ID: 1144849278

View in Genome Browser
Species Human (GRCh38)
Location 17:18235846-18235868
Sequence AGAGCCCAGCGTGGGCCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 506
Summary {0: 1, 1: 0, 2: 6, 3: 52, 4: 447}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144849272_1144849278 -6 Left 1144849272 17:18235829-18235851 CCCAGGGAAGGTGCCAGAGAGCC 0: 1
1: 0
2: 3
3: 29
4: 257
Right 1144849278 17:18235846-18235868 AGAGCCCAGCGTGGGCCTGGCGG 0: 1
1: 0
2: 6
3: 52
4: 447
1144849269_1144849278 8 Left 1144849269 17:18235815-18235837 CCCACGCTGAGCTGCCCAGGGAA 0: 1
1: 0
2: 1
3: 12
4: 163
Right 1144849278 17:18235846-18235868 AGAGCCCAGCGTGGGCCTGGCGG 0: 1
1: 0
2: 6
3: 52
4: 447
1144849273_1144849278 -7 Left 1144849273 17:18235830-18235852 CCAGGGAAGGTGCCAGAGAGCCC 0: 1
1: 0
2: 1
3: 31
4: 326
Right 1144849278 17:18235846-18235868 AGAGCCCAGCGTGGGCCTGGCGG 0: 1
1: 0
2: 6
3: 52
4: 447
1144849270_1144849278 7 Left 1144849270 17:18235816-18235838 CCACGCTGAGCTGCCCAGGGAAG 0: 1
1: 0
2: 2
3: 24
4: 248
Right 1144849278 17:18235846-18235868 AGAGCCCAGCGTGGGCCTGGCGG 0: 1
1: 0
2: 6
3: 52
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144849278 Original CRISPR AGAGCCCAGCGTGGGCCTGG CGG Intronic
900292351 1:1928889-1928911 AGAGACCAGCGTGGGCACAGGGG + Intronic
900331188 1:2135429-2135451 AGAGCCCAGCCTGGGCTCAGCGG - Intronic
900554364 1:3272419-3272441 AGAGTCCAGCGCGTGCCTGTGGG - Intronic
901006387 1:6173684-6173706 AGAGCCCAGCGAGACCCAGGAGG + Intronic
901011873 1:6206767-6206789 AGAGCCAACCTTGGGCCCGGGGG - Intronic
901656815 1:10774102-10774124 AGTGCCCCTTGTGGGCCTGGCGG - Intronic
902940911 1:19799772-19799794 AGTGCCCCGCGTGGGGCCGGCGG + Intronic
904312016 1:29635140-29635162 AGAGCGCAGGGCGGGCCTGCAGG - Intergenic
904575722 1:31503958-31503980 GGAGCCCTGCGTGGGGCTGACGG - Intergenic
904590883 1:31614782-31614804 GGAGCCCAGCCTGGACATGGAGG + Intergenic
905653253 1:39670639-39670661 AGAGCCCACAGAGGGCCTTGGGG - Intronic
905923521 1:41734134-41734156 AGAGCCCACCCCAGGCCTGGTGG - Intronic
906344918 1:45009092-45009114 AGAGCCCGGCGTGGAGATGGGGG - Intronic
907159757 1:52361459-52361481 TGAGGCAAGCTTGGGCCTGGTGG - Intronic
907324080 1:53625595-53625617 AGAGCCAGGGTTGGGCCTGGGGG - Intronic
907498861 1:54863457-54863479 ATAGCTCAGCGTGGGCATGCTGG + Intronic
910389005 1:86717707-86717729 AGAGCACAGGCTGGGCATGGTGG - Intronic
910772137 1:90841541-90841563 TGAGCGGAGCCTGGGCCTGGCGG - Intergenic
912467508 1:109884029-109884051 TGAGCCCAGCGTGGTGCTAGAGG + Intergenic
912512465 1:110198525-110198547 AGGGCCTGGCCTGGGCCTGGTGG - Exonic
912924822 1:113904908-113904930 AGAGCCTAGGGTGGGGCTCGCGG - Exonic
913336089 1:117710069-117710091 AGAGCTCAGTGTGGGATTGGAGG + Intergenic
913548860 1:119896912-119896934 ACTGCCCAGAGTGGGGCTGGGGG - Intergenic
914847572 1:151291473-151291495 AACCCCCAGTGTGGGCCTGGGGG + Exonic
915365818 1:155315148-155315170 AGAGCCCAGCATGGGCCGTGGGG - Intronic
915513555 1:156400280-156400302 AGGGTCCTGAGTGGGCCTGGGGG - Intergenic
915589823 1:156864455-156864477 GGAGCTCAGCATGGGCCTGGGGG + Intronic
916046708 1:161005385-161005407 AGGGCCCAGTGTTGGCCTGCTGG + Intronic
917071958 1:171161156-171161178 AGATCCCCGCCTGGCCCTGGAGG + Exonic
917141644 1:171841498-171841520 AGAGCCAAGCGGCGGGCTGGCGG + Exonic
917790925 1:178498262-178498284 AGAGCCTAGACTGGGCCTGGGGG - Intergenic
917920488 1:179745461-179745483 AAATCCCAGCGTGGGCCTCTGGG - Intronic
918343596 1:183587101-183587123 AGAGCACAGGGTGGGCCTCGAGG - Intronic
918759010 1:188377470-188377492 AGAGCACAGGGTGGGGTTGGTGG - Intergenic
919856466 1:201709596-201709618 TCAGCCCAGGGTGGGTCTGGAGG - Intronic
920382781 1:205545293-205545315 AGAGCCCTGGGTGGGCGTGGTGG - Intergenic
920432439 1:205927627-205927649 AGAAGCCAGTGTGGGGCTGGGGG + Intronic
921060369 1:211579418-211579440 GGAGCCGGGCGTGGGCCGGGGGG + Intergenic
922064176 1:222120583-222120605 AGAGACCACAGAGGGCCTGGTGG + Intergenic
922287663 1:224183688-224183710 ACCGGCCGGCGTGGGCCTGGCGG - Intronic
922481929 1:225945175-225945197 AGTGCTCAGGGTGGCCCTGGGGG + Intergenic
922669065 1:227495044-227495066 AGGGCCCAGCGCGGGCCTGCCGG - Intergenic
922670532 1:227506258-227506280 AGGGCCCAGCGCGGGCCTGCCGG + Intergenic
924694062 1:246381902-246381924 GGAGCCCGCGGTGGGCCTGGAGG - Intronic
924694103 1:246382052-246382074 GGAGCCCACGGTTGGCCTGGAGG - Intronic
1062885215 10:1011019-1011041 AGAGCCCATCCAGGGCCTGGCGG - Intronic
1063683386 10:8212061-8212083 AGAGCCCAGGATGGGCGTGATGG + Intergenic
1064146820 10:12832477-12832499 AGAGCCGTGCATGGTCCTGGGGG - Exonic
1067037386 10:42930636-42930658 GGAGCCCAGCATGGGTGTGGGGG + Intergenic
1067064126 10:43094137-43094159 AGTGCTCAGCATGGGGCTGGAGG + Intronic
1067223053 10:44357591-44357613 AGAGCCCCGGGTGGGACCGGGGG - Intergenic
1067249749 10:44576345-44576367 GGGACCCAGGGTGGGCCTGGTGG - Intergenic
1067830552 10:49609320-49609342 AGAGCCCACCCGGGGCTTGGAGG + Intronic
1069186450 10:65429384-65429406 GGAGCACAGCGGGGGACTGGCGG - Intergenic
1069224141 10:65920671-65920693 ATTGCCAAGCGTGGGCATGGTGG + Intronic
1070264350 10:74887610-74887632 AGAGACCAGGCTGGGCATGGTGG - Intronic
1070401426 10:76056518-76056540 ACAGCTCAGCATGGGCCTGCAGG - Intronic
1070642732 10:78180991-78181013 AGACCCCAGCATGAGCATGGGGG - Intergenic
1070750825 10:78963117-78963139 GGAGCCCAGCCTGGCCCAGGGGG - Intergenic
1070915110 10:80148498-80148520 TGGGCCCAGCTGGGGCCTGGAGG + Intergenic
1071507764 10:86242964-86242986 TGGGCCCAGCGTAGGCCTGCTGG - Intronic
1071568604 10:86684408-86684430 AGAGGGCAGTGTTGGCCTGGCGG - Intronic
1071956927 10:90770351-90770373 GGAGCCCAGAGAGGACCTGGAGG + Intronic
1072622502 10:97089404-97089426 AGAACGCAGCGTGGGGCTGCTGG + Intronic
1073294982 10:102433490-102433512 AGAGACCAGCCTGGGCCACGTGG - Intergenic
1073571066 10:104581559-104581581 AGAGCCTAGAGTGGCCTTGGTGG + Intergenic
1073845040 10:107544984-107545006 GCAGCTCAGCGTGGGCCTGCAGG + Intergenic
1074182901 10:111078806-111078828 CGAGCGCAGCGCGGGCCCGGGGG + Exonic
1074755674 10:116622264-116622286 AGAGCCTGGCGTGAGCCTTGGGG - Intronic
1075229115 10:120657497-120657519 AGACAGCAGTGTGGGCCTGGAGG - Intergenic
1075337962 10:121622344-121622366 AGTGCCCAGAGTGGCCCAGGAGG + Intergenic
1075498901 10:122954125-122954147 AGAGGCCAGCGTGGGGCGGCGGG + Exonic
1075521813 10:123147953-123147975 AGAGCGCGCCGAGGGCCTGGCGG - Intergenic
1075630924 10:124000228-124000250 AGAACCCAGGGAGGGCCTCGAGG + Intergenic
1075644353 10:124087719-124087741 AGAGCCCAGAGGGGGCCTGGAGG - Intronic
1075777112 10:124996268-124996290 AGAGGGCAGCCTGGGGCTGGGGG - Intronic
1075781891 10:125022555-125022577 AGAGCCCAGCGTGAGCTTAGAGG - Intronic
1076488959 10:130843490-130843512 ACAGCCCCGCGAGGCCCTGGTGG - Intergenic
1076529451 10:131134867-131134889 GGAGCTGAGCGTGGGCCTGTTGG - Intronic
1076720226 10:132389205-132389227 AGAACCCGGCGTGGGCCTTGGGG + Intergenic
1076740727 10:132482874-132482896 AGAGCCCAGGCTGGGCACGGTGG + Intergenic
1077048181 11:555337-555359 AGAGGCCGGGCTGGGCCTGGAGG - Exonic
1077185417 11:1233534-1233556 TGAGCCCAGGGTGGGAGTGGGGG - Intronic
1077328747 11:1974800-1974822 GGATCCCAGCGGGGGCCTGTGGG + Intronic
1077358072 11:2127770-2127792 CCGGCCCTGCGTGGGCCTGGGGG + Intergenic
1077502920 11:2917307-2917329 AGAGCCCAGCCTGGGCCAGAGGG + Intronic
1078081437 11:8207280-8207302 GGAGCCCACCCTGGGTCTGGTGG + Intergenic
1079251565 11:18791372-18791394 AGAGCCCCACGGGGGCGTGGCGG + Intronic
1081811023 11:45914183-45914205 AGTGCTCAGCCTGGGCCTGTGGG - Exonic
1081870973 11:46382324-46382346 AGTGCGCTGAGTGGGCCTGGGGG + Exonic
1082115600 11:48325164-48325186 GGAAGCCAGCGTGGGGCTGGAGG - Exonic
1082820799 11:57543486-57543508 AGAGCCCAGGGTGGGGGAGGGGG + Intronic
1083308534 11:61772915-61772937 AGTGCCCAGTGCTGGCCTGGCGG - Intronic
1083565930 11:63716541-63716563 AGCGCCCAGGGTGGGCGTGGTGG + Intronic
1083593801 11:63909724-63909746 GAAGCCCACAGTGGGCCTGGCGG - Exonic
1083770694 11:64865247-64865269 TGAGGGCAGCGAGGGCCTGGTGG - Intronic
1084195795 11:67523192-67523214 AGAGCCCTCCGAGGGCCGGGCGG - Intronic
1084416643 11:69036245-69036267 AAAGCCAAGCCTGGCCCTGGAGG - Intergenic
1084695742 11:70754586-70754608 AGAGCCCAGCCTGGAACTTGTGG + Intronic
1084931531 11:72560291-72560313 TGAGCCCAGCGTGGGGCCTGAGG + Intergenic
1085217345 11:74844201-74844223 AGTGTCCAGCTTGGGCTTGGAGG + Exonic
1085391934 11:76186663-76186685 AGACCCCAGGGTGGGCCAGGGGG + Exonic
1086535274 11:87836778-87836800 AGAGCAGAGCGTAGGACTGGGGG - Intergenic
1087672923 11:101128221-101128243 AGCGCCCAGGGTCGCCCTGGTGG - Exonic
1089843524 11:121440083-121440105 ATACCCCAGGGTGGGCATGGTGG + Intergenic
1090829198 11:130409138-130409160 AAAGCCCAGCATGCGGCTGGAGG - Intronic
1091277327 11:134361409-134361431 AGGCGCCAGCGTGGGCCTCGCGG + Intronic
1091283512 11:134395599-134395621 GGAGCCCAGCCTGGGATTGGGGG + Intronic
1202811726 11_KI270721v1_random:29979-30001 GGATCCCAGCGGGGGCCTGTGGG + Intergenic
1091795241 12:3294301-3294323 AGGGCCCAATGTGGCCCTGGGGG - Intergenic
1091873776 12:3916973-3916995 TGGGACCAGAGTGGGCCTGGTGG - Intergenic
1094691986 12:32778317-32778339 ACAGCCCAAGGTGGGCGTGGTGG - Intergenic
1094814113 12:34166856-34166878 AGGGCCCAGCTCGGGCCTGCCGG - Intergenic
1095102784 12:38201643-38201665 AGGGCCCAGCTCGGGCCTGCCGG + Intergenic
1095954856 12:47800083-47800105 AGTGGCCAGCTTGGGCCTGGAGG - Intronic
1095986787 12:48004555-48004577 ACAGCCCAGCGGGGGGCAGGGGG - Intergenic
1096219597 12:49820785-49820807 AGAGCCCAGTGGGGGCTTGTGGG - Intronic
1096470504 12:51872457-51872479 AGAGGCCAGCGTGGGGGAGGAGG - Intergenic
1097055545 12:56247055-56247077 TGGGCACAGCGTGGGTCTGGTGG + Intronic
1097210728 12:57366972-57366994 AAAGCCCAGACTGGGCGTGGTGG - Intronic
1100390319 12:94141483-94141505 ACAGCCCAGCCTGGACCTGTGGG + Intergenic
1100600941 12:96110889-96110911 AGAGCCCAGCCTGGGAGAGGTGG - Intergenic
1101399129 12:104373002-104373024 AAAGCCCAGCCTGGCCCTGCTGG - Intergenic
1101860695 12:108480143-108480165 AGATCCCAGCCTGGCCCTGGAGG + Intergenic
1101967813 12:109293015-109293037 TGAGCCCTGCCTGGGCCTGCGGG - Intronic
1102203907 12:111077218-111077240 AGAGGCCAGCTTGGGCCTCGGGG - Intronic
1102594486 12:113982022-113982044 AGAGCCCTGGCTGGGCCTGGGGG + Intergenic
1102955047 12:117053783-117053805 AGAGCCCAGGGGGTGCCTGTGGG - Intronic
1103301788 12:119933279-119933301 AGATTCCAGGCTGGGCCTGGTGG + Intergenic
1103620652 12:122185181-122185203 AGAGCCCAGTCTCGGCATGGTGG + Intronic
1103746217 12:123126154-123126176 AGAGCCTAGGCTGGGCATGGTGG - Intronic
1104948817 12:132429533-132429555 AGAGCCCAGGGTGCTCCTGTGGG + Intergenic
1104962559 12:132495200-132495222 TGAGCCCCTAGTGGGCCTGGTGG + Intronic
1105432428 13:20349740-20349762 AGAGCCCACAGAGGGCCTCGGGG - Intergenic
1105828801 13:24145849-24145871 AGAGCACAGCTGGGGCTTGGAGG + Intronic
1106231624 13:27825367-27825389 AGAGGCCAGCGTGGGTATGTGGG - Intergenic
1106304084 13:28495005-28495027 AGCGGCCAGCGGGCGCCTGGCGG - Exonic
1106382818 13:29256462-29256484 TGAGCCCAGAGTGGGCAAGGAGG + Intronic
1106735968 13:32587324-32587346 AGAGCCCAGCACTGGCGTGGAGG + Intronic
1107133561 13:36920495-36920517 AGAGGGCAGCGCGGGGCTGGGGG - Intronic
1108470936 13:50766341-50766363 AGAGCCCAGCACGAGCCTGCAGG - Intronic
1108510206 13:51148798-51148820 CGGGCCCAGCTGGGGCCTGGCGG - Intergenic
1109957820 13:69591152-69591174 AGTGCCCAGCCTGGGCTGGGGGG + Intergenic
1110416642 13:75260756-75260778 GAAGCCCAGCCTGGGCATGGTGG + Intergenic
1112180139 13:97070152-97070174 AGAGCACAGTGAGGGGCTGGTGG - Intergenic
1113857545 13:113456255-113456277 AGAAGCCAGCGGGGGCCAGGCGG + Intronic
1113887976 13:113670893-113670915 GGTGCCCAGGGAGGGCCTGGTGG + Intronic
1113924157 13:113930936-113930958 AGGCCCCAGCCTGGCCCTGGAGG - Intergenic
1114155621 14:20099582-20099604 GGCGCACAGCGTGGGACTGGCGG + Intergenic
1114455002 14:22848540-22848562 GGAGCCCAGGGTGGGCTGGGTGG - Intronic
1116477728 14:45360939-45360961 AGAGCCCAGGCCGGGCATGGTGG - Intergenic
1118634353 14:67734114-67734136 AGATCCCAGGCTGGGCATGGGGG + Exonic
1119399075 14:74349564-74349586 AGAGCCCAGAATGAGGCTGGTGG + Intronic
1121013753 14:90536108-90536130 AGAGCTGACCGTGGGCCTGGTGG - Exonic
1121017700 14:90558388-90558410 AGCGCCCGGGGTGGGCTTGGTGG - Intronic
1121439353 14:93939104-93939126 GGAGCCCAGCGTGGTGCAGGTGG - Exonic
1121439578 14:93940228-93940250 AGAGCCCACCGTGTGCCAGGAGG + Intronic
1122456039 14:101852224-101852246 AGAGTGCAGGGTGAGCCTGGGGG - Intronic
1122788999 14:104176567-104176589 GGAGCCAAGTGTGGGGCTGGGGG - Exonic
1122818381 14:104326687-104326709 ATAACCCAGTGGGGGCCTGGTGG - Intergenic
1122859746 14:104577269-104577291 AGAGGCCAGCGTTGGCCCAGGGG - Intronic
1122861450 14:104584394-104584416 AAAGCCCAGGGTGGGGTTGGGGG - Intronic
1122961241 14:105094421-105094443 AGTGCCCAACCTGGGCCTGGGGG - Intergenic
1123783219 15:23646347-23646369 GGATCACAGCGGGGGCCTGGCGG + Exonic
1123948103 15:25248629-25248651 AGAGCCTACCCTGGGCATGGTGG - Intergenic
1124627727 15:31318582-31318604 AGAGCCCAGCCTGGAGCTGAGGG - Intergenic
1125685170 15:41559444-41559466 GGAGCCCGGGGCGGGCCTGGCGG + Intronic
1126853104 15:52810667-52810689 AAAGACCAGCCTGGGCCAGGTGG - Intergenic
1127531802 15:59850732-59850754 AGAGCCCAGTTGGGGGCTGGGGG - Intergenic
1128183281 15:65623667-65623689 AGAGCCCAGGGAGGACTTGGTGG + Intronic
1128198291 15:65780192-65780214 AGAGCACAGAATGGGCCTAGCGG - Intronic
1128501698 15:68231211-68231233 AGAGCCCAGGATGGGGCTGATGG - Intronic
1128978264 15:72168653-72168675 AGTCCCCAGCATGGGCCGGGGGG - Intronic
1129326013 15:74800650-74800672 AGGGGCCAGTGAGGGCCTGGAGG - Intronic
1129328751 15:74816155-74816177 AGACGCCATCCTGGGCCTGGAGG + Exonic
1129359933 15:75018387-75018409 AGAGGCCAGTGTGGGGCTGCGGG - Intronic
1129440594 15:75578651-75578673 AGAGGCCGGCGTAGGCCTCGGGG + Intronic
1129456373 15:75677959-75677981 AGAGCCCAGAGTGGGGCCTGAGG - Intronic
1130991568 15:88878935-88878957 ATAGCCAAGCGCGGGCCTGTGGG - Intronic
1131457635 15:92595862-92595884 AGAGTCCAGTGTGGGCCGAGCGG + Intergenic
1131650163 15:94389307-94389329 GGAGCTCAGGGTGGGCATGGAGG + Intronic
1132403569 15:101528733-101528755 ACAGCCCAGCCTGGGACTGTGGG - Intergenic
1132600744 16:771700-771722 AGAGCGCAGCGTGAGGATGGAGG + Intronic
1132645422 16:997276-997298 AGGGGCCAGTGTGGGACTGGGGG - Intergenic
1132675425 16:1119360-1119382 AGAGCCGCGCCGGGGCCTGGAGG - Intergenic
1132689068 16:1174463-1174485 AGAGTCCAGGCTGGGCCAGGTGG - Intronic
1132867380 16:2100187-2100209 GGAGGCCAACGGGGGCCTGGTGG - Exonic
1132953468 16:2578198-2578220 AGAGCGCAGGGAGGCCCTGGAGG + Intronic
1132960884 16:2621970-2621992 AGAGCGCAGGGAGGCCCTGGAGG - Intergenic
1132996586 16:2826825-2826847 ACAGCCCAGCTTCGGCCTGGTGG + Intergenic
1133015161 16:2936446-2936468 AGAGGCCAGCGGGGGGCGGGAGG - Intronic
1133390351 16:5405166-5405188 TGTGCCCAGGGTGGGCCAGGTGG + Intergenic
1134524397 16:14932928-14932950 GGAGGCCAACGGGGGCCTGGTGG + Intronic
1134548504 16:15128013-15128035 GGAGGCCAACGGGGGCCTGGTGG - Intronic
1134711985 16:16331415-16331437 GGAGGCCAACGGGGGCCTGGTGG + Intergenic
1134719843 16:16374708-16374730 GGAGGCCAACGGGGGCCTGGTGG + Intergenic
1134947583 16:18337177-18337199 GGAGGCCAACGGGGGCCTGGTGG - Intergenic
1134954843 16:18377279-18377301 GGAGGCCAACGGGGGCCTGGTGG - Intergenic
1135427077 16:22347456-22347478 AGAGCCCAGCCAGAGCCTGCTGG - Exonic
1136516860 16:30773655-30773677 AGAGTCCAGGCTGGGCCTGTGGG + Intronic
1138415897 16:56871169-56871191 ATGGCCCAGGGTGGGCATGGTGG + Intronic
1139473292 16:67189668-67189690 TGAGTCCATTGTGGGCCTGGAGG + Exonic
1139527174 16:67524290-67524312 AGAGTCCAGGCTGGGGCTGGAGG + Intronic
1140593108 16:76376595-76376617 AGAGCCCAGCGTTGGCCAAAGGG + Intronic
1141431506 16:83972539-83972561 AGGGCCTAGCGTGAGGCTGGCGG - Intronic
1142440334 16:90094099-90094121 AGGGCCCAGCCCGGGCCTGCCGG + Intergenic
1142481913 17:224263-224285 GGAGCCCAGTGTGGTCCTGGGGG - Intronic
1143172460 17:4938128-4938150 AGTGTGCAGCCTGGGCCTGGAGG - Intronic
1143892772 17:10115294-10115316 GGAGCCCCCCGTGGGACTGGCGG + Intronic
1144001065 17:11055638-11055660 AGAGTCCAGGCTGGGCATGGTGG + Intergenic
1144057898 17:11558339-11558361 AGAGCAGAGCGGGGGCCGGGAGG + Exonic
1144058759 17:11562873-11562895 AGAGCCTGGGGTGGGCCTGATGG + Exonic
1144849206 17:18235586-18235608 AGAGCCCATCCTGGGCCTGGTGG + Intronic
1144849278 17:18235846-18235868 AGAGCCCAGCGTGGGCCTGGCGG + Intronic
1145888348 17:28397862-28397884 ACAGCCAAGAGTGGGGCTGGGGG - Exonic
1145910372 17:28538761-28538783 TCAGCCCACCCTGGGCCTGGGGG + Exonic
1145977279 17:28991611-28991633 AGAGCCCAGGGTGGGGCTCCTGG + Intronic
1146257651 17:31400854-31400876 AGAGCCCAGGATGTGCCAGGCGG - Intronic
1146359848 17:32165051-32165073 AGGGCCGGGCGTGGGCGTGGTGG + Intronic
1146400407 17:32496610-32496632 AGGGACCAGCCTGGTCCTGGAGG - Intronic
1146934910 17:36807496-36807518 GGAGACCAGTGGGGGCCTGGAGG - Intergenic
1147146202 17:38485952-38485974 AGGTCCCAGGGAGGGCCTGGTGG + Intronic
1147594240 17:41706374-41706396 ACAGCCCAGCCTGGGCCCAGGGG + Intergenic
1147742322 17:42676306-42676328 AGCGCGCAGCGTGTGGCTGGAGG + Intronic
1147941491 17:44051460-44051482 GGAGCCTAGCTTGTGCCTGGGGG + Intronic
1147978539 17:44261310-44261332 ACAGCCCAGCCAGGGCCTGAGGG + Intronic
1148207415 17:45787847-45787869 TGAGCCCAGGGTGGGCCAGTGGG + Intronic
1148745717 17:49916861-49916883 AGAAGCCCACGTGGGCCTGGTGG - Intergenic
1151010073 17:70483963-70483985 TGAGCCCAGGGAGGGCCTGAAGG - Intergenic
1152011929 17:77724177-77724199 AGAGCCCAGCCTGAGTCAGGAGG + Intergenic
1152017549 17:77761535-77761557 AGAGCCCTGCATGGGCCTGGGGG + Intergenic
1152621875 17:81368896-81368918 GGTCCCCAGCATGGGCCTGGTGG + Intergenic
1152636096 17:81431081-81431103 GGATCCCAGCGTGGGGGTGGAGG + Intronic
1152688692 17:81707725-81707747 AGACCCCACAGTGGGCCTGGTGG + Intergenic
1152741479 17:82020310-82020332 AGAGCCCGGGTTGGGTCTGGAGG + Intronic
1152957224 18:49459-49481 AGGGCCCAGCCCGGGCCTGCCGG - Intronic
1154157659 18:11956485-11956507 AGAACCCAGCTTGGGGGTGGTGG + Intergenic
1155898515 18:31359458-31359480 AGAGCCCAGCCTTGACCAGGTGG + Intergenic
1156648690 18:39198808-39198830 GGAGCCCAGAGAGGGCCTGAGGG - Intergenic
1156886474 18:42141255-42141277 AGATCCCGGTGTGGGGCTGGGGG + Intergenic
1159548083 18:69866028-69866050 AGAGTCCAGTGAGGGCCTGCGGG + Intronic
1159962699 18:74567798-74567820 TGCTCCCAGCGTGGGCCTGCTGG + Intronic
1160231751 18:77054178-77054200 ATAGCTCAGCGAGGGCCAGGCGG - Intronic
1161378129 19:3950474-3950496 TGGGCCCAGCTAGGGCCTGGGGG + Intergenic
1161680695 19:5678373-5678395 GGAGCACAGGGTTGGCCTGGTGG - Intronic
1161845685 19:6710779-6710801 AGAGCCCGGCCAGGACCTGGTGG - Exonic
1162398351 19:10430770-10430792 GGCGGCCTGCGTGGGCCTGGCGG + Intronic
1162574271 19:11489792-11489814 ATACCACAGCGTGGGTCTGGGGG - Intronic
1162735600 19:12745382-12745404 TGACCCCAGCCTGGGCGTGGCGG + Exonic
1162922849 19:13913556-13913578 AGAGCCCAGGGTCACCCTGGAGG + Exonic
1163424686 19:17235063-17235085 GGAGCCCAGTGGGGGCCTGAGGG + Intronic
1163782699 19:19258637-19258659 GGAGCCCTGCGGCGGCCTGGGGG - Exonic
1164538945 19:29107881-29107903 TGAGCCCAGCTTGGTCGTGGAGG - Intergenic
1165314521 19:35046530-35046552 AGAGCTCAGGCTGGGCATGGTGG - Intronic
1166731432 19:45061126-45061148 AAAGCCCAGCCTGGGTCAGGAGG + Intronic
1166924969 19:46261000-46261022 AGGGCCCAGCGTGTGTCTGCAGG - Intergenic
1166939363 19:46353499-46353521 AGTGCCCAGCTTGGGGCTGGAGG + Intronic
1167309570 19:48729217-48729239 AAGGCCCAGCCAGGGCCTGGCGG + Exonic
1167486835 19:49767605-49767627 AGAGGCCAGAGGGGACCTGGAGG + Intronic
1167611101 19:50508058-50508080 AGAGCCCATCTGGGGCCTTGGGG - Intronic
1168115888 19:54221209-54221231 AGAGCCCAGCCTGGGGCTGCTGG + Exonic
1168118871 19:54240957-54240979 AGAGCCCAGCCTGGGGCTGCTGG + Exonic
1168121692 19:54255412-54255434 AGAGCCCAGCCTGGGGCTGCTGG + Exonic
1168125189 19:54278938-54278960 AGAGCCCAGCCTGGGGCTGCCGG + Exonic
1168129746 19:54310705-54310727 AGAGCCCAGCCTGGGGCTGCCGG + Intronic
1168133811 19:54337526-54337548 AGAGCCCAGCCTGGGGCTGCCGG + Exonic
1168166523 19:54552104-54552126 AGAGCCCAGCCTCGGGCTGCTGG - Intergenic
1168172065 19:54595787-54595809 AGAGCCCAGCCTGGGGCTGTGGG - Exonic
1168185597 19:54697797-54697819 AGAGCCCAGCCTGGGGCTGCTGG - Intronic
1168187573 19:54709703-54709725 AGAGCCCAGCCTGGGGCTGCCGG - Intergenic
1168254243 19:55157242-55157264 AGCGCCCACCCTGGCCCTGGGGG + Intronic
925169162 2:1740473-1740495 AGAGCCCCCAGAGGGCCTGGGGG + Intronic
926251551 2:11157860-11157882 AGAGCCCAGCAGAGCCCTGGAGG - Intronic
927712279 2:25333234-25333256 AGAGTCCACCATGGGCTTGGGGG + Intronic
927886011 2:26719324-26719346 ATAGACCTGCGTGGGACTGGTGG - Intronic
928549705 2:32358015-32358037 TGCGCCCAGCGTGGGGGTGGGGG + Intronic
930782286 2:55234400-55234422 TGAGACCAGCCTGGGCATGGTGG - Intronic
931076931 2:58725649-58725671 AGAGGCCAGGCTGGGCATGGTGG + Intergenic
932115373 2:69041937-69041959 ACAGCCCAGCCTCTGCCTGGTGG - Intronic
932435157 2:71699066-71699088 TGTGCCCAGCCTGGGGCTGGAGG - Intergenic
932583615 2:73008550-73008572 AGGGCCCGGCTTGGCCCTGGTGG - Intronic
932587018 2:73036698-73036720 AGAGCGGAGCCTGGGCCAGGAGG + Intronic
933042547 2:77487522-77487544 CCAGCTCAGCGTGGGCCTGCAGG + Intronic
933739586 2:85522975-85522997 AGTGCCCAGGCTGGGCGTGGTGG - Intergenic
935571695 2:104669054-104669076 AGAGCCCAGCCTGGACCTTGTGG - Intergenic
936383914 2:112011995-112012017 AGAGCCCAGTGGGGGCATAGGGG + Intronic
936460922 2:112713359-112713381 AGCTTCCAGCGTGGGCGTGGCGG + Intergenic
937902667 2:127033735-127033757 AGAGGCCCGCGTGGATCTGGAGG + Intergenic
937982543 2:127623964-127623986 GGAGCCCAGCGTGGGCTGAGTGG - Intronic
940446741 2:153785783-153785805 AGCTCCCAGTGTGGGCGTGGGGG + Intergenic
946088576 2:217198882-217198904 AGAGACAAGTGGGGGCCTGGGGG - Intergenic
946179170 2:217939754-217939776 AGAGCCCAGACTAGCCCTGGAGG + Intronic
946434313 2:219641792-219641814 AGAGCCCAGCCCTGGGCTGGGGG + Exonic
946494366 2:220181068-220181090 AAAGCCCAGGCTGGGCATGGTGG + Intergenic
947318644 2:228893081-228893103 AGAGCTCAGGGTGGGTTTGGAGG - Intronic
947589120 2:231374947-231374969 ATAGCACAGCCTGGGGCTGGTGG + Intergenic
947716194 2:232339996-232340018 AGAGCCAGGGGTGGCCCTGGTGG + Intronic
947801028 2:232928486-232928508 GGTGCCCAGCGTGGGCAAGGCGG - Intronic
948465090 2:238148415-238148437 AGAGCCCAAGATGGGCCTCGAGG - Intronic
948695548 2:239731495-239731517 AGAGGGAAGCTTGGGCCTGGAGG + Intergenic
948886764 2:240888684-240888706 GGAGCACAGGGTGGGCCGGGTGG - Intronic
948894678 2:240922589-240922611 GGAGCACAGCGTGGATCTGGAGG + Exonic
1169122113 20:3102933-3102955 GGAGGCCTGCGTGGTCCTGGTGG - Intergenic
1169142149 20:3232785-3232807 GGAGCCCAGTGTCGGGCTGGGGG + Intronic
1171767984 20:29300668-29300690 GGCGCCCCGCGTGGGCCTGGTGG - Intergenic
1172021657 20:31918984-31919006 AGAGCCTCGGGTGGGCCAGGTGG + Intronic
1172426679 20:34860312-34860334 AGAGCCCAGGCTGGGCAAGGCGG + Exonic
1172592426 20:36127228-36127250 AGAGCCCTGTCTGGGTCTGGCGG + Intronic
1172847453 20:37938393-37938415 AGGGCCCAGCCTGGGGCAGGAGG + Intronic
1172966062 20:38836123-38836145 CGAGGCCAGCGTGGCCCTGCTGG + Exonic
1173221014 20:41133280-41133302 AGAGCCTAGCCTGGGCCAGATGG - Intergenic
1174320597 20:49738970-49738992 ACAGCCCCCAGTGGGCCTGGAGG - Intergenic
1175754914 20:61523300-61523322 AGAGACCAGCGTGGGCCCGCTGG - Intronic
1175866815 20:62183076-62183098 AGCGGGGAGCGTGGGCCTGGGGG + Intronic
1175944013 20:62550466-62550488 AGAGGCCAGAGCGGGCGTGGGGG - Exonic
1176070416 20:63223344-63223366 AGGGAACAGCGTGGCCCTGGGGG - Intergenic
1176194696 20:63831614-63831636 AGGGCGCAGCGGGGGCCAGGGGG - Intergenic
1176205969 20:63888383-63888405 AGAGCCCAGGGTGTCCCTGTAGG + Intronic
1176205988 20:63888466-63888488 AGAGCCCAGGGTGTCCCTGTAGG + Intronic
1176206027 20:63888632-63888654 AGAGCCCAGGGTGTCCCTGTAGG + Intronic
1176861303 21:14012862-14012884 TGAGGCCAGGGAGGGCCTGGTGG + Intergenic
1178557042 21:33601222-33601244 AGAGCACAGGCTGGGCGTGGTGG - Intronic
1178966731 21:37127140-37127162 AGACCCCAGGCTGGGCGTGGTGG - Intronic
1179569869 21:42272406-42272428 TGACCCCAGCCTGTGCCTGGAGG + Intronic
1179903274 21:44406073-44406095 GCAGCCCAGGGTGGGCCTCGGGG + Intronic
1180089999 21:45529102-45529124 AGAGCCCAGTGTGGGCCTCGGGG + Intronic
1180617963 22:17141024-17141046 AGCTCCCAGCCTTGGCCTGGTGG - Intronic
1180875746 22:19174545-19174567 AGAGCCAAGCATGGGCTTGGGGG - Intergenic
1181002274 22:19993479-19993501 AGAGCCCAGGAGGGCCCTGGGGG + Intronic
1181602540 22:23960954-23960976 AGAGCAGGGCGGGGGCCTGGGGG + Intronic
1181605974 22:23980353-23980375 AGAGCAGGGCGGGGGCCTGGGGG - Intronic
1182115561 22:27754406-27754428 TGAGCCCAGGGTGGCCCTGCTGG - Intronic
1183195222 22:36349059-36349081 AGAGGCCATCGTGGAGCTGGTGG - Exonic
1183378912 22:37480842-37480864 AGAGTCCATCTGGGGCCTGGTGG - Intronic
1183731600 22:39621624-39621646 AGGGCACAGAGGGGGCCTGGGGG + Intronic
1183780961 22:39998555-39998577 ACAGCCCAGCAGGGGCCTTGTGG + Intronic
1184258948 22:43303438-43303460 AGGCCCCGGGGTGGGCCTGGTGG + Intronic
1184468456 22:44682461-44682483 AGAGGCCAGCGGGGACATGGTGG - Intronic
1184499939 22:44865527-44865549 AGACCGCAGCGTGGGACTTGCGG - Intergenic
1184664723 22:45982204-45982226 TGAGTCCACCATGGGCCTGGCGG - Intergenic
1184992451 22:48180133-48180155 AGTGCCCAGGGTGGGGGTGGTGG + Intergenic
1185011815 22:48318811-48318833 AGAGCCTGGCGTGGGGCTGCTGG - Intergenic
1185038153 22:48490172-48490194 GGAGCCCAGCCTGGGCTCGGAGG + Intronic
1185075699 22:48680928-48680950 GGAGCGCAGGTTGGGCCTGGGGG - Intronic
1185125222 22:49006832-49006854 AGAGGCCAGCGAGTGTCTGGAGG - Intergenic
1185172883 22:49303903-49303925 TGGGGCCAGCCTGGGCCTGGCGG - Intergenic
1185214042 22:49588279-49588301 AGGGTCCAGGGTGGGGCTGGGGG - Intronic
949537154 3:5004940-5004962 AGAGCCCAGGCTGGCCATGGAGG + Intergenic
950443911 3:13025247-13025269 AGAGCCCGGCTTTGGCCTTGTGG - Intronic
950510851 3:13425676-13425698 AGAGCCCAGGGTCGGGGTGGGGG - Intergenic
950667014 3:14503751-14503773 AGGGCCCAGCGTTGGGCTCGAGG + Intronic
950672039 3:14532963-14532985 AGAGCCCAGCCCTGGTCTGGCGG - Intronic
953787571 3:45922465-45922487 AGAGCAGAGCTTGGGCCTGGTGG + Intronic
953877717 3:46675925-46675947 ACAGCCCAGCCTGGGACTGCAGG + Intronic
954362819 3:50131267-50131289 AGATTCCAGCGGGGGCGTGGTGG - Intergenic
954661074 3:52227221-52227243 ACCACCCAGAGTGGGCCTGGGGG - Intergenic
955732352 3:62000007-62000029 TGTGCCCAGCCCGGGCCTGGGGG - Intronic
956575556 3:70748777-70748799 GGAGCCCAGCAGGGTCCTGGTGG + Intergenic
956740553 3:72272421-72272443 AGATCACAGCATGAGCCTGGTGG + Intergenic
957193562 3:77039934-77039956 AGAGCCCAGCCCGGGCGCGGCGG - Intronic
959252500 3:103966050-103966072 ACAGCTCAGTGTGGGCCTGCAGG + Intergenic
960534627 3:118802627-118802649 AGTGCCCTGCTTGCGCCTGGAGG + Intergenic
961445653 3:126980110-126980132 GGAGCCCAGAGTGGGGATGGAGG + Intergenic
961541060 3:127599591-127599613 AGAGCCCATTGTGTGCCTGGTGG + Intronic
961627754 3:128275508-128275530 AGAGCCCAAGCTGGCCCTGGGGG + Intronic
961716533 3:128861415-128861437 AGAGCCCAGTGTGGGCCAAGTGG - Intergenic
961756090 3:129128187-129128209 AGCACCCAGCTTGGGCCTGCAGG - Intronic
966751198 3:183323705-183323727 AGAGGACTGCTTGGGCCTGGAGG + Intronic
968624663 4:1621725-1621747 AGACCCCAGCCTGGGTCTGCAGG + Intronic
971695918 4:29902688-29902710 AGACCCCAGGCTGGGCCTGGTGG + Intergenic
973160066 4:47005021-47005043 AAAGCCAAGAGTGGGCCTAGGGG + Intronic
974420112 4:61662556-61662578 GTAGCTCAGCGTGGGCCTGCAGG + Intronic
975763052 4:77636450-77636472 AGTGCCCAGCTTGTACCTGGAGG + Intergenic
976846578 4:89495428-89495450 AGAATCCAACGTGGGCCTGAAGG - Intergenic
977975921 4:103267128-103267150 GGACCCCAGGCTGGGCCTGGTGG + Intergenic
978445063 4:108772526-108772548 AGAGCCCAAGGTGAGGCTGGAGG - Intergenic
978761631 4:112359647-112359669 AGAGGCCAGCAGGGGCCTTGGGG + Intronic
983465754 4:168087486-168087508 AGTGCTCAGGGTGGGCTTGGTGG - Intergenic
983544134 4:168944324-168944346 TTAGCCAGGCGTGGGCCTGGTGG + Intronic
985441498 4:189984773-189984795 AGGGCCCAGCCCGGGCCTGCCGG - Intergenic
985707776 5:1411380-1411402 AGAGCACAGCGTGGGCTCTGTGG - Intronic
985781317 5:1873403-1873425 AAAGCCCAGAGCGGGTCTGGCGG + Intergenic
985869428 5:2542556-2542578 AGAACCCAGGGTGGGTATGGGGG - Intergenic
985875599 5:2591616-2591638 AGGACCCAGGCTGGGCCTGGGGG + Intergenic
985884872 5:2670053-2670075 GGAGCCCAGCGTGGTCCCGCAGG - Intergenic
991541454 5:67734115-67734137 AGAGACCAGCTTGAGCCTAGAGG + Intergenic
991557757 5:67914677-67914699 AGATCCCAGCTTGTGCCAGGTGG - Intergenic
992663786 5:78985767-78985789 AGAGCCCAGCCTGTGGCAGGTGG + Exonic
995442213 5:112204515-112204537 AGAGCCCAGAGAGTTCCTGGGGG + Intronic
996478631 5:123949164-123949186 GGCGCACAGCGTGGGACTGGCGG - Intergenic
997468549 5:134104027-134104049 AGGGCTCAGGGTGGGCCGGGTGG - Intergenic
997586800 5:135048277-135048299 AGAGCCCAGAGTGATCATGGGGG + Intronic
997612844 5:135227309-135227331 AGAACCCAGCGTGGTCAAGGGGG - Intronic
998488813 5:142528071-142528093 AGAGCCCAGGGTGGACCTTCTGG - Intergenic
999243953 5:150143598-150143620 GCAGCACAGCCTGGGCCTGGCGG + Intronic
999435300 5:151559072-151559094 AGAGCCCAGAGTTTCCCTGGGGG + Intronic
1001980534 5:176034846-176034868 GGAGGCCAGCTTGGGCCAGGAGG - Intergenic
1002236927 5:177809219-177809241 GGAGGCCAGCTTGGGCCAGGAGG + Intergenic
1002381187 5:178831309-178831331 GGAGGCCAGCTTGGGCCAGGAGG - Intergenic
1002453440 5:179332254-179332276 AGTGCCCAGAGAGGGCGTGGAGG - Intronic
1002453984 5:179335862-179335884 AGTGCCCAGAGAGGGCGTGGAGG - Intronic
1002565771 5:180112448-180112470 ATAGCCCAGAGAGGGGCTGGGGG - Intronic
1003080040 6:3014433-3014455 AGAGCTCAGCGTGGCTCTGCTGG - Intronic
1003310055 6:4962724-4962746 AAAGCCCAGGCTGGGCGTGGTGG - Intergenic
1004003134 6:11614143-11614165 TGGGCCCAGCATGGGCTTGGGGG + Intergenic
1005586320 6:27279812-27279834 GGAGCCCAGCCTGCACCTGGAGG + Intergenic
1006133007 6:31879925-31879947 AGATCCCAGCCAGGCCCTGGAGG - Exonic
1006499814 6:34450948-34450970 AGAGCCCAGCCTGGACTGGGTGG + Intergenic
1006692573 6:35902193-35902215 TGAGCCCAGCCTGGGCCAGATGG + Intronic
1007181474 6:39932187-39932209 AGAGCCCTGTGTGGGCGTGTTGG + Intronic
1007298218 6:40845069-40845091 ACAGCCCAGCCTGGGCTTGGAGG + Intergenic
1007815035 6:44515955-44515977 AGATCCCAGGTTGGGCATGGTGG + Intergenic
1011109589 6:83822181-83822203 AGAGCTCAGAGTGGGCCTATGGG + Intergenic
1011413447 6:87090931-87090953 AGAGCCCAGGCTGGTCATGGTGG - Intronic
1011895663 6:92221678-92221700 AGAGCTCAACGTTGGCATGGTGG - Intergenic
1017406780 6:154127876-154127898 AGAGCACTGGGTGAGCCTGGGGG - Intronic
1017865123 6:158436192-158436214 AGAGTCCAGGCTGGGCATGGTGG - Intronic
1018840469 6:167512971-167512993 AGAGCCAAGCGTGGGCTCAGTGG - Intergenic
1019152730 6:170019595-170019617 AGAGCCCGCCCTGGGCGTGGGGG - Intergenic
1019316684 7:390245-390267 ACAGCCCTGCGTGTGCCCGGAGG - Intergenic
1019599192 7:1873105-1873127 GGAGCCCCCCGTGGGGCTGGTGG + Intronic
1019907315 7:4074571-4074593 AGGGCCCAGGCTGGGCGTGGTGG + Intronic
1020140666 7:5609758-5609780 AGAGGCCACTGTGGCCCTGGAGG - Intergenic
1020187585 7:5970718-5970740 AGAGCACAGGGTGGGCCTGGCGG - Intergenic
1020295332 7:6754052-6754074 AGAGCACAGGGTGGGCCTGGCGG + Intergenic
1024053700 7:45646191-45646213 AGAGCTGACTGTGGGCCTGGAGG + Intronic
1024993717 7:55255174-55255196 AGCGCCGAAGGTGGGCCTGGAGG - Intronic
1025995189 7:66523378-66523400 GGAGCCCAGGCTGGGCATGGTGG - Intergenic
1026078661 7:67197611-67197633 AGAGCTCAGACTGGGCATGGTGG - Intronic
1026737732 7:72959848-72959870 AGAGCTCAGCCAGGGTCTGGTGG - Exonic
1026788767 7:73318649-73318671 AGAGCTCAGCCAGGGTCTGGTGG - Intronic
1026972992 7:74479265-74479287 AGAGACCAGCGTGGCCATTGGGG - Intronic
1026984587 7:74546826-74546848 TGGACCCAGCGTGGGCCTTGGGG + Intronic
1027106002 7:75405220-75405242 AGAGCTCAGCCAGGGTCTGGTGG + Exonic
1027623267 7:80518804-80518826 ATCGCCCAGGCTGGGCCTGGTGG - Intronic
1028830290 7:95320372-95320394 GGAGCCCAGGGTGGGCAAGGGGG + Intronic
1029282888 7:99448066-99448088 AGAGGCCACCCTGAGCCTGGGGG - Intronic
1030298713 7:107954368-107954390 AGAGACCAGCGTGGGCAAGATGG - Intronic
1030318986 7:108144883-108144905 AGAGCCCAGCCTGGTCAAGGTGG - Intergenic
1031977444 7:128103071-128103093 CAAGCCCTGCCTGGGCCTGGTGG - Intergenic
1031978110 7:128106589-128106611 AGATCCCAGGGTGGGGGTGGGGG - Intergenic
1032860831 7:135877800-135877822 AGCACCCAGCCTGTGCCTGGAGG + Intergenic
1034221680 7:149451261-149451283 AGAGCCCACTGTGGGTGTGGGGG + Intronic
1034415629 7:150963024-150963046 GGAGCAGAGCGAGGGCCTGGGGG - Intronic
1034900916 7:154907286-154907308 GGCGCCCTGCGTGGGACTGGCGG + Intergenic
1035026782 7:155831462-155831484 AGACCCCGGCCTGGGCCAGGAGG + Intergenic
1035034138 7:155884372-155884394 CGAGCACAGCGCGGGGCTGGGGG - Intergenic
1035034435 7:155885790-155885812 ATAGCCCAGCGTGTGCCGAGAGG - Intergenic
1035225703 7:157430992-157431014 AGAGCCCGGGGTGGGCTTGTGGG + Intergenic
1036161321 8:6391084-6391106 GGGGCCCAGCGGGGGCCTGCAGG + Intergenic
1036656205 8:10679034-10679056 AGGGCTCAGCCTGGGCCTGGAGG - Intronic
1036740403 8:11356154-11356176 AGAGCCCAGCCTGTGGCTGTTGG + Intergenic
1038439262 8:27560252-27560274 AGAGACCAGTGTAGGCCGGGAGG - Intergenic
1038440072 8:27565446-27565468 TGAGCCCAGCCTGGGCATAGTGG + Intergenic
1039854219 8:41398540-41398562 AGAGACCAGCGGGAGGCTGGAGG + Intergenic
1040897845 8:52387958-52387980 AGTGCCCGGCGTGGGGCGGGGGG - Intronic
1044556452 8:93567632-93567654 AAAGCCCGGAGTGGGCATGGTGG + Intergenic
1048286724 8:133147379-133147401 GGAGCCATGCCTGGGCCTGGAGG - Intergenic
1048720009 8:137312745-137312767 AGAGGACAGAGTGGGGCTGGAGG - Intergenic
1048865847 8:138760946-138760968 AGACCCCAGGGAGGGCCTGGAGG + Intronic
1049214248 8:141400560-141400582 AGAGCCCATCATGGGGGTGGGGG - Intronic
1049221482 8:141430672-141430694 GGAGCCCAGAGTCAGCCTGGAGG + Intronic
1049318264 8:141981194-141981216 AGAGCTCAGTGCGGGGCTGGAGG + Intergenic
1049337040 8:142092137-142092159 AGAGCCTAGCCTGGGCTAGGAGG - Intergenic
1049371053 8:142267566-142267588 AGAGCCCAGGGTGGTATTGGAGG - Intronic
1049531456 8:143157667-143157689 AGATCACAGGGTGGGCTTGGGGG - Intergenic
1049622397 8:143604615-143604637 TGGGGCCAGCGTGGGACTGGAGG + Exonic
1049779635 8:144423033-144423055 AGAGTCAAGGCTGGGCCTGGTGG - Intergenic
1052575147 9:30281854-30281876 AGATAGCAGCATGGGCCTGGAGG + Intergenic
1056320353 9:85429620-85429642 ATGGCCCAGAGTGGACCTGGAGG + Intergenic
1057145911 9:92759550-92759572 AGAGCCCAGCTTGGGACAGCAGG + Intronic
1057721048 9:97532225-97532247 AGAGCCGAGGATGGGCCTGGTGG + Intronic
1057911907 9:99026003-99026025 AGAGAGTAGTGTGGGCCTGGTGG - Intronic
1058958127 9:109968213-109968235 AGAGGCCACCATGGCCCTGGGGG + Intronic
1059284395 9:113160274-113160296 CAAGCCCAGGGAGGGCCTGGAGG - Intronic
1060157152 9:121327684-121327706 AGAGCCTAGCCTGGGCGTGGTGG + Intronic
1060396285 9:123319116-123319138 GGAGGGCAGCCTGGGCCTGGAGG + Intergenic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1060829813 9:126706249-126706271 AGACCCCCTCGTGTGCCTGGAGG - Intergenic
1060896137 9:127218807-127218829 GGAACCCAGGCTGGGCCTGGTGG + Exonic
1061575401 9:131503098-131503120 AGAGCCCAGCCCGGACTTGGGGG + Intronic
1061888718 9:133606446-133606468 AGAGGCCAGGGTGGGGCTGGGGG - Intergenic
1061902622 9:133680753-133680775 AGTGGCCAGTGTGGGCCTGGCGG - Intronic
1061902632 9:133680796-133680818 AGTGGCCAGTGTGGGCCTGGCGG - Intronic
1062192096 9:135253355-135253377 AGAGCCAGGCCTGGGCCTGTGGG + Intergenic
1062342575 9:136100326-136100348 AGGGCCCAGGGTGAGGCTGGTGG - Intergenic
1062473076 9:136714709-136714731 GGAGACCAACCTGGGCCTGGAGG + Intronic
1062569528 9:137178757-137178779 AGAGCCAAGCTGAGGCCTGGAGG + Intronic
1062720332 9:138038631-138038653 AGAGCCCAGAGTGTCCCTGTGGG + Intronic
1062740925 9:138175120-138175142 AGGGCCCAGCCCGGGCCTGCCGG + Intergenic
1203361322 Un_KI270442v1:220838-220860 GGTGCCCCGCATGGGCCTGGTGG - Intergenic
1185689387 X:2140689-2140711 AGAGCCCAGTGGGGGCCCAGTGG + Intergenic
1188226198 X:27601136-27601158 AGAGCCCAGCCTGGGCAACGTGG - Intronic
1190336593 X:49266457-49266479 AAAGCCCAGAATGGGCCTGATGG + Intergenic
1191856586 X:65631972-65631994 ATAGCCCAGGCTGGGCATGGTGG - Intronic
1195088227 X:101433836-101433858 AGAGACCATGGTGGGCCTGTGGG + Intronic
1195269931 X:103219574-103219596 AGACCCCAGACTGGGCGTGGTGG + Intergenic
1196098477 X:111824552-111824574 AGAGCTCAGTTTGGGCCTAGAGG + Intronic
1198640138 X:138747253-138747275 AGAGAGCAGGGTAGGCCTGGAGG + Intronic
1199540404 X:148952315-148952337 AGAGCCCAGTATGGTCCTGGAGG - Intronic
1200056226 X:153462773-153462795 GGAGACCAGGGTGGGCCAGGAGG + Intronic
1200065185 X:153501413-153501435 AGAGCTCAGGCGGGGCCTGGAGG + Intronic
1200206176 X:154317888-154317910 GGAGCTCTGTGTGGGCCTGGGGG + Intronic
1200235931 X:154467716-154467738 GCAGCCCAGGGTGGGCGTGGTGG + Intronic
1201077126 Y:10196722-10196744 GGCGCCCCGCGTGGGCCTGGTGG + Intergenic
1201575214 Y:15455730-15455752 AAAGCCCAGCGCGGGCCCGGTGG + Intergenic