
979721514 4:123905502-123905524 CTGTGAAAGCAGCTGGGGGGGGG + Intergenic
980510944 4:133786806-133786828 CTGTGGTGGGGTCAGGGGAGGGG - Intergenic
981046860 4:140272673-140272695 ATGTGGAGGGTGCAGGGGAGGGG + Intronic
981914100 4:150015303-150015325 CTGTGAAAGTGGCCAGGGAAGGG - Intergenic
983523604 4:168736883-168736905 CAGTGGGAGGGGGAGGGGAGTGG + Intronic
984172878 4:176381856-176381878 CAGTGTGAGGGGCAGGGCAGTGG - Intergenic
984371996 4:178880078-178880100 ATGTGAAAGTGGAAGGGGTGAGG - Intergenic
984708359 4:182864108-182864130 TTGTGGAAGGGGGTGGGGAGGGG - Intergenic
984900309 4:184580543-184580565 CCGTGAAAGCAGCTGGGGAGGGG - Intergenic
984911484 4:184677046-184677068 AAGGGAAAGGGGAAGGGGAGGGG - Intronic
985571959 5:651814-651836 GAATGAAAGGGGGAGGGGAGGGG - Intronic
985683754 5:1271030-1271052 GTGGGGAAGGGGCAGGAGAGAGG + Intronic
985777820 5:1854105-1854127 CTGTGGTAGAGGCAGGGAAGAGG - Intergenic
985817201 5:2135736-2135758 CAGTGGAGGGGGCCGGGGAGAGG + Intergenic
985828163 5:2208040-2208062 CTCTGAAAGGGAGTGGGGAGAGG - Intergenic
986176935 5:5360367-5360389 CCGTTAAAAGGGCAGGGAAGGGG + Intergenic
986328864 5:6702951-6702973 GAGTGAGAGGGGAAGGGGAGAGG - Intergenic
986674126 5:10168606-10168628 CTGTGCCAGTGGCAGGGGCGAGG - Intergenic
986695835 5:10353826-10353848 CGGGGAAAGAGGGAGGGGAGAGG - Exonic
986728510 5:10617883-10617905 GTGTGAAAGAGGCAAGGCAGTGG - Intronic
986929883 5:12805100-12805122 CTGAGAAAAGGGTAGGGGAAGGG - Intergenic
988214260 5:28250863-28250885 CTGTGACTGGGGTTGGGGAGTGG - Intergenic
988274944 5:29069004-29069026 CTGTGAAAGCGGCCAGGAAGGGG - Intergenic
988305601 5:29490153-29490175 CTGTGGTGGGGTCAGGGGAGGGG + Intergenic
988732066 5:33982236-33982258 CTGTGAAGAGGGCATGGTAGTGG + Exonic
988803470 5:34718583-34718605 CTGAGAACGGGGGAGGGCAGAGG - Intronic
989605705 5:43242437-43242459 CTTTCAAAGGGGCAGGGATGGGG + Intronic
989710359 5:44389557-44389579 GGGTGAAAGGGGCAGAGAAGGGG + Intronic
990117152 5:52403134-52403156 CAGTGAAAGGGCCAGGGGGTTGG - Intergenic
990446235 5:55896684-55896706 CTGGGGAGGGGGAAGGGGAGTGG - Intronic
990556985 5:56946433-56946455 CTTTTAAAGGAGCAGGGGATGGG + Intronic
991074570 5:62520520-62520542 CTGTCATGGGGTCAGGGGAGTGG - Intronic
991258326 5:64639578-64639600 GGGTGAATGGGGCAGGGTAGGGG - Intergenic
991306491 5:65181873-65181895 ATGTGAAGGAGGCAGGGGAGTGG - Intronic
991452906 5:66771599-66771621 CTAAGAAATGAGCAGGGGAGTGG - Intronic
992009368 5:72511526-72511548 CTGTAAAAAGGGCAGGGGGATGG - Intergenic
992157688 5:73971096-73971118 CTCTGCAAGGGGCAGGGGGTGGG + Intergenic
992182943 5:74215580-74215602 CAGTGGAAGGGGCAGAGGAAAGG + Intergenic
992523150 5:77577295-77577317 GGGGGAAGGGGGCAGGGGAGTGG - Intronic
992610659 5:78505453-78505475 GTGTGTCAGGGGAAGGGGAGGGG + Intronic
992958643 5:81937053-81937075 AAGTGTAAGGGGCAGGGTAGTGG - Intergenic
993272761 5:85816217-85816239 CATAGAAAGGGGCAGGGGAATGG + Intergenic
993810084 5:92464820-92464842 CTATGAAAGGGGCGGGGGCTTGG - Intergenic
994285209 5:97956171-97956193 CCGTGAAAGAAGCTGGGGAGGGG + Intergenic
994675321 5:102814023-102814045 CTGTGGTAGGGGCAGGAGACTGG + Intronic
994831812 5:104793244-104793266 GTGGGAAAGAGGCAGGAGAGTGG + Intergenic
996308623 5:122078184-122078206 CTGAGAAAGGGGAAAGGGAAGGG - Exonic
996923543 5:128796713-128796735 GTGTGAAAGGCTCAGTGGAGGGG - Intronic
996942329 5:129023075-129023097 CAGTGAAAGGCTCAGGGGAAAGG + Intronic
997696200 5:135862979-135863001 CTCTGGAAGGGGCAGAAGAGTGG + Intronic
997868777 5:137488741-137488763 CTGTGATTGGAGCAGGGAAGTGG - Intronic
998160591 5:139810792-139810814 GTGGGGAAGGGGCAGGGGACTGG + Intronic
998377692 5:141702174-141702196 CTGTAAAATGGGCACGGTAGTGG + Intergenic
998475230 5:142415250-142415272 TTGTCAAAGTGACAGGGGAGGGG + Intergenic
999101495 5:149029267-149029289 TTGTAAAAGTGGCAGGGGCGAGG + Intronic
999265931 5:150266924-150266946 TAGTGAAGGGGGCAGGGGAAAGG - Intronic
999378162 5:151101338-151101360 CTAAGGAAGGGGCAGGGGTGGGG - Exonic
999404653 5:151296315-151296337 CTGTGAGAGGGCCAGGGAATGGG - Intronic
1000440912 5:161261947-161261969 CTGTGGAAGGTGCAGGAGTGTGG + Intergenic
1001056916 5:168457430-168457452 CTGTGGAGGGGGCAGGGTGGAGG - Intronic
1001072683 5:168600568-168600590 ATGTGAAAGGCACAGGGGAAAGG - Intergenic
1001144626 5:169173016-169173038 CTTTGAAAGGCGCAGAGGGGTGG + Intronic
1001283566 5:170405971-170405993 CGGAGAAACGGGCAGGGGAGAGG - Intronic
1001322851 5:170697207-170697229 CTGGGATGGGGGCAGGGGAAAGG - Intronic
1001533964 5:172485520-172485542 CTGTGAAATGGCTTGGGGAGTGG + Intergenic
1001662897 5:173409867-173409889 CAGAGGTAGGGGCAGGGGAGAGG - Intergenic
1002029976 5:176420765-176420787 ATGTGAAAAGGACAGGGTAGAGG + Intergenic
1002045070 5:176536995-176537017 CTGGGCAGGGGGCGGGGGAGGGG + Exonic
1004055819 6:12138047-12138069 CTCTGAGAGGGACAGGAGAGTGG - Intronic
1004257692 6:14080098-14080120 CTGGGAAAAAGGCTGGGGAGTGG + Intergenic
1004603522 6:17173435-17173457 AAGGGGAAGGGGCAGGGGAGGGG + Intergenic
1004907245 6:20247668-20247690 TTAAGAAAGGGGAAGGGGAGGGG + Intergenic
1005676391 6:28159922-28159944 CGGGGACAGGGGCAGGGGCGGGG - Intergenic
1005897945 6:30194305-30194327 TTGGGAAGGGGGCTGGGGAGAGG + Intronic
1005899355 6:30204578-30204600 TTGTGTATGGGGAAGGGGAGCGG - Intronic
1006383536 6:33715583-33715605 CAGTGATTGGGGCAGGGGAGGGG + Intergenic
1006713100 6:36092855-36092877 CTGTGGAAGGTGCTGGGGACAGG + Intronic
1006783677 6:36650323-36650345 AAGGGAAAGGGGCAGGGAAGCGG - Intergenic
1006935071 6:37711588-37711610 GTGTGAAAGGGGCAGCCAAGAGG + Intergenic
1006937642 6:37729429-37729451 CGGAGAGAGCGGCAGGGGAGAGG + Intergenic
1007077731 6:39078545-39078567 CTGGGACAGGGGCAGGGGCAGGG - Intronic
1007368858 6:41413261-41413283 CTGGGAAGGGGGGAGTGGAGAGG - Intergenic
1007402989 6:41615117-41615139 CTGCGAAAGGGGCAAGAAAGTGG + Intergenic
1007775856 6:44223911-44223933 CTCCGCAAGGGGCAGGCGAGTGG + Exonic
1008000863 6:46358361-46358383 CAGGGACAGTGGCAGGGGAGGGG + Intronic
1008122688 6:47635787-47635809 CTGTCATAGGGTCGGGGGAGGGG - Intergenic
1008381666 6:50844619-50844641 CGGTGGAGGTGGCAGGGGAGGGG + Exonic
1008661559 6:53673184-53673206 CTGGGAGATGGGCAGGGGTGGGG - Intergenic
1008718532 6:54319551-54319573 CTGTGAAACATCCAGGGGAGGGG + Intronic
1009706300 6:67256605-67256627 CTGTGAGAGGGGCAGTGGGAGGG - Intergenic
1010060123 6:71613272-71613294 GTGAGAAAGGGGCAGGGGTGAGG - Intergenic
1010959527 6:82129955-82129977 CTGTGAAGAGGGCAGGGCATTGG - Intergenic
1011237480 6:85233330-85233352 ATTTGAAAGGGGCATTGGAGAGG + Intergenic
1011723723 6:90186673-90186695 TTGTCACGGGGGCAGGGGAGGGG - Intronic
1011805056 6:91062214-91062236 CAGAGGAAGGGGCAGGGGTGGGG + Intergenic
1012958758 6:105599624-105599646 CAGTGAAAGGGAAAGGGGAAAGG + Intergenic
1013655585 6:112243274-112243296 CTGTGGTAGGGGGTGGGGAGGGG - Intronic
1014851089 6:126340423-126340445 CTGGGAATGGGGCACGGGAGAGG + Exonic
1015601010 6:134910491-134910513 CAGAGGAAGGGGCAGGAGAGGGG - Intergenic
1016013442 6:139161454-139161476 CTGTTAAAGGGACAGGGATGGGG + Intronic
1016231200 6:141806589-141806611 CTTTAAAAGAGACAGGGGAGGGG - Intergenic
1016700761 6:147051508-147051530 CTTTAAGAGGGGCAGGGGTGAGG + Intergenic
1017571118 6:155745440-155745462 ATGTGGTAGGGGGAGGGGAGTGG + Intergenic
1017960792 6:159218817-159218839 CTGTGGAACTGTCAGGGGAGAGG + Intronic
1017997700 6:159547360-159547382 CTGTGGTGGGGTCAGGGGAGGGG - Intergenic
1018203466 6:161415772-161415794 CAGTGAAATGGGCAGTGGCGGGG - Intronic
1018460504 6:163994354-163994376 CTGTCAGAGGGGCAAGGGAAGGG + Intergenic
1018830105 6:167435529-167435551 CAGTGAGCGGGGCAGGGGAGGGG + Intergenic
1019786388 7:2980135-2980157 CAGTGCCAGGGGCCGGGGAGTGG - Intronic
1020080227 7:5282811-5282833 GTGAGGAAGGGGGAGGGGAGGGG + Intronic
1020418147 7:7969233-7969255 GTGTGTAAGGGGGAGGGGCGGGG - Exonic
1020579406 7:9976068-9976090 CTGTGAAAGGCCAAGGTGAGCGG - Intergenic
1021453900 7:20808386-20808408 CTGTATATGGGGCAGGAGAGGGG - Intergenic
1021813233 7:24424054-24424076 CTGAGAACTGGGCAGGGCAGGGG - Intergenic
1021818741 7:24475919-24475941 CTTTGGAAGGGGGTGGGGAGGGG + Intergenic
1022811135 7:33870038-33870060 CTGTGAAGTGGGCAGCAGAGTGG - Intergenic
1023199725 7:37683255-37683277 GTGCTATAGGGGCAGGGGAGGGG - Intergenic
1023781435 7:43659749-43659771 ATGTAAAACAGGCAGGGGAGTGG - Intronic
1024319248 7:48048742-48048764 GCTTGCAAGGGGCAGGGGAGAGG - Intronic
1024490322 7:49975121-49975143 CTGTGAAAGTGGCAGGGGTCAGG + Intronic
1024534708 7:50420529-50420551 AAGGGTAAGGGGCAGGGGAGAGG - Intergenic
1024553342 7:50581973-50581995 CTGAGAGAGGGGAAGGGTAGTGG - Intergenic
1026360435 7:69598058-69598080 CTGTGAGGGGGGCGGGGGCGGGG - Intergenic
1026633997 7:72065373-72065395 CTGGGGCAGGGGCAGGGGGGCGG - Intronic
1027506415 7:79021377-79021399 CTGTGAAAGCGGCTGGGAGGGGG + Intronic
1027654999 7:80919326-80919348 CTGCGAAAGGAGCAGGGTTGCGG - Exonic
1028113973 7:86976547-86976569 GTGTGGAGGGGGCAGGTGAGGGG - Intronic
1028532200 7:91850437-91850459 TTCTGAAAGGGGCAGCTGAGAGG + Intronic
1029010069 7:97250445-97250467 CTGTCAGAGGGGCAGGGGGAGGG - Intergenic
1029286387 7:99468772-99468794 CTGGGGAAGGGGCGGGGGCGCGG - Intergenic
1029496474 7:100897544-100897566 CTGTGCATGGGGGAGGGGACAGG + Intergenic
1029537953 7:101166793-101166815 ATGGGGAGGGGGCAGGGGAGAGG + Intergenic
1029927224 7:104329694-104329716 CTGGGAAAGGGGGCGGGGGGCGG + Intronic
1030273784 7:107697851-107697873 GTGTGGAATCGGCAGGGGAGGGG - Intronic
1030379792 7:108799338-108799360 CTGTTAAAGGGCCAGGGAGGAGG - Intergenic
1030797482 7:113806580-113806602 TGGTGAAAGGGGGTGGGGAGGGG - Intergenic
1031964497 7:128017905-128017927 TTGTGCAGGGAGCAGGGGAGAGG + Intronic
1032481182 7:132248478-132248500 CCGTGAAAGGTAGAGGGGAGAGG + Intronic
1032938419 7:136760858-136760880 CAGTGGAAGGTGAAGGGGAGTGG - Intergenic
1033370673 7:140704589-140704611 CTGTGATAGAGGGAGGGTAGGGG - Intronic
1033530450 7:142257527-142257549 ATGGGAACGGGGCAGTGGAGAGG + Intronic
1033652807 7:143355124-143355146 CTGTGCCAAGGGCTGGGGAGGGG + Exonic
1034223218 7:149460951-149460973 GTGTGAGAGGCGCAGGGGATCGG - Exonic
1034400448 7:150858273-150858295 CTGTGCATGGGGCAAGGGAGGGG + Intronic
1034404384 7:150892362-150892384 CTGGGGAAGGGGCATGGGAGAGG + Intergenic
1034411589 7:150945171-150945193 CAGTGAGAGGGGCAGGGGCAGGG - Exonic
1034412091 7:150947117-150947139 GTGGGGAAGGGGAAGGGGAGGGG + Intronic
1034422712 7:150997810-150997832 CAGTGACAGGGGCAGGGGAGTGG - Intronic
1034459580 7:151191135-151191157 CTGTAAAAGGGGGAGGGGTGAGG - Intronic
1034551679 7:151824631-151824653 CTGTGAGAGGAGCAGGAGAGAGG - Intronic
1034625193 7:152487267-152487289 AAGGGAAAGGGGAAGGGGAGGGG - Intergenic
1034625204 7:152487290-152487312 AAGGGAAAGGGGAAGGGGAGGGG - Intergenic
1034625215 7:152487313-152487335 AAGGGAAAGGGGAAGGGGAGGGG - Intergenic
1034625226 7:152487336-152487358 AAGGGAAAGGGGAAGGGGAGGGG - Intergenic
1034658126 7:152745439-152745461 TGGTGAAAGGGGCATTGGAGAGG + Intergenic
1034738130 7:153447769-153447791 CTGGGACAGGGAGAGGGGAGGGG - Intergenic
1035103870 7:156425201-156425223 ACCTGAAAAGGGCAGGGGAGGGG + Intergenic
1035115634 7:156520956-156520978 CTGAAGAAGGGGAAGGGGAGTGG + Intergenic
1035199094 7:157248566-157248588 CTGGGAGAGGCGCAGGTGAGGGG + Exonic
1035553297 8:545444-545466 CTGGGAAAGGGTGGGGGGAGGGG - Intronic
1035870282 8:3130244-3130266 CTAGGAATGGGGCAAGGGAGGGG + Intronic
1036672302 8:10799552-10799574 CTTTGAAATGGACAGGTGAGCGG + Intronic
1036978850 8:13445948-13445970 CTAAGAAAGGGGCAAGGGAATGG + Intronic
1037770838 8:21798570-21798592 TTGTGACAAGGGCAGGGTAGAGG - Intronic
1037783263 8:21885921-21885943 CTGTGCTAGGGTCGGGGGAGGGG - Intergenic
1037886384 8:22598527-22598549 ATGAGAAAGAGGCAGGGGACCGG + Intronic
1038383540 8:27119476-27119498 CTGTGATGGGGTCGGGGGAGGGG + Intergenic
1038433119 8:27515695-27515717 CTGTGGAAGGGAAAGAGGAGAGG - Intronic
1039434049 8:37547471-37547493 CAGGCAGAGGGGCAGGGGAGTGG - Intergenic
1039609202 8:38905611-38905633 CTGGGGGTGGGGCAGGGGAGTGG - Intronic
1039621415 8:39000280-39000302 CTGTGAGAGAGGCTGGGGCGCGG - Intronic
1040914908 8:52558996-52559018 AGGAGCAAGGGGCAGGGGAGGGG + Intronic
1042033140 8:64499385-64499407 CAGTCAAAGGGGAATGGGAGAGG + Intergenic
1042552175 8:70003773-70003795 CTCTTAAAAGGGCAGGGAAGTGG - Intergenic
1043147873 8:76679034-76679056 GTGTGCATGGGGAAGGGGAGTGG - Intergenic
1043748319 8:83903751-83903773 CTGTCATAGGGTGAGGGGAGGGG + Intergenic
1043850135 8:85206448-85206470 GTGTGGAAGGGGAAGGGGACAGG + Intronic
1044359503 8:91265037-91265059 CTGTGAAGGGGATGGGGGAGAGG - Intronic
1044603282 8:94026783-94026805 CTGGGGAAGGGGTAGGGGAATGG - Intergenic
1044720243 8:95138356-95138378 CTGAAAAAGGGGCGGGGGGGGGG - Intronic
1045016765 8:98007318-98007340 CAGAGCAAGGGGCAGGGGAGGGG - Intronic
1046424159 8:114024486-114024508 GTGTGGAGGGGGCAGGAGAGAGG - Intergenic
1046488761 8:114919537-114919559 CTGTCATTGGGGCAGGGGATGGG + Intergenic
1046885192 8:119359059-119359081 ATGTGGAAGGAGAAGGGGAGGGG + Intergenic
1046885681 8:119364408-119364430 CTGAGAAAGGGGAAAGGGGGAGG - Intergenic
1047474471 8:125213544-125213566 AGGGGAAAGGGGGAGGGGAGTGG - Intronic
1047530429 8:125669314-125669336 CTGTGGTGGGGTCAGGGGAGGGG - Intergenic
1047733802 8:127748342-127748364 CTGTGATAGAGGAAGGGGGGAGG - Intergenic
1048435922 8:134417417-134417439 CTGTGGTGGGGTCAGGGGAGGGG + Intergenic
1048502868 8:134994516-134994538 CTGTGGAAGGGGCGGGGGTGCGG + Intergenic
1048873222 8:138815869-138815891 CTGAGAAGGGAGCAGGGGAGTGG - Intronic
1049284229 8:141765958-141765980 ATGGGAGAGGGGCAGGGGAGAGG + Intergenic
1049538568 8:143194585-143194607 CAGTGCAGGGGCCAGGGGAGAGG + Intergenic
1049642434 8:143721705-143721727 CACTGAAAGGTGCAGAGGAGGGG - Intronic
1049701553 8:144016481-144016503 GTGTGACAGGGGCCAGGGAGAGG + Intronic
1049840330 8:144766940-144766962 CCTGGAGAGGGGCAGGGGAGAGG - Intergenic
1049919690 9:351670-351692 CTGAGAAAGTGGAATGGGAGGGG + Intronic
1050151343 9:2622000-2622022 CTGTGCAAGTTGTAGGGGAGGGG + Exonic
1050220757 9:3387001-3387023 CTGTGAAGGTGACTGGGGAGAGG - Intronic
1050301486 9:4263140-4263162 CTTTTAAAAGGGCAGGGCAGAGG - Intronic
1050640863 9:7666176-7666198 CAGTGAAAGGAGCAGGGAATTGG + Intergenic
1051173889 9:14345500-14345522 ATGCGAAAGGTGCAGAGGAGTGG + Intronic
1052078251 9:24171944-24171966 GTGTGGCAGGGGGAGGGGAGTGG + Intergenic
1053223198 9:36328323-36328345 CTGTGGAAGGAGCATGGGAGTGG + Intergenic
1053466384 9:38311620-38311642 CTGGGAAAGGAGCAAGGGAGTGG + Intergenic
1053486354 9:38459676-38459698 ATGTGATAGGGGCAGAGTAGGGG + Intergenic
1053575548 9:39355543-39355565 GAGGGAGAGGGGCAGGGGAGGGG - Intergenic
1053840054 9:42183482-42183504 GAGGGAGAGGGGCAGGGGAGGGG - Intergenic
1054097109 9:60914230-60914252 GAGGGAGAGGGGCAGGGGAGGGG - Intergenic
1054118515 9:61189859-61189881 GAGGGAGAGGGGCAGGGGAGGGG - Intergenic
1054454618 9:65423540-65423562 CTGTGACCATGGCAGGGGAGGGG - Intergenic
1054589242 9:66992705-66992727 GAGGGAGAGGGGCAGGGGAGGGG + Intergenic
1055200165 9:73649315-73649337 CTGTGAAAGTCCCAGGGAAGAGG + Intergenic
1055692242 9:78845638-78845660 CTGTGGAAAGGGGAGGGAAGAGG - Intergenic
1055704717 9:78985121-78985143 TTCTGAAAGCAGCAGGGGAGAGG + Intergenic
1055849573 9:80610114-80610136 CTGTGGTGGGGTCAGGGGAGGGG - Intergenic
1056520300 9:87395160-87395182 CTGTGTGAGAGGCAGGGGAGAGG - Intergenic
1056662187 9:88552192-88552214 CTGTAAAAGCGGAAGGGGAGTGG - Intronic
1056969525 9:91190918-91190940 TTGTAAAAGGGGCTGGGGGGTGG - Intergenic
1057040505 9:91844353-91844375 CTGTGGAAGGTGCAGGAGCGTGG - Intronic
1057141364 9:92728489-92728511 CTGTGAACAAGGCAGGGGTGTGG + Intronic
1057197366 9:93122412-93122434 CTGGGAAGGGGGGAGAGGAGAGG + Intronic
1058652583 9:107190614-107190636 CTGCAAAAGGGGTGGGGGAGGGG - Intergenic
1059031384 9:110701094-110701116 TTGTTAAAGGGTCAGGGAAGGGG + Intronic
1059039548 9:110796960-110796982 CTGTGGTGGGGTCAGGGGAGGGG + Intronic
1059538202 9:115103817-115103839 CTGTTCAAGGGGCAGGAGGGAGG - Intronic
1059988202 9:119840160-119840182 TTGTGAAAAGGGCAGGGTATTGG - Intergenic
1060269069 9:122128438-122128460 CTGTGGAGGGGGCAGGGGTTGGG - Intergenic
1060405707 9:123372154-123372176 CTGTGGGAGAGGCAGGGCAGGGG - Intronic
1060454101 9:123774009-123774031 CAGTGAAAGAGGAAGGGGAAGGG + Intronic
1060726599 9:126010331-126010353 TTCTGGAAGGGGCAGGCGAGGGG + Intergenic
1061044485 9:128157468-128157490 CTGGGACAGGGGCAGGACAGGGG - Intergenic
1061600746 9:131668560-131668582 CTGTGAAAATGGGAGGGGAGGGG - Intronic
1061943496 9:133895119-133895141 CAGCACAAGGGGCAGGGGAGGGG + Intronic
1062267650 9:135694732-135694754 GTGTGGGAGGGGGAGGGGAGGGG - Intronic
1062315046 9:135963003-135963025 CTGTGGAGGGGACAGGGAAGAGG + Intergenic
1062464708 9:136675869-136675891 CTGTGCAAGGTGGTGGGGAGGGG - Intronic
1062512538 9:136914934-136914956 CTTTGAAAGGCGGAGGCGAGCGG + Intronic
1062535282 9:137018563-137018585 GTTTGGAAGGGGCAGGGGTGGGG + Intronic
1062637577 9:137499693-137499715 CCGGGCAAGGGGCAGGGGTGGGG - Intronic
1062662127 9:137642884-137642906 CTGTCAAGAGGGGAGGGGAGGGG - Intronic
1185518914 X:723674-723696 CCGGGAAAGGGGGAGGGGAATGG - Intergenic
1185756644 X:2659157-2659179 AAGGGAAAGGGGGAGGGGAGGGG - Intergenic
1186143788 X:6604420-6604442 ATGTGAAGAGGCCAGGGGAGTGG - Intergenic
1186343123 X:8664040-8664062 CTGTCAAAGGGGTGGGGGAAGGG + Intronic
1186356826 X:8799651-8799673 CAGGGATGGGGGCAGGGGAGGGG - Intronic
1186357153 X:8800766-8800788 CAGGGATGGGGGCAGGGGAGGGG - Intronic
1186688326 X:11948601-11948623 CTTGGAAAGGGGAAGGGGAAGGG + Intergenic
1187188492 X:17010604-17010626 TTGTGTAAGGGGGAGGGAAGAGG + Intronic
1187323004 X:18257935-18257957 AGGGGAAAGGGGAAGGGGAGAGG + Intronic
1187948646 X:24450807-24450829 AAGGGAAAGGGGGAGGGGAGAGG + Intergenic
1188535737 X:31194776-31194798 CTGTGAAAGGGACAGGACAATGG + Intronic
1188734594 X:33696748-33696770 GGGTGCAAGGGGAAGGGGAGGGG + Intergenic
1189392260 X:40586068-40586090 AAGTGAAAGGGCCAGTGGAGAGG + Intronic
1189707881 X:43777995-43778017 GTGGGATAGGGGCAGGGTAGGGG - Intronic
1189860523 X:45266496-45266518 CTGAGCAAGGGGCAGGAGTGGGG - Intergenic
1190116619 X:47629675-47629697 CTGTAACAGGGCCAGGGGATGGG + Intronic
1190265695 X:48826378-48826400 CAGTGGCAGGGGCAGGGGCGCGG + Intergenic
1190276525 X:48902901-48902923 CGGTGAAAGAGTCAGGGGATGGG - Intronic
1190598458 X:52067898-52067920 CTGTGAATGGGGGAGGGAGGAGG - Intronic
1190610366 X:52186175-52186197 CTGTGAATGGGGGAGGGAGGAGG + Intronic
1190713176 X:53083653-53083675 TGGTGAAAGGAGGAGGGGAGGGG + Intronic
1190735203 X:53251175-53251197 CTGTGCAAGGGGGGGAGGAGAGG + Intronic
1191098710 X:56701747-56701769 CTGTGGAGGGGTCGGGGGAGGGG + Intergenic
1191270999 X:58469000-58469022 CTGTGGAGGGGTCGGGGGAGGGG + Intergenic
1191727489 X:64296727-64296749 CTGTGTTGGGGGCGGGGGAGGGG - Intronic
1192633105 X:72792051-72792073 CGGTGAAGGTGGCAGGGAAGGGG - Intronic
1192648604 X:72928750-72928772 CGGTGAAGGTGGCAGGGAAGGGG + Intronic
1192844496 X:74891874-74891896 CTGTGAAAGGGTGAGGGGAAAGG - Intronic
1193844020 X:86446441-86446463 CTGTGATGGGGTCGGGGGAGGGG - Intronic
1194088363 X:89556498-89556520 CTGATAAAGGGCCAGGTGAGTGG - Intergenic
1194288475 X:92039443-92039465 CTGTGAAAAGGGGAGAGAAGAGG - Intronic
1194703381 X:97143986-97144008 CTGGGAAAGGTGAAGGGTAGGGG + Intronic
1194744992 X:97618501-97618523 CTTTGCAAGGGTCAGGGGAGGGG - Intergenic
1194973013 X:100364775-100364797 CTATGAAAGAGACAGGTGAGAGG - Intronic
1195086427 X:101418262-101418284 CAGGGAAAGGGACAGGGAAGAGG + Intergenic
1195469961 X:105219885-105219907 GTGGGAATGGGGCAGGGCAGTGG + Intronic
1195516177 X:105778804-105778826 ATGTGTATGGGGGAGGGGAGTGG - Intergenic
1195808939 X:108808039-108808061 CTGTCATAGGGTGAGGGGAGGGG - Intergenic
1195823191 X:108969654-108969676 CACTGAAAGGGGCATGGAAGAGG + Intergenic
1196173697 X:112617257-112617279 CTGTGAAAGCAGCTGGGAAGAGG + Intergenic
1196739275 X:119010179-119010201 ATGTGAGAGGTGAAGGGGAGGGG + Intronic
1196793491 X:119484430-119484452 CTGGGAAAGGTAGAGGGGAGGGG - Intergenic
1197807469 X:130411613-130411635 GTGTGAAAGGGGAAGGTGTGGGG + Intronic
1197871806 X:131068582-131068604 CAGTGAAAGGGCCAGGGGGAGGG - Intronic
1198277034 X:135104815-135104837 CTATGAAAGTGGCGGGGCAGAGG - Intergenic
1198368410 X:135967034-135967056 GAGTGAAAGGGGGAAGGGAGGGG + Intronic
1198410606 X:136363253-136363275 GTGGGAAGGGGGAAGGGGAGTGG - Intronic
1198834986 X:140795456-140795478 CTGTGAAAGCAGCCGGGGGGTGG - Intergenic
1199132812 X:144213012-144213034 GTGTGAAAGGAGCAGAGAAGAGG - Intergenic
1199142233 X:144326593-144326615 CTGTGGTGGGGTCAGGGGAGGGG + Intergenic
1199694924 X:150337160-150337182 CTGTGAGAGGGGCTGGGGTCAGG - Intergenic
1199874623 X:151920552-151920574 ATGGGAAAGGGGTAGGGGATAGG - Intronic
1199999371 X:153049758-153049780 CTGTGAAAGCAGCTGGGAAGGGG + Intergenic
1200368945 X:155700759-155700781 CTGTGGTGGGGTCAGGGGAGGGG - Intergenic
1200441038 Y:3212537-3212559 CTGATAAAGGGCCAGGTGAGTGG - Intergenic
1200605994 Y:5264008-5264030 CTGTGAAAAGGGGAGAGAAGAGG - Intronic
1200795547 Y:7338113-7338135 CGCTGGGAGGGGCAGGGGAGAGG + Intergenic
1200872737 Y:8121126-8121148 CTGTGACAGGGGCTGTGGTGGGG + Intergenic