ID: 1144849541

View in Genome Browser
Species Human (GRCh38)
Location 17:18237060-18237082
Sequence GCTCTGGGTGGGGCTGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1111
Summary {0: 1, 1: 0, 2: 10, 3: 115, 4: 985}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144849532_1144849541 -7 Left 1144849532 17:18237044-18237066 CCAAGGTGGGAATAGGGCTCTGG 0: 1
1: 0
2: 1
3: 12
4: 181
Right 1144849541 17:18237060-18237082 GCTCTGGGTGGGGCTGGCTGGGG 0: 1
1: 0
2: 10
3: 115
4: 985

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144849541 Original CRISPR GCTCTGGGTGGGGCTGGCTG GGG Intronic