ID: 1144848713

View in Genome Browser
Species Human (GRCh38)
Location 17:18233374-18233396
Sequence CCCCATCTGCAGAAGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 235}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144848713_1144848725 22 Left 1144848713 17:18233374-18233396 CCTCCCAGCTTCTGCAGATGGGG 0: 1
1: 0
2: 3
3: 37
4: 235
Right 1144848725 17:18233419-18233441 GTCAGGAGATGTCTGAGCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 84
1144848713_1144848721 5 Left 1144848713 17:18233374-18233396 CCTCCCAGCTTCTGCAGATGGGG 0: 1
1: 0
2: 3
3: 37
4: 235
Right 1144848721 17:18233402-18233424 TGGGGCCCTCCTGCGAAGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 111
1144848713_1144848726 28 Left 1144848713 17:18233374-18233396 CCTCCCAGCTTCTGCAGATGGGG 0: 1
1: 0
2: 3
3: 37
4: 235
Right 1144848726 17:18233425-18233447 AGATGTCTGAGCGCTGGCAGCGG 0: 1
1: 0
2: 1
3: 14
4: 179
1144848713_1144848727 29 Left 1144848713 17:18233374-18233396 CCTCCCAGCTTCTGCAGATGGGG 0: 1
1: 0
2: 3
3: 37
4: 235
Right 1144848727 17:18233426-18233448 GATGTCTGAGCGCTGGCAGCGGG 0: 1
1: 0
2: 0
3: 13
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144848713 Original CRISPR CCCCATCTGCAGAAGCTGGG AGG (reversed) Intronic
900680744 1:3914946-3914968 CTCCAGCTGCAGGAACTGGGAGG - Intergenic
902837175 1:19054617-19054639 CCCCTTCTGTGGAATCTGGGGGG - Intergenic
903141461 1:21341722-21341744 CCCCATCTGGAGTGGCTGAGAGG + Intronic
903445342 1:23419071-23419093 CCCCACCTGTAGTAGCTGGATGG + Exonic
903786390 1:25863906-25863928 CCCCACGAGCAGCAGCTGGGGGG + Intronic
904425599 1:30420803-30420825 GCCCATCTTCTGAAGCTGCGGGG - Intergenic
905309028 1:37036879-37036901 TCCCAGCTGCAGAGGCTGTGGGG + Intergenic
905352402 1:37356706-37356728 CCTCACCTGCAGCAGCTGGGGGG - Intergenic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
906194215 1:43920030-43920052 CCCTATCTGCAGCAGCTGAGGGG - Intronic
907050267 1:51325568-51325590 CCCCATCTGCAATAGGTGTGGGG - Intronic
907584499 1:55604981-55605003 CCACATCTGGAGAAGCCTGGTGG + Intergenic
908323967 1:63005452-63005474 GCCCACCTGCAGATGCTTGGAGG - Intergenic
912491645 1:110065806-110065828 CCCCTACTCCAGAAGCTTGGCGG + Intronic
912583186 1:110738125-110738147 CCTCACCTGCAGGAGATGGGAGG - Intergenic
913378563 1:118184366-118184388 CCTCATTTACTGAAGCTGGGTGG + Intronic
918069773 1:181126426-181126448 CCCCTTCTTGAGAAACTGGGAGG - Intergenic
919235909 1:194842324-194842346 TCTCATCTGCTGAAGCTGGAGGG + Intergenic
920159079 1:203982013-203982035 CCCCAGCTGCAGAACCTAGGAGG - Intergenic
920298706 1:204975534-204975556 CCCCCTCTGCAGAAGCTCCTTGG - Intronic
920674314 1:208028834-208028856 CCCCAGCTACAAGAGCTGGGTGG - Exonic
920966450 1:210705222-210705244 CCTCCTCTGGAGAAGCTGGCAGG - Intronic
923511788 1:234659467-234659489 CCCCAAATGCAGAAGCTCAGTGG + Intergenic
923566074 1:235076911-235076933 CCCCATCTGCTGCATGTGGGGGG - Intergenic
1062920516 10:1275330-1275352 CCCCAGCTGGAGGAGGTGGGAGG + Intronic
1063154256 10:3364101-3364123 CCCCACCTTCATTAGCTGGGTGG + Intergenic
1063187379 10:3663641-3663663 CCCCATCTGTGGAAGGTGTGGGG - Intergenic
1065883789 10:30059367-30059389 TCCCAGCTGGAGAAGTTGGGGGG + Intronic
1067742290 10:48904806-48904828 CCCTATCCCCAGAAGCTGGGCGG - Intronic
1070626466 10:78054514-78054536 CCTCATCTGCAAAAGCGGGAAGG - Exonic
1070713229 10:78698708-78698730 CCTCCTCTGCTGAAGCGGGGTGG - Intergenic
1074818067 10:117158557-117158579 CCCCGTCTCCAGCAGCTCGGTGG - Intergenic
1075198708 10:120383291-120383313 CCACGTCTACAGAAGCTGTGTGG + Intergenic
1075732090 10:124642482-124642504 TCCCATCTGCAGAAGCTGCCCGG + Intronic
1076452252 10:130564921-130564943 CCCCAAATGCAGAGGCAGGGAGG - Intergenic
1076898652 10:133326183-133326205 CCCCAACCGCAGAAGCGGGAGGG - Intronic
1077365691 11:2160701-2160723 CCCCTTCTGCCCATGCTGGGTGG + Intronic
1077411376 11:2405461-2405483 CCCACTCTGCAGCGGCTGGGGGG - Intronic
1077905991 11:6533889-6533911 CCACATATCCAGAAGCTGTGGGG - Exonic
1078319640 11:10322641-10322663 CCCAAGCTGCAGCAGCTGTGGGG + Intronic
1078333928 11:10449807-10449829 CACCATCTTCAGCAGCTCGGGGG + Intronic
1078427249 11:11261870-11261892 CCCCAGCTGCAGATGCAGGTAGG + Intergenic
1078856335 11:15208761-15208783 CTCCATCCGCAGAGGCTCGGTGG + Intronic
1079005669 11:16789727-16789749 CCCCATGTGAAGGAGCAGGGAGG + Intronic
1079141341 11:17812056-17812078 CCCCTTCTGCAGATGGAGGGGGG - Intronic
1080408724 11:32003358-32003380 CCACATCTCCTGAAGCTGGGAGG + Intronic
1083262449 11:61530622-61530644 CCCCAACTTCAGAAGCAAGGGGG - Intronic
1084147966 11:67275075-67275097 CCCCACCCTCAGAGGCTGGGAGG - Intronic
1084641292 11:70427805-70427827 TTTCATCTGCAGAAGCTGAGTGG + Intronic
1084735287 11:71101539-71101561 CTCCATCTGCAGAGGGTGAGAGG - Intronic
1087269406 11:96096453-96096475 TCTCATCTGCAAAAGCGGGGAGG - Intronic
1088859873 11:113789722-113789744 CACCACCTGTAGAAGCTGGAGGG + Intergenic
1091230933 11:133987534-133987556 CCTCATCGGGAGAGGCTGGGTGG + Intergenic
1091873164 12:3912034-3912056 CCCCATGTGCAGAAGCTTGAGGG + Intergenic
1092199346 12:6570442-6570464 CGCCATCTGCAGGAGCTGGCGGG - Exonic
1092979755 12:13782880-13782902 CCCCATCTGCATAGGCTAGTGGG - Intronic
1094668253 12:32543409-32543431 CTCCCTCTCCAGAAGTTGGGAGG + Intronic
1097158581 12:57029804-57029826 CCCAAGCTGCAGAAGCTGAAAGG - Exonic
1098501935 12:71202944-71202966 CCACAAATGCAAAAGCTGGGTGG + Intronic
1101131762 12:101697666-101697688 CCCCAGCCCCAGAAGCTGTGGGG - Exonic
1101806704 12:108070228-108070250 CCCCATGTGGACAGGCTGGGAGG + Intergenic
1102101262 12:110280948-110280970 ACCCACCTGCAGACGCAGGGTGG - Intronic
1102218845 12:111180694-111180716 CCACAGCTGCAGGAGCTGAGAGG - Intronic
1102517086 12:113456956-113456978 ACCCATCAGCAGGTGCTGGGGGG + Intergenic
1103560085 12:121789036-121789058 GCCCATCTGCAGAGGCTGGATGG - Intronic
1104345150 12:127989962-127989984 CCCCATCCGGAGGAGCTGGAAGG - Intergenic
1104953066 12:132451105-132451127 CCCTCCCTGCAGAAGCCGGGCGG - Intergenic
1106080410 13:26495951-26495973 TCCCACCTGCAGATGCTGGCAGG + Intergenic
1106169037 13:27272879-27272901 CTGCTTCTGCAGAAGCTGGGTGG + Intronic
1106546707 13:30737173-30737195 CCCCAACTGCACAGGCAGGGAGG - Intronic
1110924320 13:81131534-81131556 CCACATCTGGAGTGGCTGGGAGG - Intergenic
1111521559 13:89412025-89412047 CACCATCTCCAGAAGCTGATAGG - Intergenic
1113161348 13:107384982-107385004 CTCCATCTACAGAAAGTGGGTGG + Intronic
1113533996 13:111049935-111049957 CCACTTCTGCAGAGGCTGCGAGG + Intergenic
1114976121 14:28102143-28102165 CACCAGCTGCAGAAGCAGGATGG - Intergenic
1115786330 14:36829769-36829791 CCCCTTCAGCAGAGGCTGAGTGG + Intronic
1117437895 14:55734669-55734691 CACCATCTGTATGAGCTGGGAGG + Intergenic
1119788810 14:77331225-77331247 CCACAGGAGCAGAAGCTGGGTGG + Exonic
1120871268 14:89339443-89339465 GCCAACCTGCAGGAGCTGGGAGG + Intronic
1121605515 14:95237313-95237335 CGGCACCTGCAGAGGCTGGGAGG + Intronic
1125022098 15:34995963-34995985 CCCCCACTGCAGTGGCTGGGGGG + Intergenic
1125155412 15:36579689-36579711 CCCTAGCTGCAAAAGCGGGGCGG - Exonic
1125957731 15:43802009-43802031 CCTCATGTGCAGATGCTAGGTGG + Exonic
1126802754 15:52315257-52315279 CCACACTTGCAGAAACTGGGAGG + Intronic
1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG + Intergenic
1129428441 15:75481372-75481394 CCCCATCCGGAGGAGGTGGGGGG + Intronic
1129865635 15:78906302-78906324 CCCATTCTGCATCAGCTGGGAGG - Intergenic
1131769953 15:95726732-95726754 TGACATCTGAAGAAGCTGGGAGG + Intergenic
1132032052 15:98446315-98446337 CCTCATCAGGAGAAGCCGGGAGG - Intronic
1133100504 16:3476378-3476400 CCTCAGGTGCAGAAGCTGGGCGG + Intronic
1134822202 16:17256117-17256139 CCCCATCTGCAGGGACAGGGTGG - Intronic
1134841013 16:17401607-17401629 CCCCACCTCAAGGAGCTGGGAGG + Intronic
1135992455 16:27226495-27226517 CCCCAACAGCAGAACCAGGGAGG + Intronic
1137479568 16:48840595-48840617 CCCAATCTATATAAGCTGGGAGG + Intergenic
1137594291 16:49713607-49713629 GCCCATTTGCAGAAGCGGGCAGG - Intronic
1137774827 16:51045980-51046002 CCCCAGAAGCAGAAGCTGGGAGG + Intergenic
1139021540 16:62755997-62756019 CCCCATGTGCAGAGGGAGGGAGG + Intergenic
1139476845 16:67207078-67207100 CCACTTCAGCTGAAGCTGGGAGG + Intergenic
1140406199 16:74713343-74713365 CCTCATCTGCGGAGGCTGGGAGG + Exonic
1140555534 16:75916836-75916858 CTGCATCTGTAGAATCTGGGAGG - Intergenic
1141648021 16:85377824-85377846 CCACATGTGCAGGAGCTGGGGGG + Intergenic
1141858571 16:86701297-86701319 CCCCACCCTCACAAGCTGGGAGG + Intergenic
1142149796 16:88507656-88507678 CCACATCTGCCGGAGCTGGATGG - Intronic
1142423715 16:89989423-89989445 CCCCATCGGGAGGTGCTGGGGGG - Intergenic
1142618280 17:1149341-1149363 ACCCCTCTTCAGAAGCTGGGTGG - Intronic
1143178876 17:4972279-4972301 CCCCATCATCTGAAGCTGGTGGG + Exonic
1143726491 17:8850442-8850464 CCCCATCTGCAGAACTGGGGAGG - Intronic
1144106590 17:11991806-11991828 TCCCCTCCTCAGAAGCTGGGTGG - Intronic
1144675496 17:17158933-17158955 CCCCATCTTCAGAAGACAGGTGG - Exonic
1144848713 17:18233374-18233396 CCCCATCTGCAGAAGCTGGGAGG - Intronic
1146074028 17:29711530-29711552 CCCCATCTGTAAAAGCTAGAAGG - Intronic
1146169887 17:30624860-30624882 CACCACCTGCAGAAGCTAGAGGG + Intergenic
1146343340 17:32040890-32040912 CACCACCTGCAGAAGCTGGAGGG + Intronic
1146643296 17:34557117-34557139 CAGTATTTGCAGAAGCTGGGAGG + Intergenic
1147059196 17:37860712-37860734 ACCCATCACCAGAAGCTAGGAGG + Intergenic
1147158217 17:38556003-38556025 CCCAATCTGCCAAAGTTGGGGGG + Intronic
1148163153 17:45463266-45463288 GCCCATGTGCAGAAGCTCCGAGG - Intronic
1150394385 17:64809918-64809940 GCCCATGTGCAGAAGCTCCGAGG - Intergenic
1150782605 17:68135120-68135142 CACCACCTGCAGAAGCTGGAGGG - Intergenic
1151441396 17:74131584-74131606 ACCCATCAGCAGAATCTGGCTGG - Intergenic
1152310100 17:79544794-79544816 CCCCATGTCTAGAAGGTGGGGGG - Intergenic
1156452162 18:37273065-37273087 CGCCATCTGCTGCATCTGGGCGG + Exonic
1156549346 18:37999170-37999192 CCCCGGCTGCAGAACCTGAGAGG + Intergenic
1156596210 18:38551054-38551076 CACCATCTTCAGAGGCTGAGAGG - Intergenic
1157204643 18:45687821-45687843 CCCCATCAGTAGAAGGTGTGGGG + Intergenic
1157495955 18:48157711-48157733 CCTCATCTGTAAAAGCTGAGTGG + Intronic
1157634760 18:49141063-49141085 TCCAACCTTCAGAAGCTGGGTGG - Intronic
1157858471 18:51121551-51121573 CCCCACCTGCGGATTCTGGGTGG - Intergenic
1159883794 18:73885120-73885142 CCCATTGTGCAGAAGCTGGCTGG + Intergenic
1160448757 18:78947487-78947509 CCCCACCTGCGGACGCCGGGGGG + Intergenic
1161062310 19:2221446-2221468 CCTCATTGGCAGAAGCAGGGAGG + Intronic
1161475515 19:4482771-4482793 CCTCATCTGCAGAATCAGGCTGG + Intronic
1162360516 19:10217294-10217316 CCCCATCTGTAGGGGCTGGGAGG + Intronic
1162967080 19:14161115-14161137 CCCCACCTGCAGAACCTGCAGGG - Intronic
1163791037 19:19306209-19306231 CCCCATCTGTAAAATCAGGGTGG - Intronic
1165117845 19:33539661-33539683 CCCTATCTTCAGATGCTGGCAGG - Intergenic
1166317770 19:41998506-41998528 CCCCACCTCCAGAAGCGTGGGGG + Exonic
1166368208 19:42287750-42287772 CCCCACCAGAAGAAGCTGGGAGG - Intronic
1166855799 19:45782158-45782180 CCCCATCTGCAGGAGCCCCGAGG + Intronic
1167709329 19:51100222-51100244 CCCCATATGCAGTAGGCGGGTGG - Intronic
925568473 2:5283123-5283145 TCCTATATGCAGAAGCTGGAAGG + Intergenic
927894397 2:26772075-26772097 CCACATCTCCAGGAGCTGGTGGG + Intronic
928121633 2:28587941-28587963 GCCTGTCTGCAGAGGCTGGGAGG - Intronic
929321582 2:40550259-40550281 CCCAATATGCAGATGCTGGTGGG + Intronic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
930665524 2:54095963-54095985 CCCCATCCGGAGGAGGTGGGGGG - Intronic
933538095 2:83602791-83602813 CCCCACTTTCAGAGGCTGGGTGG + Intergenic
933846980 2:86334721-86334743 GCCCATCTGCTCAGGCTGGGTGG + Intronic
933865700 2:86515167-86515189 CCCCATATGTAGAGGCTTGGGGG + Intronic
935220494 2:101008160-101008182 CCCGATCTGCAGCAGCAGTGTGG + Exonic
936147278 2:109988308-109988330 CTCAATGGGCAGAAGCTGGGTGG - Intergenic
936197414 2:110383175-110383197 CTCAATGGGCAGAAGCTGGGTGG + Intergenic
939911594 2:147989954-147989976 CCCCATCTGCTGGAGCTGTAAGG - Intronic
940645418 2:156387697-156387719 TCCCATCTGTAGAAGATGGGTGG - Intergenic
945673531 2:212830802-212830824 CCCAAACTGCAGTTGCTGGGTGG - Intergenic
947230064 2:227875532-227875554 CACCAACTGCAGACCCTGGGTGG - Intronic
947463706 2:230323784-230323806 CCCCACCTTCAGAAGGTGGCCGG + Intergenic
948565771 2:238885104-238885126 CTGCATCTGCACAATCTGGGAGG - Intronic
1170092672 20:12608508-12608530 GCCCATCTAAAGAACCTGGGAGG + Intergenic
1170643616 20:18177425-18177447 CCCCACCCACTGAAGCTGGGTGG - Intronic
1170847660 20:19975508-19975530 TCCCAGCTGCAGAAGGTGAGCGG + Exonic
1172406023 20:34689897-34689919 CCCCTTCTGCAGAATCTGGATGG - Intergenic
1173495718 20:43515754-43515776 CTCTAGCTGCAGAAGCTGGAAGG + Intronic
1173642045 20:44610163-44610185 CGCCATCTGCTGTAGCCGGGGGG + Intronic
1174728654 20:52891916-52891938 CCCCTTCTGCAGCAGCCAGGTGG + Intergenic
1175166664 20:57048886-57048908 CCCCCTCTGGAGGAGCTTGGGGG + Intergenic
1175231549 20:57476730-57476752 CCACAACGGCTGAAGCTGGGCGG - Intergenic
1177318143 21:19487757-19487779 CCTCACCTGCAGAACCTGGGAGG - Intergenic
1178800617 21:35791771-35791793 GCCCACCTGCAGGTGCTGGGAGG + Intronic
1178925128 21:36768392-36768414 TCCCAGCTACAGAAACTGGGTGG + Intronic
1180001685 21:44998080-44998102 CCCCATCTTCTGAGGGTGGGAGG + Intergenic
1180102472 21:45595263-45595285 ACCCAACTGCAGACTCTGGGAGG + Intergenic
1181003450 22:19998590-19998612 GCCTCTCTGCAGGAGCTGGGGGG + Intronic
1181570626 22:23766237-23766259 CCCCATCTGCAGGGGCTGGGGGG + Exonic
1181891520 22:26067612-26067634 TCCCATCTGGAAAATCTGGGAGG - Intergenic
1182686523 22:32124356-32124378 CCACTTCTGCAGAATCTGGAGGG + Intergenic
1182755607 22:32676402-32676424 CCCTATCTGCAGAAGCCCGGAGG + Intronic
1183338048 22:37262210-37262232 CACCATCTGCTGCTGCTGGGTGG - Intergenic
1183394901 22:37566194-37566216 CCCCAAATGCAGAGGCTGTGGGG - Exonic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1184471912 22:44701199-44701221 CCACAGCTCCAGGAGCTGGGAGG - Intronic
949507632 3:4742033-4742055 GCCCTTCTGCGGAAGCTGTGAGG + Intronic
950520699 3:13496173-13496195 CTCCAGCTGCTGAGGCTGGGGGG - Intronic
950890936 3:16403048-16403070 TTCCATCAGCAGAACCTGGGCGG + Intronic
952764936 3:36945407-36945429 CCTCATCTGTAGGAGCTAGGGGG - Intergenic
953626854 3:44579036-44579058 CCCCATCTTCAGAAGACAGGTGG + Intronic
954786093 3:53093583-53093605 CCTCATGTGCAGAATCTGGGTGG - Intronic
956400923 3:68878928-68878950 ACCCATCTGCCAAAACTGGGGGG + Intronic
956602896 3:71041666-71041688 CCGCATCTGCCGTAGTTGGGAGG - Intronic
958153680 3:89725436-89725458 CCCCATCAGCAGAGGCTGAGTGG + Intergenic
958406908 3:93763533-93763555 CCCCACCTCCAGAAGAAGGGCGG + Intergenic
961457730 3:127032573-127032595 CCCCAACTACAAGAGCTGGGTGG + Exonic
962708686 3:138068053-138068075 TCCTATCTGCAGAAGCCTGGAGG + Intronic
962985244 3:140530614-140530636 CCACATCTGCTGAAGCTGGATGG - Intronic
964433727 3:156631177-156631199 CCACCTCTGCAGAAGTAGGGAGG - Intergenic
966815276 3:183885080-183885102 CCTCATCTGCAAATGCCGGGAGG - Intergenic
967977790 3:195045049-195045071 CCCCATCTGCGGAATCTGAGGGG + Intergenic
967992230 3:195139886-195139908 CAGAATCTCCAGAAGCTGGGAGG - Intronic
968040921 3:195588654-195588676 TCCCATCTGTAGCAGCTGGCAGG - Intergenic
968812910 4:2808200-2808222 GGCCACCAGCAGAAGCTGGGAGG - Intronic
969902590 4:10363439-10363461 CCCCATCAGCAGAAGATGGTTGG + Intergenic
973677460 4:53279799-53279821 GCCCATCTTCACAAGGTGGGAGG + Intronic
976087327 4:81419792-81419814 CCTCATCTGCAGAGGATTGGGGG - Intergenic
977726507 4:100302673-100302695 CTCCATCTGCAGTGGGTGGGGGG - Intergenic
979812508 4:125055356-125055378 CCCCATCAGCAGAAGCAGCTAGG + Intergenic
981073257 4:140567512-140567534 CTCCATCTGGAGAATATGGGTGG - Intronic
981114472 4:140973937-140973959 CACCATCAGAGGAAGCTGGGAGG - Intronic
982031423 4:151304917-151304939 GCCCATCTGCATAAGCTGGGAGG + Intronic
985324706 4:188754640-188754662 CCCCCTCTGCAGCTGCTGGCTGG - Intergenic
985480259 5:105859-105881 CGGCAGCTGTAGAAGCTGGGGGG + Intergenic
985563157 5:602089-602111 CCGCAGCTGCAGGAGCTGGGCGG - Intergenic
985667370 5:1188037-1188059 CCACAGCTGCTGAAGCTGGCGGG - Intergenic
988496236 5:31748556-31748578 CCCCAGCAGCAGAAGCTGTGGGG + Intronic
988563856 5:32304820-32304842 CTCCATCTGCAGAAGTTGTGTGG + Intronic
992025659 5:72666530-72666552 CCCCATCTTCAGGAACTGGCTGG - Intergenic
997714146 5:136029487-136029509 CCCTTTCTGCAGTGGCTGGGAGG - Intronic
1001086272 5:168701995-168702017 GCCCATCTTCAGCAGCTGGAAGG + Intronic
1002025286 5:176392635-176392657 CCCCATCTCCAGGCGCTGGGAGG - Exonic
1004863326 6:19829046-19829068 CAGCATGTGCAGAAGCTTGGAGG - Intergenic
1006065320 6:31457247-31457269 GTCCATCTGCAAAACCTGGGAGG - Intergenic
1008630243 6:53357557-53357579 CCTCATCTGCAGAAACTTTGAGG + Intergenic
1010032770 6:71288449-71288471 CCTCAGCTCCAGGAGCTGGGCGG + Intergenic
1011551845 6:88537412-88537434 CACCATCTGCAGACACTTGGTGG - Intergenic
1013194621 6:107834206-107834228 CCCCAAAAGCAGAAGTTGGGAGG + Intergenic
1015840560 6:137472208-137472230 CACCATCTGCTGTGGCTGGGGGG + Intergenic
1017905594 6:158755728-158755750 ACCCATTTGCAGCAGCTGTGCGG - Intronic
1019428814 7:989137-989159 CCCCAGCTGTAGGTGCTGGGGGG - Exonic
1019536680 7:1533124-1533146 CCTCATCTACAGCAGCTGGTCGG - Intronic
1020042182 7:5012602-5012624 TCCCACCTGCAGTGGCTGGGTGG + Intronic
1020813493 7:12874770-12874792 CCAGATTTGTAGAAGCTGGGAGG - Intergenic
1021174994 7:17440146-17440168 CCACAGCTGGAGCAGCTGGGAGG + Intergenic
1022955967 7:35380652-35380674 CTCCATCTTCAGAAGGTGGAGGG - Intergenic
1023255889 7:38311663-38311685 CCCCATCTGCAGGGGCTGGGGGG - Intergenic
1024780373 7:52841029-52841051 CCCCCTCTGCTGTAGCTGGCAGG + Intergenic
1024986997 7:55202714-55202736 CCCCCTCTGGAGATGCTGGAGGG - Intronic
1026033746 7:66816344-66816366 CCCCATGTGTGGAATCTGGGGGG + Intergenic
1028029915 7:85897802-85897824 CTCTATTTCCAGAAGCTGGGTGG - Intergenic
1028625320 7:92870881-92870903 CACCATCTGCAGAACCTGGCAGG + Intergenic
1028727176 7:94101034-94101056 CCCCCTCTGCAGCTGCTGGCTGG - Intergenic
1029235422 7:99112306-99112328 GCCCATCTGCAAAGACTGGGGGG + Intronic
1029413280 7:100428694-100428716 CCTCATTGGCAGAAGCTGGGGGG + Intronic
1032458952 7:132095168-132095190 CCCTATCTGGAGAGGCTGAGGGG - Intergenic
1033348678 7:140544644-140544666 CCTCCTCTCCAGAAGCAGGGAGG + Exonic
1034070178 7:148176802-148176824 CCCCATCGGCTGAGGCTGAGGGG + Intronic
1034293953 7:149955195-149955217 CACCATCTGCATGAGCTGCGTGG + Intergenic
1034421870 7:150994918-150994940 CCCCATCTCCAGAAGAGGTGAGG + Intronic
1034812118 7:154141665-154141687 CACCATCTGCATGAGCTGCGTGG - Intronic
1036191061 8:6670945-6670967 CCCAATCTTCAGATGCTTGGAGG - Intergenic
1036561289 8:9902345-9902367 CCCCATCCGCTGCAGCTTGGTGG + Intergenic
1037438405 8:18888998-18889020 CCCCATGTGAAGATGGTGGGTGG - Intronic
1037906385 8:22718272-22718294 CCCCAGCTGCAGAAGGGAGGAGG - Intronic
1038020780 8:23550530-23550552 CTGCATTTGTAGAAGCTGGGAGG + Intronic
1039479278 8:37859790-37859812 CAGCATCTGCAGCAGCTGGAAGG + Exonic
1046950716 8:120017226-120017248 CAACAACTGCTGAAGCTGGGTGG + Intronic
1047958539 8:129994253-129994275 CCAAAACTCCAGAAGCTGGGGGG + Intronic
1049223142 8:141436949-141436971 CCCCATCTGCACTGGGTGGGGGG + Intergenic
1049310324 8:141930761-141930783 CCTCATCTGTAGATGCAGGGTGG - Intergenic
1049788648 8:144463004-144463026 CCGCCCCTGCAGAAGGTGGGCGG + Intronic
1051422893 9:16906014-16906036 CCTCCTTTGCAGAAGCTGGCTGG - Intergenic
1053454808 9:38225873-38225895 CCTCATCTGTAAAAGGTGGGGGG + Intergenic
1054160706 9:61670557-61670579 CCACATCTGGAGAGGCTGGCAGG + Intergenic
1056817333 9:89811496-89811518 CCGTCACTGCAGAAGCTGGGTGG + Intergenic
1061036636 9:128118029-128118051 CCCCATCTGCAGCAGCCCCGGGG + Intergenic
1061681565 9:132245055-132245077 CCCCTGGTGCAGAAGGTGGGCGG + Intergenic
1061801099 9:133113807-133113829 CCACATCTGGACCAGCTGGGAGG + Intronic
1062402031 9:136376963-136376985 GCCCACTTGCAGCAGCTGGGAGG - Intronic
1062457261 9:136645641-136645663 CCACTTCTGCAGAAGCACGGGGG - Intergenic
1062578483 9:137219389-137219411 CCCCATCTTCACCATCTGGGCGG + Intergenic
1191188554 X:57640109-57640131 CCACAGCTGGAGCAGCTGGGAGG - Intergenic
1196601681 X:117607881-117607903 CCCCATCTGTAACAGCTGAGGGG - Intergenic
1196761444 X:119204209-119204231 CCCCAGCTGCTGAGGCTGGGAGG + Intergenic
1197680432 X:129377128-129377150 CCACAGCTGGAGAAGGTGGGAGG - Intergenic
1197874043 X:131085373-131085395 CCTCCTCTACAGAACCTGGGTGG - Intronic
1198268682 X:135033573-135033595 CCCCATTTACAGAACCAGGGAGG - Intergenic
1199699343 X:150364479-150364501 ACCCAGCTGCAGAAGCGCGGCGG - Intronic
1200236710 X:154471291-154471313 CCCCAACTACAAGAGCTGGGTGG + Exonic