ID: 1144849541

View in Genome Browser
Species Human (GRCh38)
Location 17:18237060-18237082
Sequence GCTCTGGGTGGGGCTGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1111
Summary {0: 1, 1: 0, 2: 10, 3: 115, 4: 985}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144849532_1144849541 -7 Left 1144849532 17:18237044-18237066 CCAAGGTGGGAATAGGGCTCTGG 0: 1
1: 0
2: 1
3: 12
4: 181
Right 1144849541 17:18237060-18237082 GCTCTGGGTGGGGCTGGCTGGGG 0: 1
1: 0
2: 10
3: 115
4: 985

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144849541 Original CRISPR GCTCTGGGTGGGGCTGGCTG GGG Intronic
900203310 1:1420742-1420764 TCTCTGGGTGGGGCAGGATGGGG - Intronic
900313576 1:2046409-2046431 CGTCTGGGAGGGGTTGGCTGTGG - Intergenic
900318445 1:2070728-2070750 GGCCAGGGTGGGGCTGGCGGGGG + Intronic
900416229 1:2535970-2535992 CCACTGAGGGGGGCTGGCTGTGG - Intergenic
900545758 1:3228334-3228356 TCTGGGGGTGGGGCTGCCTGGGG - Intronic
900579679 1:3402891-3402913 GCTCTACGAGGGCCTGGCTGAGG + Exonic
900653538 1:3743279-3743301 GCTATGGGCTGGGCTGGCTGAGG - Intergenic
900827944 1:4941534-4941556 GCCAGGGGTGGGGCGGGCTGCGG - Intergenic
901045522 1:6393494-6393516 GCTCGGGGTGGGGCCGGCGCGGG - Intronic
901052782 1:6433823-6433845 GCTCAGGGTTGGCCTTGCTGAGG - Intronic
901264740 1:7902098-7902120 GCTCTGGGTAGGGAGGACTGCGG + Intergenic
901502038 1:9658418-9658440 GGTGAGGGTGGGGCTGGGTGAGG + Intronic
901573375 1:10180067-10180089 GCTCTGGGTGGGCCTGGGGTTGG - Exonic
901664476 1:10818654-10818676 GCTCTGGCTGGGGGTGACTGCGG + Intergenic
901757896 1:11452357-11452379 GCTCAGGGAGGAGCTGGCTTCGG + Intergenic
901794313 1:11671768-11671790 GCACTGGCTGGGGCTGACTCTGG - Intronic
902157393 1:14499470-14499492 TTTCTGGGAGGAGCTGGCTGTGG + Intergenic
902270670 1:15302199-15302221 TCTCTGGCTGGGGCTGGATTTGG - Intronic
902398347 1:16144364-16144386 ACTCTGGGAGCTGCTGGCTGTGG - Intronic
902399437 1:16150093-16150115 GCTCTGGGCAGGCTTGGCTGGGG - Intronic
902478051 1:16698374-16698396 GTGCTGGGTGGGGGTGTCTGGGG + Intergenic
902481457 1:16714225-16714247 GCTCAGGGTTGGCCTTGCTGAGG + Intergenic
902649846 1:17829897-17829919 GGGCTGGGTGGGGCTGGCAGAGG + Intergenic
902976259 1:20090697-20090719 GGTCTGGGAGGAGCTCGCTGGGG - Exonic
903058230 1:20651722-20651744 GCTGTGGGTGGGGGTTGCTGTGG - Intergenic
903059057 1:20656875-20656897 GCACTGGGTGGGGCTATTTGAGG + Intronic
903183609 1:21617653-21617675 GCGCTGTCTGGGTCTGGCTGAGG - Intronic
903424774 1:23245585-23245607 GCGGTGGGTTGGGCTGGGTGAGG + Intergenic
903670171 1:25030879-25030901 GGCCAGGGTGGGGCTGGGTGGGG - Intergenic
903694290 1:25195957-25195979 TCTCTGGTTGGGGGTGGCTGGGG - Intergenic
904262999 1:29301165-29301187 GCTCTGGGTGAGGCTGTGAGGGG - Intronic
904302272 1:29561928-29561950 GCCCTGGGTGGAGCTGGCACAGG + Intergenic
904338127 1:29810997-29811019 GCTGTGGGTGGGGCTGGCTTTGG + Intergenic
904401148 1:30257580-30257602 GCCCTGGGTGGAGCTGGCACAGG - Intergenic
905127725 1:35727291-35727313 GCTCCCTGTGGGGTTGGCTGAGG - Intronic
905276157 1:36819522-36819544 ACTCTGGCTGGAGCTGGCTCAGG - Intronic
905548407 1:38817805-38817827 GTTCTGGGTGGAGGTCGCTGGGG + Intergenic
905630659 1:39516391-39516413 GCTCTGGGAGGGCCTGACGGTGG + Intronic
905667102 1:39769779-39769801 GCTCTGGGAGGGCCTGACGGTGG - Exonic
905738101 1:40344781-40344803 GCTCAGGGTGGGGGCGGCAGAGG + Intergenic
905797185 1:40822412-40822434 GCTGGGGGTGGGGGTGGGTGGGG + Intronic
905803058 1:40857971-40857993 GCTCCCAGCGGGGCTGGCTGAGG + Intergenic
905824632 1:41018766-41018788 GGTCAGGGAGGGGCTCGCTGGGG - Intronic
905865158 1:41372465-41372487 GCTCAGGGCAGGGCTGGGTGAGG + Intronic
906608945 1:47189140-47189162 GCTCGGGGTGGGGGTGGGAGGGG + Intronic
906675229 1:47688423-47688445 GCCCGGGGTGGGGTTGCCTGTGG - Intergenic
907241142 1:53081767-53081789 GCTTGTGGTGGGGCTGGCTCTGG - Intronic
907291593 1:53417093-53417115 GCTCGGGGTGGGGGTGGCAGGGG - Intergenic
907310677 1:53537269-53537291 GCTCTGAGTGTGGCTTGCTGAGG - Intronic
907498202 1:54859299-54859321 GATCTGGGTGGTCCTGGCTCAGG - Intronic
907576896 1:55534726-55534748 GCCCTGGGTGATGCTGGGTGTGG - Intergenic
907674773 1:56508309-56508331 GCTCTGTGTCAGGCTGTCTGGGG + Intronic
908740041 1:67318014-67318036 GGTCAGGGAGGGGCTGTCTGGGG + Intronic
909014738 1:70369778-70369800 GCTCTGGGAGTGGCTGCCAGGGG - Intronic
910094885 1:83510478-83510500 GATCTGGGCTGGGCTGGCTCAGG - Intergenic
910579371 1:88805934-88805956 GCTCGTGGTGGGGCTGGAGGAGG - Exonic
911265884 1:95742821-95742843 TCCTTGGGTGGGGCTTGCTGTGG + Intergenic
912462745 1:109847490-109847512 GAGCTGGGTGAGGCTGCCTGTGG - Intergenic
912551840 1:110489895-110489917 GCTCTGGCTGGGCCTAGATGGGG + Intergenic
912703068 1:111893065-111893087 GCTCTGGGCTGAGCTGGCTGAGG + Intronic
912705978 1:111913027-111913049 GCTCTGGGTGAGGCTGTGTGAGG - Intronic
913330110 1:117660005-117660027 GCTTTGGAAGGGGCTGGCTGAGG - Intergenic
913409081 1:118531176-118531198 GCTCTGGGGTGGCCTGCCTGGGG + Intergenic
914824421 1:151131413-151131435 GCTCCGGTTGGGACTGGCTGCGG - Intergenic
915142474 1:153776043-153776065 GCTCTGGTTCGGGCTGGCCAAGG + Exonic
915286644 1:154857477-154857499 GCTCTGGGGGAGGCTGGCAGGGG + Intronic
915348956 1:155212845-155212867 GCTGGGGCTGGGGCTGGCTCAGG + Intronic
915352143 1:155233471-155233493 GCTGGGGCTGGGGCTGGCTCAGG + Intergenic
915930757 1:160059525-160059547 GCTGTGGCTGTGGTTGGCTGGGG - Intronic
915948768 1:160173761-160173783 CATCTGGGTGGGGCAGGCTGGGG - Intronic
916170431 1:161997859-161997881 GCTCAGCGTGGGGCTGGCAGGGG + Exonic
916574265 1:166053052-166053074 AGGCTGGGTGGGGATGGCTGAGG + Intergenic
917967504 1:180187754-180187776 CCTCGGGGTAGGGCTGGCAGTGG + Intronic
918171761 1:182004192-182004214 TCCTTGGGTGGGGCTTGCTGTGG - Intergenic
918423544 1:184386942-184386964 GCTCGGGGAGGGGCCGGCGGTGG + Intergenic
919802693 1:201363093-201363115 GCACTAGGAGGGGCTTGCTGGGG - Intronic
919920267 1:202163104-202163126 GAGCTGGGAGGAGCTGGCTGGGG + Intergenic
920112580 1:203597769-203597791 TCTGTGTGTGGGGGTGGCTGTGG - Intergenic
920255557 1:204651943-204651965 GCCCTGGCAGGGGCCGGCTGGGG - Intronic
920431911 1:205924136-205924158 ACTCTTGCTGGGGATGGCTGGGG - Intronic
921159414 1:212462723-212462745 GCCCTGGGGGAGGCTTGCTGGGG - Intergenic
921313960 1:213873328-213873350 GCTGAAGGTGGGGGTGGCTGTGG - Intergenic
921384125 1:214552083-214552105 GCCCAGGGTTGGGGTGGCTGCGG - Intronic
921506396 1:215976422-215976444 GCTCTGTGTGATGTTGGCTGTGG + Intronic
921925012 1:220704076-220704098 GCTCCTGGTGGGGTGGGCTGAGG - Intergenic
922029776 1:221786684-221786706 GCTCTGCATGGTGCTAGCTGGGG - Intergenic
922071281 1:222196383-222196405 GCTCAGGGCAGGCCTGGCTGTGG - Intergenic
922307449 1:224356835-224356857 GCCCTTGCCGGGGCTGGCTGAGG - Exonic
922434212 1:225586946-225586968 GGTGGGGGTGGGGTTGGCTGGGG + Intronic
922621039 1:226988360-226988382 GCCCTGGCTGGGGCTGGCCTGGG - Intergenic
922769439 1:228174112-228174134 GCTGTGGGCGTGGCTCGCTGTGG + Intronic
922769442 1:228174128-228174150 GCTGTGGGCGTGGCTCGCTGTGG + Intronic
922769445 1:228174144-228174166 GCTGTGGGCGTGGCTCGCTGTGG + Intronic
922769448 1:228174160-228174182 GCTGTGGGCGTGGCTCGCTGTGG + Intronic
922769451 1:228174176-228174198 GCTGTGGGCGTGGCTCGCTGTGG + Intronic
922769454 1:228174192-228174214 GCTGTGGGCGTGGCTCGCTGTGG + Intronic
922769457 1:228174208-228174230 GCTGTGGGCGTGGCTCGCTGTGG + Intronic
922769460 1:228174224-228174246 GCTGTGGGCGTGGCTCGCTGTGG + Intronic
922769463 1:228174240-228174262 GCTGTGGGCGTGGCTCGCTGTGG + Intronic
922769466 1:228174256-228174278 GCTGTGGGCGTGGCTCGCTGTGG + Intronic
922769469 1:228174272-228174294 GCTGTGGGCGTGGCTCGCTGTGG + Intronic
922769472 1:228174288-228174310 GCTGTGGGCGTGGCTCGCTGTGG + Intronic
922769475 1:228174304-228174326 GCTGTGGGCGTGGCTCGCTGTGG + Intronic
922769478 1:228174320-228174342 GCTGTGGGCGTGGCTCGCTGTGG + Intronic
922769481 1:228174336-228174358 GCTGTGGGCGTGGCTCGCTGTGG + Intronic
922769484 1:228174352-228174374 GCTGTGGGCGTGGCTCGCTGTGG + Intronic
922769487 1:228174368-228174390 GCTGTGGGCGTGGCTCGCTGTGG + Intronic
922769490 1:228174384-228174406 GCTGTGGGCGTGGCTCGCTGTGG + Intronic
922769493 1:228174400-228174422 GCTGTGGGCGTGGCTCGCTGTGG + Intronic
922769496 1:228174416-228174438 GCTGTGGGCGTGGCTCGCTGTGG + Intronic
922769499 1:228174432-228174454 GCTGTGGGCGTGGCTCGCTGTGG + Intronic
922769502 1:228174448-228174470 GCTGTGGGCGTGGCTCGCTGTGG + Intronic
922769505 1:228174464-228174486 GCTGTGGGCGTGGCTCGCTGTGG + Intronic
922769508 1:228174480-228174502 GCTGTGGGCGTGGCTCGCTGTGG + Intronic
922798600 1:228353605-228353627 ATTCAGGGTAGGGCTGGCTGTGG + Intronic
923337959 1:232986242-232986264 GCTCAGGGTGGAGCTGGTGGAGG + Exonic
924299271 1:242620737-242620759 GCACTGGGAGGGGCTGACTTTGG + Intergenic
924561119 1:245156688-245156710 GCGCCGCGCGGGGCTGGCTGGGG + Intronic
1062801658 10:385579-385601 GCTCTGGCCGGGCCTTGCTGCGG + Intronic
1062831413 10:608359-608381 GCTGTGTGTGGGGGGGGCTGTGG - Intronic
1064146526 10:12830407-12830429 GCACTGGCTGGGCCTGGCGGAGG - Exonic
1065462353 10:25982230-25982252 TCCTTGGGTGGGGCTCGCTGTGG - Intronic
1065521669 10:26579687-26579709 GCCCTGCCTGGGGCTGGCTTTGG - Intergenic
1065522264 10:26584405-26584427 GCCCTGACTGGGGCTGGCTTTGG - Intergenic
1065527837 10:26640710-26640732 GCCCTGACTGGGGCTGGCTTTGG - Intergenic
1065528171 10:26643301-26643323 GCCCTGAGTGGGGCTGGCCTTGG - Intergenic
1065528743 10:26647963-26647985 GCCCTGACTGGGGCTGGCTTTGG - Intergenic
1065558481 10:26939584-26939606 GCCCTGACTGGGGCTGGCTTTGG + Intergenic
1065558707 10:26941414-26941436 GCCCTGACTGGGGCTGGCTTTGG + Intergenic
1065559062 10:26944231-26944253 GCCCTGCCTGGGGCTGGCTTTGG + Intergenic
1065559348 10:26946437-26946459 GCCCTGCCTGGGGCTGGCTTTGG + Intergenic
1065757992 10:28951878-28951900 GCTTCGGGTGGGGAAGGCTGAGG - Intergenic
1067060561 10:43076129-43076151 GTTCTGGGTGAGGTTGGATGTGG - Intergenic
1067132066 10:43574234-43574256 GCTCTGGCCTGGGCCGGCTGGGG - Intronic
1067145415 10:43690220-43690242 GCTCTGGGCTGGGCCGGCAGAGG + Intergenic
1067160272 10:43819561-43819583 GCCCTGAATGGGGCTGTCTGGGG + Intergenic
1067456644 10:46423819-46423841 TCTCTGGGTGGGGCTGCTTGGGG - Intergenic
1067630558 10:47960820-47960842 TCTCTGGGTGGGGCTGCTTGGGG + Intergenic
1067716891 10:48696997-48697019 GCTCTGGGTTGGCCTGGCCTTGG + Intronic
1068080624 10:52314164-52314186 GCGCTGGGAGGGGCTGGGAGGGG - Intergenic
1068121341 10:52784879-52784901 GTCCTGAGTGGGGCTGGATGAGG + Intergenic
1069592125 10:69648701-69648723 CCTCGGGGTGGGATTGGCTGAGG + Intergenic
1069613196 10:69789162-69789184 CCTCTGTGTGGGGAAGGCTGTGG + Intergenic
1069687501 10:70327815-70327837 GCTCTGGACACGGCTGGCTGGGG - Intronic
1069784822 10:70981279-70981301 GCTGTGGCTGGGGCTGTCTAGGG + Intergenic
1069854703 10:71433660-71433682 GCTGCAGGTGGAGCTGGCTGAGG - Intronic
1069923019 10:71828876-71828898 CCTTTGGCTGGGGCTTGCTGCGG + Exonic
1070148671 10:73792298-73792320 GCACTGGGTGGGGCTGGCAGTGG + Exonic
1070732204 10:78838276-78838298 GCTCTTGGTGGGGCATGCCGTGG + Intergenic
1070770155 10:79077483-79077505 GGTCTGGGTGGGGAGGGGTGGGG + Intronic
1071854054 10:89605213-89605235 GCTGAGGGTTGGGGTGGCTGTGG + Intronic
1071870556 10:89789661-89789683 TCCTTGGGTGGGGCTTGCTGTGG + Intergenic
1071932134 10:90484562-90484584 TCTTTGGTTGGGGCTTGCTGAGG + Intergenic
1073070080 10:100787742-100787764 GCACTGGCTGGGGTTGGGTGGGG + Intronic
1073100834 10:101005793-101005815 CCTCTGGGGGTGGCAGGCTGAGG - Intronic
1073106656 10:101036224-101036246 ATTCGGGGTGGGGCAGGCTGAGG - Intronic
1073291174 10:102414011-102414033 GCTCTGGGTTGGGCCAGGTGAGG + Exonic
1073301021 10:102471018-102471040 GCTCTGGGCTGGGCTTTCTGGGG + Exonic
1073583809 10:104690094-104690116 GCTCTGGGTCTGGCTCACTGAGG + Intronic
1074288295 10:112119169-112119191 GCTGGGGGTGGGGCTTGCTCAGG - Intergenic
1074419177 10:113294007-113294029 TCTCTGGCAGGGCCTGGCTGGGG - Intergenic
1074856720 10:117479403-117479425 CATCTGAGGGGGGCTGGCTGCGG - Intergenic
1075055047 10:119211819-119211841 GCTCTGCGTGGGGCAGGCTATGG + Intronic
1075583049 10:123636652-123636674 GATGTTGGTGGGGCTGGATGGGG + Intergenic
1075612958 10:123868121-123868143 GCCCAGGGTGGGGCTGACAGAGG - Intronic
1076013150 10:127006551-127006573 CCTCTGCGTGGGGCTGTGTGCGG + Intronic
1076149335 10:128150021-128150043 GCTGCAGGTGGGGCGGGCTGGGG - Intergenic
1076285133 10:129288165-129288187 GCTGTGGGTTGTGCTTGCTGGGG + Intergenic
1076734314 10:132451945-132451967 GTGCTGGGTGGGGCATGCTGGGG + Intergenic
1076826376 10:132971688-132971710 CCTCTCGGTGGGGCTGGGAGTGG + Intergenic
1076875208 10:133212581-133212603 GCTCTGGCTGGGCCAGTCTGAGG + Intronic
1076922201 10:133459882-133459904 CCTCAGGGTGCGGCTGGCCGCGG + Intergenic
1077111058 11:862420-862442 ACTCTGGGTGGTTCTGGCTCAGG + Intronic
1077140011 11:1020142-1020164 TGTCTGGGTGGGGCTGGCAGGGG + Exonic
1077173999 11:1180581-1180603 GCTTTGGGTGGGGCTGGGAGCGG + Intronic
1077191195 11:1256527-1256549 GCTCAGGGTGGGCGGGGCTGGGG - Intronic
1077222630 11:1424332-1424354 GCACTGGGTGGGTCTGAGTGTGG + Intronic
1077282979 11:1753952-1753974 GCTGGGGCTGGGGCTGGCAGGGG - Intronic
1077377661 11:2212793-2212815 GCTCTGCCTGGGGCTGGCCACGG + Intergenic
1077467483 11:2740457-2740479 CCTCTGGGTGGGGCTGCATCGGG - Intronic
1077470839 11:2759838-2759860 GCTCAGGGTGGGGCTGGGCCTGG - Intronic
1077578648 11:3403047-3403069 CCACTGGGTGGGGCAGCCTGGGG + Intergenic
1078524381 11:12089585-12089607 CCTGTGGGTAGGCCTGGCTGGGG - Intergenic
1078566480 11:12418555-12418577 GAACTGGGTGGGGGAGGCTGTGG - Intronic
1079004725 11:16783611-16783633 GCCCTGGGCCGGGCTGGCTGGGG - Intronic
1079102658 11:17551532-17551554 GGTTGGGGTGGGGGTGGCTGTGG + Intronic
1079103905 11:17558473-17558495 GTTCTGTGTGGGGCTGTGTGTGG + Intronic
1080744773 11:35098983-35099005 CCTCTGTCTGGGGCAGGCTGGGG - Intergenic
1081164100 11:39786606-39786628 GCTCTGTGTGGGGCCATCTGAGG - Intergenic
1081576663 11:44322919-44322941 GCTCAGGGTGGGGAGGGGTGGGG + Intergenic
1081580307 11:44347258-44347280 CCTCTGGGTGGGGCTGGTCCTGG + Intergenic
1081836487 11:46159856-46159878 TCTCTGGGTGGGGAAGGGTGGGG - Intergenic
1082027983 11:47586612-47586634 GAACAGGGAGGGGCTGGCTGTGG - Intergenic
1082789704 11:57338820-57338842 GCCCTAGGTGGGGGTGGCAGAGG - Intronic
1082810712 11:57477290-57477312 GTCCTGGGTGGGGCTCCCTGGGG - Exonic
1083132166 11:60634582-60634604 GCTCTGGGTGGTGCTTTCAGTGG - Intergenic
1083228481 11:61300012-61300034 GCTCTGGGGGCAGCTGGCTTAGG + Exonic
1083587230 11:63869213-63869235 GCCCAGGGTGGGGGTGGGTGGGG - Intronic
1083636205 11:64122359-64122381 GCTCTGGGTGACGCTGGCAGGGG + Intronic
1083708040 11:64530065-64530087 GCTGTGGGCTGGGCTGGCTAAGG - Intergenic
1083746829 11:64741644-64741666 GCTCTGGGAGGGGTTGGAGGTGG + Intronic
1083823019 11:65183081-65183103 TTTCTGGGAGGGGCTGGCCGAGG + Intronic
1083955805 11:65982234-65982256 GCCCTGCCTGGGGCTGGGTGGGG - Intergenic
1084022211 11:66424522-66424544 GCTCTGGGAAGGTTTGGCTGGGG - Exonic
1084112333 11:67022426-67022448 GCACTGGGAGGGGCTGGGTGCGG - Intronic
1084455239 11:69264532-69264554 TCCCTGGTTGGGCCTGGCTGAGG + Intergenic
1084479406 11:69410023-69410045 GAGCTGGGTGGGGCAGGATGTGG - Intergenic
1084594713 11:70110017-70110039 GAGCAGGGTGGGGCTAGCTGCGG + Intronic
1084689152 11:70715093-70715115 GTTATAGGTGGGGCTGGGTGTGG - Intronic
1084847899 11:71915068-71915090 GCTGAAGGTTGGGCTGGCTGTGG - Intronic
1085262881 11:75218374-75218396 GATCTGGTTGGCGCTGGTTGGGG + Intergenic
1085310198 11:75511711-75511733 GCTATTGGTGGTGGTGGCTGAGG - Intronic
1085315999 11:75545221-75545243 CCTTTGGGTGGGGGTGGCAGGGG + Intergenic
1085509787 11:77082448-77082470 GCTCTGCCTGGGGCTAGCAGAGG + Intronic
1086158086 11:83690673-83690695 GCTGTGGGTGGGGGTGGGGGGGG + Intronic
1086964966 11:93018098-93018120 GCTCTGGTAGGGACTGTCTGTGG + Intergenic
1087602076 11:100329266-100329288 TCTTTGAGTGGGGCTTGCTGTGG - Intronic
1088720865 11:112590687-112590709 TCTTTGGGAGGGGCTGTCTGAGG + Intergenic
1089046089 11:115503500-115503522 GCTGTGGGGCGGGCGGGCTGCGG + Intronic
1089491652 11:118887762-118887784 GCTGTGAGTGGGGCTGGCCAGGG - Intronic
1089593699 11:119561216-119561238 GAGGTAGGTGGGGCTGGCTGGGG - Intergenic
1089601954 11:119621872-119621894 GCTCTGGTTGGCACTGGCTAGGG + Intergenic
1089603145 11:119627196-119627218 GCACTGGGTGGGGTAGGCTTGGG - Intronic
1090134747 11:124185686-124185708 GATCTGTGTGGCCCTGGCTGTGG + Exonic
1090411627 11:126513368-126513390 GCTCATGGTGGCACTGGCTGGGG + Intronic
1090717781 11:129445381-129445403 GCACTGGGCGGTGCTGGCAGAGG - Intronic
1091219084 11:133919942-133919964 GCTCTGGGAGGGGGAGCCTGTGG + Exonic
1091582033 12:1796129-1796151 GCTCTGGGTGAGGGTGGCGGGGG + Intronic
1091584333 12:1807372-1807394 GATCTGGGTGCGGCTGGCTCAGG - Intronic
1091727734 12:2857302-2857324 CCTCAGGGTGGGGATGGCAGTGG + Intronic
1091784115 12:3231901-3231923 GCTCTCAGTGGGGCTGTCTCAGG + Intronic
1091805260 12:3351427-3351449 GCTGGGGGTGGGGCCAGCTGCGG - Intergenic
1092205954 12:6614216-6614238 GCACGGGGTGGGGCTGGGAGAGG - Intergenic
1092502761 12:9064891-9064913 GCTCTGAGTAGGGCCGCCTGGGG + Intergenic
1093604493 12:21073749-21073771 TCTTTGGGTAGGGCTTGCTGTGG + Intronic
1093662197 12:21770147-21770169 GCTCAAGGTTGGGGTGGCTGTGG - Intronic
1094645110 12:32315843-32315865 GCTTTGAGTGGGGCTGGGCGTGG + Intronic
1095270757 12:40215773-40215795 GCTCCCGGTAGGGTTGGCTGAGG + Intronic
1096052021 12:48618701-48618723 GCTCAGGTTGGGGCTGGTTAAGG - Intergenic
1096148304 12:49294128-49294150 GGGATGGGTGGGGCTGGATGGGG - Exonic
1096271143 12:50167247-50167269 GCTTGCTGTGGGGCTGGCTGTGG - Exonic
1096956362 12:55529987-55530009 TCCTTGGGTGGGGCTTGCTGTGG - Intergenic
1097084106 12:56454701-56454723 TCCCTGGGAGGGGCAGGCTGAGG + Intronic
1097189190 12:57211445-57211467 GCTGGGGCTGGGGCTGGCAGAGG - Intronic
1097192197 12:57224955-57224977 GCTCTGGGAGCTGCTGGCCGGGG - Exonic
1097239804 12:57567397-57567419 TCTCTGGGTGGGCGGGGCTGGGG + Intronic
1097302540 12:58034255-58034277 TCCTTGGGTGGGGCTTGCTGTGG + Intergenic
1098009716 12:66037619-66037641 TCTCTGGGTGGAGCAGACTGGGG - Intergenic
1098597953 12:72295117-72295139 GCTGTGGTGGGGGGTGGCTGGGG + Intronic
1099989696 12:89709067-89709089 GCCCCGAGTGGGGCGGGCTGCGG - Intronic
1100451671 12:94712654-94712676 GCTGGGGGTGGGGGTGGGTGGGG - Intergenic
1100933023 12:99632350-99632372 GCTCTAGCAGGGGCTGTCTGTGG - Intronic
1101023208 12:100573941-100573963 GCTCTGCGTTTGCCTGGCTGCGG + Intronic
1101030538 12:100653900-100653922 TCTCTGGGTGGGGGTGGGTGGGG + Intergenic
1101399477 12:104375198-104375220 GATGTGGGTGGGGCTGGCCTGGG + Intergenic
1101955079 12:109205789-109205811 GCTAGGGGTGGGGATGGGTGTGG + Intronic
1102128059 12:110501849-110501871 CCTCTGGGTGCGGCTGGCCTAGG - Intronic
1102207505 12:111100432-111100454 GCCATGGGTGTGGCTGGGTGTGG + Intronic
1102570925 12:113826558-113826580 GCTCTGGGTCGGGCATGGTGGGG + Intronic
1102785326 12:115599749-115599771 GCTTAGGGTGGGGGTGGCAGCGG + Intergenic
1102819042 12:115892412-115892434 GTTCTGTGTGGTGTTGGCTGGGG - Intergenic
1103188433 12:118981047-118981069 GGTCTGGGGGAGGCCGGCTGGGG + Intergenic
1103245265 12:119451387-119451409 GGTTGGGGTGGGGCTGGGTGGGG - Intronic
1103339341 12:120213086-120213108 GCTCTGAGAGGGGCCGGGTGAGG + Intronic
1103394515 12:120597491-120597513 CCTGTGGGTGGTGCTGGCCGAGG + Intergenic
1103567379 12:121823341-121823363 GGTGGGGGTGGGGGTGGCTGGGG - Exonic
1103594820 12:122018214-122018236 GCTCTGGCTGGGGCTGGGGAAGG + Intergenic
1103721878 12:122979610-122979632 GCTCTCCGTGGGGCCAGCTGAGG - Exonic
1103910015 12:124346885-124346907 GCTCTTGATGGGTCTGGGTGGGG - Intronic
1103932589 12:124458430-124458452 GCTCTTGGTGGGCCGGGCTCTGG - Intronic
1104079356 12:125416639-125416661 GTTCTAGCTGGGGTTGGCTGGGG - Intronic
1104623755 12:130337441-130337463 GGCCTGGGTGGGGCTGGCCGGGG + Intergenic
1104672735 12:130691692-130691714 GAGCTGGGTGGGGCTCCCTGTGG - Intronic
1104714664 12:131008534-131008556 GGTCTGCCTGGGGCTGGCTGTGG - Intronic
1104745514 12:131207939-131207961 GATCTCAGTGGGGCTGGCTCAGG - Intergenic
1104788826 12:131469170-131469192 GATCTCAGTGGGGCTGGCTCAGG + Intergenic
1104799717 12:131546190-131546212 GCTCAGGGTTAGGCTGGCTGTGG - Intergenic
1104856581 12:131905043-131905065 GCTGTGGGTGGGGTGGGCTGAGG + Intronic
1104915007 12:132260079-132260101 GCCCTCTGTGGGGCTGGCTTTGG + Intronic
1104930762 12:132338304-132338326 TCTCTGGGTGGTGCCGACTGTGG + Intergenic
1104944303 12:132408846-132408868 GCTCCGGGTGGTGCTGGCCCTGG - Intergenic
1104945091 12:132412159-132412181 GGTCTGGGGGTGTCTGGCTGGGG + Intergenic
1106320557 13:28633450-28633472 TCTATGAGTGGTGCTGGCTGGGG - Intergenic
1106753498 13:32797872-32797894 GCTCTGCGTGGTGGTGGGTGGGG + Intergenic
1107016040 13:35708300-35708322 CCCCTGCGTGGGGTTGGCTGAGG + Intergenic
1107371632 13:39756733-39756755 GCTCTGGGCGGGGCGGGGGGCGG + Intronic
1107628759 13:42320312-42320334 TATCTGGGTGGGGCGGGGTGGGG - Exonic
1107784758 13:43943650-43943672 ACTCCCTGTGGGGCTGGCTGAGG + Intergenic
1108077072 13:46692304-46692326 GGTCGGGGTGGGGCTTTCTGGGG - Intronic
1108751492 13:53452439-53452461 GCAGGGGGTGGTGCTGGCTGGGG + Intergenic
1109001472 13:56811125-56811147 GATCTGTGTGGGGCTTGCTGCGG + Intergenic
1109208411 13:59506955-59506977 GCTCTGGGTTTGGGTGACTGAGG - Intergenic
1110181803 13:72626130-72626152 TCCCTGGGTGGGTCTTGCTGTGG - Intergenic
1110720994 13:78761558-78761580 TCTCTGGATGGAGCAGGCTGGGG - Intergenic
1112041409 13:95552357-95552379 GCCTTGGGTAGGGCTGGGTGGGG + Intronic
1113110048 13:106813317-106813339 GCTCTGGGTGGCACTGGGTGTGG + Intergenic
1113339150 13:109404809-109404831 GCCATGGGTGGGGCTGGAAGAGG - Intergenic
1113400237 13:109985809-109985831 GCTGTGAGTGGGGGTGGCTATGG - Intergenic
1113521603 13:110946000-110946022 GCTCTGTTGGGGGCTGGGTGGGG - Intergenic
1113552482 13:111204051-111204073 GTTCTGGGGGAGCCTGGCTGGGG + Intronic
1113557841 13:111252961-111252983 GCTCTCGCTGGGGCTGCCTTAGG - Intronic
1113588953 13:111484702-111484724 GCTCTGCCTGGCCCTGGCTGGGG + Intergenic
1113735061 13:112672579-112672601 CCTCTTGGTGGGGCCTGCTGGGG - Intronic
1113738439 13:112694333-112694355 TCCCTGGGTAGGGTTGGCTGGGG + Intronic
1113801983 13:113091481-113091503 GTGCTGGGTGGAGCTGGGTGGGG + Intronic
1113910705 13:113839958-113839980 GCTCTGAGGGGCGCAGGCTGAGG + Intronic
1113948374 13:114057767-114057789 GGTCTGGGTGTGGTTGGCGGAGG - Intronic
1113957455 13:114106984-114107006 GCTCTGGGGGGGCCTGGCTGAGG - Intronic
1114524741 14:23360484-23360506 GCCCTGGGTGGGGCTAGTTGGGG + Intronic
1114655944 14:24315723-24315745 GCTGTCAGTGGCGCTGGCTGTGG + Exonic
1115203311 14:30875356-30875378 GCTGTGGGTGGGCCTGGAGGAGG - Intronic
1117450600 14:55845920-55845942 GGTGGGGGTGGGGCTGGCAGGGG + Intergenic
1118210530 14:63761942-63761964 GCACGGGGTGACGCTGGCTGCGG + Intergenic
1118601533 14:67473925-67473947 GCGCCGACTGGGGCTGGCTGCGG + Exonic
1119693284 14:76693283-76693305 GCTCTAGATAAGGCTGGCTGTGG + Intergenic
1119936140 14:78594016-78594038 GCTCTGGGTGGGGTGGCCTGGGG - Intronic
1120012627 14:79434795-79434817 GCTCACCGTGGGACTGGCTGAGG - Intronic
1121013201 14:90533848-90533870 GCCCTGAGTGGGGCTGACTATGG - Exonic
1121482821 14:94291635-94291657 GCCCTGGGAGGGTCTGGGTGGGG + Intronic
1121588289 14:95079020-95079042 GCTGAGGGTGGGGCTGGGTGTGG + Intergenic
1122071726 14:99209468-99209490 GCTCTGGGCTGGGCTGGCCCTGG - Intronic
1122264539 14:100540462-100540484 GGGCGGGGTGGGCCTGGCTGCGG + Intronic
1122355586 14:101121225-101121247 CCTCTGGGTGGCCCTGGCTCGGG - Intergenic
1122408031 14:101512027-101512049 GGTCTGTGAGGGGCTGGCAGTGG - Intergenic
1122575137 14:102737296-102737318 CCTCTTGATGGGACTGGCTGTGG + Intergenic
1122767375 14:104081695-104081717 GCTCTGGGTGGGGCTGGGGCCGG + Intergenic
1122771638 14:104100294-104100316 GCTCTGGGCATGTCTGGCTGTGG + Intronic
1122781206 14:104144324-104144346 GCTCTGGGGGAGTCTGGCCGTGG + Intronic
1122796769 14:104210021-104210043 GCTCTGTGTGGGGAAGGGTGGGG + Intergenic
1122834248 14:104423369-104423391 GGCCTGGGAGGGGCAGGCTGAGG + Intergenic
1122842608 14:104473707-104473729 TCTCAGGGTGGGGGTGGCAGCGG - Intergenic
1122974265 14:105164621-105164643 GCTCAAGGTGGGCCAGGCTGAGG - Intronic
1123020616 14:105396221-105396243 GCTCTGGCTGGGAGGGGCTGGGG - Exonic
1123039125 14:105483217-105483239 GCTGGGGGCAGGGCTGGCTGAGG + Intergenic
1123476119 15:20593483-20593505 GCTGTGGATGGGGCTGCCCGAGG + Intergenic
1123574883 15:21656494-21656516 GCTCTGGGTGGAGTTGCCAGAGG + Intergenic
1123611498 15:22098983-22099005 GCTCTGGGTGGAGTTGCCAGAGG + Intergenic
1123641893 15:22406881-22406903 GCTGTGGATGGGGCTGCCCGAGG - Intergenic
1124096256 15:26651204-26651226 GCTCTGTGTGGGGCCTGCAGTGG - Intronic
1124150225 15:27171045-27171067 GCACTGTCTGGTGCTGGCTGAGG + Intronic
1124633894 15:31353028-31353050 GCTCTGGGTGGGCCTTCCAGGGG + Intronic
1124641104 15:31397213-31397235 GTTCAGGGTGGGGCGGGGTGGGG + Intronic
1124910559 15:33916010-33916032 TCCGTGGGTGGGGCTTGCTGCGG - Intronic
1125514022 15:40307988-40308010 GCACAGGGTGGGGCTGGGGGTGG - Intergenic
1125928750 15:43584577-43584599 GCTGTGGGTGGGGCTGGGGATGG + Intronic
1125941916 15:43684412-43684434 GCTGTGGGTGGGGCTGGGGATGG + Intergenic
1126959762 15:53978395-53978417 GCTCTCGGTGGAGGAGGCTGGGG + Intergenic
1127089989 15:55457389-55457411 CCCTTGGGTGGGGCTTGCTGTGG - Intronic
1127487982 15:59437256-59437278 GCTCAGGCTGGGGCGGGGTGGGG + Intronic
1127997758 15:64163327-64163349 GCTCCGGGCGGGGCGGGCCGCGG - Intergenic
1128113639 15:65092198-65092220 GGTCTGCGCAGGGCTGGCTGGGG + Intergenic
1128330809 15:66754283-66754305 GCTCTGGGTGTCACTGCCTGGGG + Intronic
1128636294 15:69304641-69304663 GCTGGGGGTGGTCCTGGCTGAGG - Intronic
1129162402 15:73753746-73753768 GCTCTGGGTCGGCAGGGCTGGGG + Intergenic
1129221760 15:74135324-74135346 GCCCACGGTGGGGCGGGCTGCGG - Exonic
1129236544 15:74227035-74227057 GCTCTGGGCCAGGCTGGCAGAGG + Intergenic
1129326622 15:74803253-74803275 TCTGTGAGTGGGGCTGGGTGGGG + Intergenic
1129421305 15:75429171-75429193 GCTCTTTGGGAGGCTGGCTGGGG + Intronic
1129562763 15:76589373-76589395 TCCTTGGGTGGGGCTTGCTGCGG + Intronic
1129679414 15:77649762-77649784 GCACTCGGGGGGGCAGGCTGTGG - Intronic
1129723433 15:77890040-77890062 GCTTTGGGTGGGGCTGGGCTTGG + Intergenic
1129917891 15:79290497-79290519 GGGCTGGCTGGGGCTGGCTGGGG + Intergenic
1130012092 15:80160000-80160022 GCTCAGGCAGGGGCTGGATGAGG - Intronic
1131176115 15:90210806-90210828 GCTGAACGTGGGGCTGGCTGAGG + Intronic
1131527855 15:93166853-93166875 GGTCTGGGAGGGGCGGGGTGAGG + Intergenic
1131967750 15:97862592-97862614 GGGTTGGGTGGGGCAGGCTGAGG - Intergenic
1132404811 15:101535830-101535852 GTGCTGGGTGGGGCAGCCTGGGG + Intergenic
1202983751 15_KI270727v1_random:390738-390760 GCTCTGGGTGGAGTTGCCAGAGG + Intergenic
1132687709 16:1169177-1169199 GGTGGGGGTGGGGCTTGCTGGGG + Intronic
1132766863 16:1538821-1538843 TCACTGCTTGGGGCTGGCTGTGG + Intronic
1132772488 16:1571932-1571954 GCTCTGGGGGGCCCTGTCTGTGG + Intronic
1132804701 16:1770034-1770056 TCTCTGGTTGGGGGTGGGTGCGG - Exonic
1132853763 16:2035858-2035880 GGCCTCCGTGGGGCTGGCTGCGG - Intronic
1132892955 16:2213465-2213487 GCCTTGGGTGGGGTTGGCAGGGG - Exonic
1132944201 16:2523619-2523641 ACTCTGTGTGGGGAGGGCTGTGG - Intronic
1132945077 16:2527997-2528019 GCTCGGGGTGGGCCTGCTTGGGG + Intronic
1132947772 16:2541517-2541539 GTTCTGTGTGGGGCAGGTTGTGG + Intronic
1132956274 16:2595682-2595704 GCTCTGTGAGGGGCAGGCCGAGG + Intronic
1132966667 16:2659820-2659842 GTTCTGTGTGGGGCAGGTTGTGG - Intergenic
1132971837 16:2693021-2693043 GATCTGCGTGGGGCTGCCTGGGG - Intronic
1133118982 16:3594900-3594922 GCACTGAGTGGGACAGGCTGCGG + Intronic
1133128886 16:3664243-3664265 GCGGTGGGTGGGGCGGGCTCCGG - Exonic
1133271579 16:4613230-4613252 CCTCCGGGTGGGGCTGCCTTGGG + Intronic
1133347256 16:5079197-5079219 CCACTGGGTGGGGCAGCCTGGGG + Intronic
1133348165 16:5084011-5084033 GAGCTGGGTGGGCCGGGCTGCGG + Intronic
1133678586 16:8099049-8099071 ACTCTGGGTTGGGCTTCCTGAGG + Intergenic
1134091451 16:11393633-11393655 GCTCAGGAAGAGGCTGGCTGGGG + Intronic
1134314609 16:13107140-13107162 GATCAGAGTTGGGCTGGCTGTGG + Intronic
1134881221 16:17746788-17746810 GCTCTGGGTGGTGTTGGGAGTGG + Intergenic
1134916042 16:18072017-18072039 GAGCTGGGAGGGGCTGGCTGAGG - Intergenic
1135323899 16:21513847-21513869 ACTCTGGCTGCGGGTGGCTGAGG - Intergenic
1135674593 16:24404699-24404721 GTTCTGGGTGGAGCTGGGTCAGG - Intergenic
1136022235 16:27447581-27447603 GATGTGGGTGATGCTGGCTGAGG - Intronic
1136335384 16:29607115-29607137 ACTCTGGCTGCGGGTGGCTGAGG - Intergenic
1137660897 16:50205196-50205218 GTTCTGTGTGGGGCGGGCAGAGG + Intronic
1137695303 16:50457659-50457681 TCTGTGGGTGGGGCTCCCTGGGG - Intergenic
1137979185 16:53055293-53055315 GCTCTGGGAGGCGAGGGCTGGGG - Intronic
1138125205 16:54432905-54432927 GCTTTGGGGGGCACTGGCTGGGG + Intergenic
1138550184 16:57743640-57743662 GCCCGGGGTGAGGCCGGCTGGGG - Intronic
1138585886 16:57970279-57970301 GGGCTGCCTGGGGCTGGCTGGGG - Intronic
1139544236 16:67642052-67642074 GCTCTGGGTAGCACAGGCTGAGG - Intergenic
1139653732 16:68375300-68375322 GCCCAGGGTGGGGGTGGATGAGG - Intronic
1139954251 16:70685792-70685814 GCTCTGGCTGGGCCGGGCCGCGG + Exonic
1140091925 16:71845991-71846013 GCTGTGGGGGGCGCTGGGTGTGG + Exonic
1140237572 16:73172909-73172931 TCTCATGGTGGGGCTGCCTGTGG + Intergenic
1140666592 16:77233794-77233816 GATGTGGGTGGGGGGGGCTGGGG - Intergenic
1141438439 16:84014170-84014192 GCTCTGGGCGGGGCTTTCAGAGG - Intronic
1141668611 16:85479714-85479736 GCGCAGCGAGGGGCTGGCTGGGG + Intergenic
1141777500 16:86134163-86134185 GACCTGGGTGGGGCTGGGCGGGG + Intergenic
1141955798 16:87370571-87370593 CCTGTGGGTGGGGATGACTGAGG + Intronic
1142036111 16:87862956-87862978 ACTCTGGCTGCGGGTGGCTGAGG - Intronic
1142113019 16:88342068-88342090 GGGCGGGGCGGGGCTGGCTGGGG + Intergenic
1142120041 16:88382775-88382797 ATTCTGGGGTGGGCTGGCTGGGG + Intergenic
1142136561 16:88454312-88454334 GCACGGGGTGGGGGTGTCTGGGG - Intronic
1142157409 16:88538937-88538959 GCATGGGGAGGGGCTGGCTGTGG - Intergenic
1142227039 16:88882553-88882575 GCTGTGTGTGGGCATGGCTGTGG + Intronic
1142716663 17:1750805-1750827 GCTGTGGGTGAGGCTGGCCCGGG + Intronic
1142805700 17:2370051-2370073 GCTCTGGGTGTGCCTTGGTGAGG - Intronic
1142856723 17:2734776-2734798 GCTCTGGTTAGGGCTGGGCGCGG - Intergenic
1143136481 17:4715239-4715261 GGGCTGGGTGGGGCAGGCTTGGG + Intronic
1143171647 17:4933897-4933919 GCTCTGGGGTGGTCGGGCTGGGG - Exonic
1143190114 17:5034498-5034520 GATCTGGGTGGAGCTGCCTGTGG - Exonic
1143352282 17:6297686-6297708 ACTCTCTGTGGGGATGGCTGAGG + Intergenic
1143380279 17:6491517-6491539 GCTCTGGCTGAAGCAGGCTGGGG + Intronic
1143479566 17:7220555-7220577 GCTCTGGTTGGGTCTGGCTAAGG - Intronic
1143609051 17:8007100-8007122 GGTTGGGATGGGGCTGGCTGGGG + Exonic
1143619621 17:8073457-8073479 ACTGGGGGTGGGGCTGGGTGTGG + Intronic
1143751097 17:9028414-9028436 GCTCTGGGTGGAGCAGGGAGCGG - Intronic
1143965347 17:10752945-10752967 GGGTTGGGTGGGGCTGGGTGAGG + Intergenic
1143994963 17:10998244-10998266 GATCTGGGTGAGGCTAGTTGGGG + Intergenic
1144584184 17:16477932-16477954 GCTGTGGGTGGGAGTGGCGGTGG + Intronic
1144679530 17:17183627-17183649 GTTCTGGGTAGAGCTGGGTGGGG + Intronic
1144717627 17:17445435-17445457 GCTCAGCATGGGGCTGTCTGTGG - Intergenic
1144726930 17:17506816-17506838 GCCCTGGGAGGATCTGGCTGTGG + Intronic
1144782180 17:17813809-17813831 GCTCTGGGAGGGGCAGGATGGGG + Intronic
1144849541 17:18237060-18237082 GCTCTGGGTGGGGCTGGCTGGGG + Intronic
1144953409 17:19005567-19005589 GATCTGGATGGGGCTGGTTTGGG + Intronic
1145254131 17:21313574-21313596 GGGCTGGCTGGGGCTGGGTGGGG + Intronic
1145416138 17:22715425-22715447 GCTCTGGGTGGTGGTGACAGTGG - Intergenic
1145784604 17:27585907-27585929 GCTCTTCATGGGGCTGCCTGTGG - Intronic
1145992453 17:29087194-29087216 GCTCTGGGTGAGGAGGCCTGGGG + Intronic
1146139429 17:30352450-30352472 GGGCTGGGTGGTGCTGTCTGAGG - Intergenic
1146255602 17:31390325-31390347 CCTCTGGGTGGGGCTTCCTCTGG + Intergenic
1146260033 17:31415064-31415086 GCTCTGGGAGAGGCTGTCTCTGG - Intronic
1147144947 17:38479376-38479398 GCCCTGGGGTGGGCTGGCTGTGG + Intronic
1147169064 17:38607505-38607527 GCTCTGTGTGGGGGAGGCTCAGG + Intergenic
1147211278 17:38873924-38873946 GCTCTGGGTTGGGGGGGATGTGG - Intronic
1147218576 17:38914981-38915003 GCTCTGGGAGGGGCTGGGTTTGG + Intronic
1147238262 17:39073536-39073558 ACTCTGGGAGGGACTGGCAGTGG - Intronic
1147240091 17:39085238-39085260 ACTCTGGGAGGGACTGGCAGTGG + Intronic
1147305655 17:39562391-39562413 GCTCTGGGAGGTCCTGACTGTGG + Intronic
1147313151 17:39606746-39606768 GCTCTGGGCGGGGCAGGCGGCGG - Intronic
1147583232 17:41638469-41638491 GATCTGGGTGGGGCCGCCTGGGG - Intergenic
1147649757 17:42055178-42055200 GATCTGGGAGGGGTTGGCAGCGG + Intronic
1147715297 17:42502813-42502835 GCTCGGGTTTGGGCTGACTGGGG - Intronic
1147865576 17:43549861-43549883 TCTCTGGGTTGGGTTAGCTGGGG + Intronic
1147968137 17:44205234-44205256 GCACTGGGATGGGATGGCTGGGG - Exonic
1147982564 17:44283525-44283547 GCCCTGGGTGGGGTTGGGTGGGG + Intergenic
1147998560 17:44374922-44374944 GCTCTGGGAGGGGCGGGGTTTGG - Intronic
1148166735 17:45489379-45489401 GTTCTGTGTGGTGTTGGCTGTGG - Intronic
1148198638 17:45733126-45733148 GCCCTGGGAGAGCCTGGCTGTGG + Intergenic
1148367752 17:47069397-47069419 GTTCTGTGTGGTGTTGGCTGTGG + Intergenic
1148668039 17:49389255-49389277 GTGATGGGTGGGCCTGGCTGGGG - Intronic
1148868129 17:50639689-50639711 GCAGTGGTTGGGGCTGGCAGGGG + Intronic
1148935420 17:51161159-51161181 GGTCTGGGAGGGGCTGAATGTGG + Exonic
1149581337 17:57752425-57752447 ACTCTGGGTGGGGCTGGGGTGGG - Intergenic
1149680687 17:58505040-58505062 TTGTTGGGTGGGGCTGGCTGTGG - Intronic
1150144386 17:62755413-62755435 ACTCAGGGTGGGGCTGGGAGAGG + Intronic
1150311183 17:64130294-64130316 GATGTGGGAGGGGCTGGCTCGGG + Intronic
1150397911 17:64835782-64835804 GTTCTGTGTGGTGTTGGCTGTGG - Intergenic
1151064640 17:71135683-71135705 GCTCTCTGTGTGGCTTGCTGAGG - Intergenic
1151235925 17:72719800-72719822 GACTTGGGTGGGGGTGGCTGGGG + Intronic
1151342814 17:73482578-73482600 GCTCTGGCTTGCGATGGCTGGGG + Intronic
1151397884 17:73836624-73836646 GTCCTGAGTGGGGCTGACTGTGG - Intergenic
1151459465 17:74245960-74245982 GCTCTGGGTGAGGCAGGGAGAGG + Intronic
1151499574 17:74480311-74480333 GCTCTGGGGTTGCCTGGCTGTGG + Intronic
1151625139 17:75271474-75271496 GCTCCGGGGAGGGCTGGGTGCGG - Intergenic
1151786756 17:76278973-76278995 GCTCTGGATGGGGAAGGCAGGGG - Intronic
1151830031 17:76544226-76544248 GCTGGGAGGGGGGCTGGCTGGGG - Intronic
1151935142 17:77256794-77256816 GGGGTGGGTGGGGCTGCCTGGGG + Intergenic
1152119710 17:78411066-78411088 GCTCAGGGAGGGCCTCGCTGAGG + Intronic
1152206652 17:78977851-78977873 GCCCAGGGTGGGCCAGGCTGGGG + Intronic
1152587524 17:81195686-81195708 GCGGTGGGTGGGGCTGTCTGGGG - Intronic
1152644862 17:81464059-81464081 GCTGTGGGTGGGGCGGGCCGGGG - Exonic
1152686484 17:81696209-81696231 GCTCTGGGGGAGGCAGGCAGAGG - Intronic
1152744330 17:82032015-82032037 GCTCCCGCTTGGGCTGGCTGCGG + Intronic
1152773812 17:82187596-82187618 GCTCGGGGGGGAGCTGGCAGGGG + Intronic
1152811017 17:82382919-82382941 GGTCAGGGTGGGGCCGGATGAGG - Intergenic
1152889742 17:82873713-82873735 GGTCTGGGTGTGGAGGGCTGGGG + Intronic
1153280037 18:3406415-3406437 TCTCTGGGTGGAGCAGGCTGGGG + Intergenic
1153299740 18:3582194-3582216 GTTCTGGGTGGGACTGGAGGTGG + Exonic
1153502377 18:5762435-5762457 GGTCTGGGTGGTGGTGCCTGGGG - Intergenic
1153972661 18:10240570-10240592 CCTCTGAGATGGGCTGGCTGTGG - Intergenic
1154216607 18:12420649-12420671 GCGCGGGGTGGGGGTGGCGGTGG + Intronic
1154941657 18:21119255-21119277 TCTCTGGGTAGAGCAGGCTGGGG + Intergenic
1155265981 18:24093901-24093923 GCTGAAGGTGGGGGTGGCTGTGG + Intronic
1156020901 18:32598102-32598124 TCCCTGGGTGGGGTTTGCTGTGG - Intergenic
1156092044 18:33483044-33483066 AGTCTGGGTGGGGATTGCTGTGG - Intergenic
1157605505 18:48923571-48923593 GCTCTGGGTGTGTGTGTCTGTGG - Intronic
1158366736 18:56744925-56744947 GCCATGGGAGTGGCTGGCTGAGG + Intronic
1160055042 18:75471148-75471170 AGGCTGGGTGGGGCTGGGTGGGG + Intergenic
1160157173 18:76442695-76442717 GCTCTTGGTGGGGCTGGCGCAGG + Exonic
1160520985 18:79507834-79507856 GCTTTCGGAGGAGCTGGCTGTGG + Intronic
1160668153 19:343228-343250 GCTCTGGGGGAGGCTGGCTTGGG + Intronic
1160679669 19:406986-407008 GCTTGGGCTGGGGCTGGCCGGGG - Exonic
1160717570 19:583322-583344 GCTCTGGAGGGGGTTTGCTGGGG + Exonic
1160723786 19:608733-608755 GCTCAGGATGGGGCTGGGTTAGG + Intronic
1160859865 19:1233205-1233227 GAGCTGGGTGGGTCTGGCTCAGG + Intronic
1160871836 19:1281293-1281315 CCTCTGGGTGGGGGGGGGTGGGG + Intergenic
1160987222 19:1844656-1844678 GTTCTGGGTGGGGCTGTTGGCGG - Intronic
1160991945 19:1863695-1863717 CCTCCGGGCGGGGCGGGCTGTGG - Intergenic
1161053707 19:2179328-2179350 GCCCTGGGAGAGGCTCGCTGAGG + Intronic
1161213421 19:3080328-3080350 GCTGTGCGTGGGGATGTCTGTGG + Intergenic
1161513308 19:4683384-4683406 GCTCCGGGTGGCGCGGGCGGTGG + Intronic
1161570267 19:5026681-5026703 GGTCAGGGTGGGGTAGGCTGGGG + Intronic
1161619574 19:5291043-5291065 GCTCAGGGAGGGGCTGGGTGGGG + Intronic
1161646161 19:5454775-5454797 GGTCAGGGTGGGGCTGGTGGGGG - Intergenic
1161840747 19:6679008-6679030 GCTGTGGGTGTGGGTGACTGTGG - Intronic
1161855244 19:6760830-6760852 GCTGTGGGTCGGCCTGGCCGGGG + Exonic
1161976801 19:7611828-7611850 GCTCCGGGGGTGGCTGGGTGGGG - Exonic
1161983348 19:7641861-7641883 CATCGGGGTGGGGCTGGGTGGGG - Intronic
1162135960 19:8555489-8555511 GCTCTGGTTGGGGGCAGCTGTGG - Intronic
1162410647 19:10503124-10503146 CCTCGGGGTGGGGATGGCCGGGG + Intronic
1162903484 19:13809204-13809226 GCTCTGGGATGAGCTGGGTGAGG + Exonic
1162935280 19:13978810-13978832 CCTCTGGTCGGGGCTGGCTCGGG + Intronic
1163535113 19:17872412-17872434 GCTGTGGGTCGGGCTGGCTCGGG + Exonic
1163665944 19:18604156-18604178 TCTCTGGGGGGTCCTGGCTGGGG + Intronic
1163702928 19:18795618-18795640 GCCTGGTGTGGGGCTGGCTGGGG - Intergenic
1164490073 19:28702205-28702227 GCTGAAGGTTGGGCTGGCTGTGG + Intergenic
1164563157 19:29308019-29308041 GCTCTGGGTGGGGGGCACTGAGG - Intergenic
1164767345 19:30781953-30781975 GCCCTGGGTGGGGTTGGGGGGGG + Intergenic
1164830586 19:31317204-31317226 GCTCTGGCTGGGGCTGGGGCTGG - Intronic
1165460129 19:35939483-35939505 GGGCTGGGTGTGGCTGACTGGGG - Exonic
1165775741 19:38403395-38403417 GCTGTGCGTGCGGCTGGCGGCGG + Exonic
1165823618 19:38692994-38693016 CCTGGGGTTGGGGCTGGCTGTGG + Intronic
1165969812 19:39617946-39617968 TCCTTGGGTGGGGCTTGCTGTGG - Intergenic
1166105744 19:40597311-40597333 GCTGGGGCTGGGGCTGGCGGCGG - Exonic
1166209635 19:41297921-41297943 GCTCTAGGGATGGCTGGCTGGGG - Intronic
1166669397 19:44701006-44701028 GCACTGGGTGGGGCTGGGAAAGG + Intronic
1166925052 19:46261371-46261393 GCTGTGGATGGGGCTGGCCCGGG + Intergenic
1166944101 19:46386570-46386592 GCTCAGGGTGGGGTGGGCTGGGG + Intronic
1166981943 19:46636155-46636177 GCTCTGGGCCGGGCTCGCGGCGG + Intergenic
1166986164 19:46661014-46661036 GCCCTGAGCGGGGCCGGCTGCGG - Exonic
1167093074 19:47358047-47358069 GCGCTGGGTGTGGCTGGCATAGG - Exonic
1167102620 19:47413427-47413449 TGTCTGGGTGGGTCTGGCTGTGG + Intronic
1167116966 19:47493979-47494001 GCTCTGGGTGTGCCTGGGGGAGG - Intronic
1167149804 19:47702084-47702106 GCCTTGGGCGGCGCTGGCTGCGG - Exonic
1167269677 19:48499786-48499808 TCTCGGGGTGGGGGTGGCGGCGG + Exonic
1167443632 19:49524760-49524782 CCTCAGGGTGGAGCTGGGTGAGG + Exonic
1167455692 19:49595909-49595931 GCTGAGCGAGGGGCTGGCTGTGG - Exonic
1167464303 19:49642190-49642212 GCGCGGGGCGGGGCGGGCTGGGG - Exonic
1167553125 19:50174791-50174813 GACCTGGCTGGGGCCGGCTGTGG + Intergenic
1167590451 19:50401934-50401956 GCTCAGGGAGGGGCTGGGTAGGG - Intronic
1167617940 19:50546502-50546524 TCTCTGGGTGGGGCAGGGGGCGG + Intronic
1168116613 19:54224434-54224456 GCTCTGGGTGAGGCTGGAAGCGG + Intronic
1168119596 19:54244217-54244239 GCTCTGGGTGAGGCTGGAAGCGG + Intronic
1168266579 19:55226924-55226946 GCTCCATGTGGGCCTGGCTGAGG + Exonic
1168587307 19:57603859-57603881 GATCGGGGTGGAGGTGGCTGAGG + Intronic
1202712071 1_KI270714v1_random:24201-24223 GTGCTGGGTGGGGGTGTCTGGGG + Intergenic
1202715497 1_KI270714v1_random:40136-40158 GCTCAGGGTTGGCCTTGCTGAGG + Intergenic
924962638 2:47204-47226 ACTCTCAGTGGGGCAGGCTGGGG + Intergenic
925436674 2:3844300-3844322 GCTCTGGGTGTGGCTGTCCCAGG - Intronic
925640193 2:5979593-5979615 GCTCTGACTGAGGCTGGATGGGG - Intergenic
925705552 2:6681548-6681570 TCTTTGGGTGGGGTTTGCTGCGG - Intergenic
926052973 2:9756583-9756605 GTTCTGGGGGTGGCTGGCTTGGG - Intergenic
926121032 2:10241242-10241264 GCTCTGGGTAATGCTGGCTGTGG - Intergenic
926186022 2:10691315-10691337 ACTCTGGGTAGGGGTGGATGGGG - Intergenic
926887601 2:17612405-17612427 GCTGAGGTTGGGGCTGACTGTGG + Intronic
927140725 2:20129165-20129187 GGACTGGCTGGGACTGGCTGAGG - Intergenic
927186089 2:20483688-20483710 CCTGTGGCTGAGGCTGGCTGAGG - Intergenic
927719037 2:25371579-25371601 GCAGTGGTTGGGGCTGGCTGTGG + Intergenic
927847929 2:26480863-26480885 GCTCCTGCTGGGCCTGGCTGTGG - Exonic
927887326 2:26726769-26726791 GCTCAGGGTGGGCCAGGGTGGGG + Intronic
929080366 2:38116390-38116412 GCACTGGGTGGGGGGGGCGGGGG + Intergenic
930198310 2:48530165-48530187 CCTCCTGGTGTGGCTGGCTGCGG + Exonic
930785674 2:55269327-55269349 GCTGGGGGTGGGACTGTCTGCGG + Intronic
931239534 2:60439749-60439771 GCTCCGGGTGGGGGAGGCTGGGG - Intergenic
932357499 2:71078407-71078429 GCTCTGGGTGGGGCCAGCCTAGG + Exonic
932369956 2:71178672-71178694 GCTCTGGGTGGGGCCAGCCTAGG + Intergenic
932419048 2:71590724-71590746 GATCTGGGTGGGGGGAGCTGGGG - Intronic
932706839 2:74032522-74032544 GCCCTTGCTGGGTCTGGCTGAGG + Intronic
932714636 2:74092442-74092464 GGGCTGGGCTGGGCTGGCTGTGG + Intronic
932751157 2:74372533-74372555 GCCTTGGGTGGGGATGTCTGAGG - Intronic
933536738 2:83584929-83584951 GCACAGGGAGGGGCTGTCTGTGG - Intergenic
933749323 2:85593016-85593038 GATCTGCGTGGGGCTGGTGGTGG + Exonic
934573059 2:95384281-95384303 GGCCTGGGAAGGGCTGGCTGGGG - Exonic
934770950 2:96907368-96907390 GGGCTGGCTGAGGCTGGCTGTGG + Intronic
935332327 2:101986208-101986230 GGCATGGGAGGGGCTGGCTGAGG - Intergenic
935738585 2:106126542-106126564 CTTCTGGGTGAGGCTGGGTGGGG + Intronic
936080045 2:109426827-109426849 GCTAAAGGTGGGGGTGGCTGTGG - Intronic
936979021 2:118246882-118246904 GCTCTCAGTGGGGCTGGCCCAGG + Intergenic
937089760 2:119198390-119198412 GGCCTTGGTGGGGCTGGCTAGGG - Intergenic
937624193 2:124025210-124025232 GCGCGGGGCGGGCCTGGCTGGGG + Intergenic
937914089 2:127090422-127090444 GTGCTGGGTGGGGCTCGCTGAGG + Intronic
937988858 2:127651197-127651219 CCTGTGGGTGGTGGTGGCTGTGG + Exonic
938151578 2:128889710-128889732 CCTATGAGTGGGGCTGGTTGGGG + Intergenic
938293398 2:130162174-130162196 CCTCTGGGTGTGTGTGGCTGTGG - Intronic
938463155 2:131510787-131510809 CCTCTGGGTGTGTGTGGCTGTGG + Intergenic
938583448 2:132668662-132668684 TCTCCGGGTAGGGCTGGATGTGG + Intronic
940762399 2:157751789-157751811 TCCTTGGGTGGGGCTTGCTGTGG - Intronic
940932957 2:159457730-159457752 GCCCTGGGAGGGGCTGGAGGTGG - Intronic
941111776 2:161424265-161424287 GAGCTGTGAGGGGCTGGCTGGGG - Exonic
942229228 2:173844405-173844427 GCTGGGGCTGGGGCTGGGTGGGG - Intergenic
943004081 2:182368329-182368351 CCTTTGGGTGGGGGGGGCTGGGG - Intronic
944539614 2:200743184-200743206 GCTCCAGGTGGAGATGGCTGTGG - Intergenic
944898589 2:204191313-204191335 GCTTAGGGTAGAGCTGGCTGAGG + Intergenic
944905414 2:204257155-204257177 ACTCTGGATGAGGCTGGCAGGGG - Intergenic
945084018 2:206113126-206113148 CCTCTCTGTGGGGTTGGCTGAGG - Intergenic
946023740 2:216659439-216659461 GCTCTGGGTGGGAGGGTCTGGGG + Intronic
946219905 2:218217362-218217384 CCCCTGAGTGGGGCTGGGTGGGG - Exonic
946245126 2:218383037-218383059 TCTCTGGGAGGTGCTTGCTGTGG - Exonic
946402462 2:219475815-219475837 TGTCTGGGTGTGGCTGGGTGGGG - Intronic
947003271 2:225482780-225482802 GTTTGGGGTAGGGCTGGCTGGGG - Intronic
947023563 2:225711353-225711375 CCTCAGGGTGGGGCTGGTTAGGG + Intergenic
947753019 2:232542541-232542563 GCCCTGGATGAGGCTGCCTGGGG - Intronic
948061185 2:235044352-235044374 GCTGACGGTGGGGCTGCCTGCGG - Intronic
948203138 2:236144117-236144139 GCTCTGGGGGTGGGTGTCTGTGG - Intergenic
948461154 2:238130609-238130631 GCTCCGAGGGGGGCTGGCCGAGG - Exonic
948611164 2:239167946-239167968 GCTCTGGGTGGGGCGGGGCGGGG + Intronic
948713985 2:239847120-239847142 TCCTTGGGTGGGGCTTGCTGAGG - Intergenic
948768005 2:240233386-240233408 GCTGTGGGCGGGGCTGGAGGTGG - Intergenic
948768072 2:240233580-240233602 GCTGTGGGTGGGGCTGGAGGGGG - Intergenic
948792918 2:240388523-240388545 GCTCAGGGCTGGGCTGGCCGAGG - Intergenic
948795702 2:240401102-240401124 GATCTGGGTCGGGCTGGGGGTGG + Intergenic
948873262 2:240814400-240814422 GCTCTGGGTGGTAGTGTCTGGGG - Intronic
1169404260 20:5310314-5310336 TCTCTGGATGGACCTGGCTGTGG + Intronic
1169460487 20:5790187-5790209 TCCCTGGGTTGGGCTGTCTGAGG - Intronic
1170157566 20:13282537-13282559 GCTGGGGGTGAGGGTGGCTGAGG - Intronic
1170163894 20:13343260-13343282 GTGCTGGGTAGGCCTGGCTGAGG - Intergenic
1170495021 20:16915608-16915630 GCCATGGGTGGGGCTGGAAGAGG - Intergenic
1170968657 20:21099518-21099540 GTGCTGGGAGGGGCTGGATGGGG - Intergenic
1170983678 20:21238821-21238843 GCTCTTGGAAGGCCTGGCTGAGG + Intronic
1171066931 20:22026620-22026642 TCCATGGGTGGGGCTTGCTGTGG + Intergenic
1171265172 20:23765923-23765945 GCTCTCCATGGGCCTGGCTGTGG + Intergenic
1171266122 20:23773433-23773455 GCTCAGCGTGGCGGTGGCTGTGG + Intergenic
1171274764 20:23847272-23847294 GCTCTCCATGGGCCTGGCTGTGG + Intergenic
1171282355 20:23911368-23911390 GCTCTCCATGGGCCTGGCTGTGG + Intergenic
1171287262 20:23951494-23951516 GCTCTCCGTGGGGCTGGCCGTGG + Intergenic
1171494838 20:25548533-25548555 GCCGTGGGTGAGGCTGGGTGTGG - Intronic
1171494868 20:25548634-25548656 GCCCTAGGTGAGGCTGGGTGTGG - Intronic
1171494885 20:25548684-25548706 GCCCCGGGTGGGGCTGGGTGTGG - Intronic
1171494904 20:25548734-25548756 GCCCTGGGTGAGGCCGGGTGTGG - Intronic
1171494947 20:25548884-25548906 GCCTTGGGTGAGGCTGGGTGTGG - Intronic
1171494963 20:25548934-25548956 GGCCTGGGTGAGGCTGGGTGTGG - Intronic
1171494995 20:25549034-25549056 GGCCTGGGTGAGGCTGGGTGTGG - Intronic
1171495013 20:25549084-25549106 GGCCTGGGTGAGGCTGGGTGTGG - Intronic
1171495031 20:25549134-25549156 GGCCTGGGTGAGGCTGGGTGTGG - Intronic
1171495049 20:25549184-25549206 GGCCTGGGTGAGGCTGGGTGTGG - Intronic
1171495068 20:25549234-25549256 GCCCTGGGTGAGGCTGGGTGTGG - Intronic
1171495086 20:25549284-25549306 GCCCTGGGTGAGGCTGGGTGTGG - Intronic
1171495115 20:25549384-25549406 GCCCTGGGTGAGGCTGGGTGTGG - Intronic
1171847882 20:30288770-30288792 GCTCTTGGTGGGGCTGGGGTTGG - Intergenic
1172011082 20:31845825-31845847 GTGCTGGGTGGTGGTGGCTGGGG + Intergenic
1172113548 20:32561188-32561210 GCTGCTGGTGGGGTTGGCTGCGG - Intronic
1172205483 20:33160135-33160157 GCTCTGGGTGGCTTTGGCTGGGG - Intergenic
1172782575 20:37445926-37445948 CCTGTGGGTGGTGCTGGCTTTGG + Intergenic
1173021931 20:39274315-39274337 GCACTGACTGGGGCAGGCTGAGG - Intergenic
1173163329 20:40668801-40668823 GCTCTGCGTGGGGCAGAGTGAGG - Intergenic
1173653751 20:44684647-44684669 TCTCTGTGTGGTGCTGGATGAGG - Intergenic
1173809482 20:45947483-45947505 GCTCAGGGTGGGGCTGGGCCTGG - Intronic
1174340286 20:49891076-49891098 GCTGAGGATGGGGCAGGCTGGGG + Exonic
1174479689 20:50822125-50822147 GGGCTGGTTGGGGCTGGTTGGGG + Intronic
1174870733 20:54178898-54178920 GTTCCGGGTGGGGCGGGGTGGGG + Intergenic
1175349569 20:58309043-58309065 TCCCTGGGCGGGGCGGGCTGAGG - Intergenic
1175366383 20:58459214-58459236 GCTCCTGGTGGGGATGGCAGTGG - Exonic
1175388592 20:58612463-58612485 GCTGCGGGAGGGGCTGTCTGGGG + Intergenic
1175658644 20:60793365-60793387 GCTGAGGGTCTGGCTGGCTGGGG + Intergenic
1175784870 20:61706099-61706121 AAACTGGGTGAGGCTGGCTGAGG + Intronic
1175926987 20:62475870-62475892 GCGCTGGGAGGGGCCGGGTGGGG + Intronic
1175939446 20:62531312-62531334 GCTCAGGGAGGGGCAGGCTCAGG - Intergenic
1175939452 20:62531328-62531350 GCTCAGGGAGGGGCAGGCTCAGG - Intergenic
1175953991 20:62598892-62598914 GGGCTGGGTGTGGCTGGGTGTGG + Intergenic
1176025171 20:62982017-62982039 GCTCTTGGTGGGACAGACTGGGG + Intergenic
1176159067 20:63639430-63639452 GCTGTGGGTGGGGCTGGCGGGGG - Intergenic
1176182639 20:63758124-63758146 GCTCTGGATGGGGCGGGTGGAGG - Intronic
1176892716 21:14337825-14337847 GCTCTGGGTGTGGCTGACTGTGG + Intergenic
1177404624 21:20649128-20649150 GCTGAGGGTTGGGGTGGCTGTGG - Intergenic
1177578895 21:22994183-22994205 CCCGTGGGTGGGGCTTGCTGTGG - Intergenic
1178300790 21:31451086-31451108 GCTCTGGATGGATATGGCTGAGG + Intronic
1178411721 21:32369051-32369073 GCACTATGTAGGGCTGGCTGTGG + Intronic
1178497244 21:33097523-33097545 TATCTGGGTGTGGCTGGGTGCGG - Intergenic
1178821819 21:35982418-35982440 GCTCTTGGTGGGGCAGTCAGGGG - Intronic
1179154661 21:38839280-38839302 GCCCTGGACGGGCCTGGCTGGGG + Intergenic
1179170599 21:38970105-38970127 TCACAGGGTGGGGCTGGGTGGGG - Intergenic
1179542780 21:42094441-42094463 GCTGTGGTTGGGGAGGGCTGTGG + Intronic
1179544990 21:42107807-42107829 GTTCTGGGTGGGGCCAGCTCAGG + Intronic
1179628197 21:42660291-42660313 GCTCAGGGTGGGTTTGTCTGGGG - Intronic
1179719412 21:43306785-43306807 CTTCTGGGTGGGGCTGGTGGAGG - Intergenic
1179893963 21:44351140-44351162 GGGCTGGGCTGGGCTGGCTGGGG + Intronic
1179935717 21:44602381-44602403 GCCCTGGGTGGGGCTGCTTTGGG + Intronic
1180082545 21:45493436-45493458 GCTCTGGGTGAGGCTTTGTGGGG + Intronic
1180156255 21:45978501-45978523 GCTGTGGGTGGGGCAGGTTGTGG + Intergenic
1180180865 21:46118187-46118209 GGTGTGGGTGGGGCTCCCTGGGG - Intronic
1180726558 22:17950960-17950982 GATCAGGGTGGGGCTGACAGTGG - Intronic
1180726567 22:17950983-17951005 GCCCAGGGTGGGGCTGACAGTGG - Intronic
1180783529 22:18534792-18534814 GCCCTGGGGAGGGCTGGCTCAGG - Intergenic
1181035058 22:20165835-20165857 GCTCTCGGTGAGGCTGGCTGTGG - Intergenic
1181112765 22:20611605-20611627 CCTCTGGGTGTGTGTGGCTGTGG - Intergenic
1181127096 22:20708843-20708865 GCCCTGGGGAGGGCTGGCTCAGG - Intronic
1181240431 22:21474144-21474166 GCCCTGGGGAGGGCTGGCTCAGG - Intergenic
1181459674 22:23078664-23078686 GCTCTGGGTGGGCCAGGGTTTGG + Intronic
1181471773 22:23145193-23145215 GCCCTGGGTGGGGCTGACCGTGG - Intergenic
1181486839 22:23236906-23236928 GCTCTGGCAGGGGGTAGCTGTGG + Intronic
1181508760 22:23379524-23379546 GCTCTGGGTGAGGCTGGCTAGGG + Intergenic
1181627747 22:24133089-24133111 CCTCAGGGTGGGGCAGGCAGGGG + Intronic
1181748736 22:24974140-24974162 GGTCTGGGTGGGGCAGGTTTGGG + Intronic
1181968570 22:26673237-26673259 GCTCTGGGGGAGGCTGGCTGAGG - Intergenic
1182075257 22:27491081-27491103 GCTCTGTGTGGGGCTGTTTCTGG + Intergenic
1182219160 22:28744106-28744128 GCTCTGGGTCTGACAGGCTGGGG - Intronic
1182295995 22:29311521-29311543 GCTCTGGGCGGAGGAGGCTGAGG - Intronic
1182537943 22:31019914-31019936 GCCCTGGTTGGGGCTGTCTGTGG + Intergenic
1183447753 22:37870064-37870086 GCTCTGGATGGGGCAAGGTGAGG - Intronic
1183541866 22:38434072-38434094 GCTCTGGCAGGGCCTGGCGGAGG - Intronic
1183744417 22:39684855-39684877 GCTCTGGGTGGGTGTGAGTGGGG + Intronic
1183750280 22:39716137-39716159 GCTCTCGGGAGGGCAGGCTGGGG - Intergenic
1183821124 22:40346681-40346703 GCTGTGGCTGTGGCTGGCGGAGG + Exonic
1184035940 22:41918149-41918171 GTTCTGGCTGGGGAAGGCTGGGG + Intergenic
1184120381 22:42446028-42446050 CCTCTGGCTGGGGTGGGCTGTGG + Intergenic
1184155414 22:42663572-42663594 GCTCTGGGAGCTGCTGGGTGAGG + Intergenic
1184274966 22:43404932-43404954 GCTCTGGGTGGTGCTGGTTTGGG + Intergenic
1184387191 22:44182879-44182901 GGCCTGTGTGGGGCTGGCTGAGG - Intronic
1184408188 22:44312020-44312042 CCTCGGGGTGGGGGTGGCTCTGG + Intronic
1184460682 22:44636249-44636271 GGTCTGGGTGGGGGTTGCAGGGG - Intergenic
1184695038 22:46134257-46134279 GCTCTGGGTGGGGGATGCGGAGG - Intergenic
1184768016 22:46582059-46582081 GCCTTGGCTGGGGCTGGGTGGGG + Intronic
1184768020 22:46582069-46582091 GGGCTGGGTGGGGCTGGGTGTGG + Intronic
1184942762 22:47781166-47781188 GCTCTGAGTGGCGCGGGCTTTGG + Intergenic
1184984436 22:48119902-48119924 GCCCTGGGAGAGGCTGGCTGTGG + Intergenic
1185070915 22:48655165-48655187 GGTCTGGGCAGGGCTGGATGTGG - Intronic
1185094379 22:48798419-48798441 GCTCTGGGGCGCGCTGGCTTTGG - Intronic
1185097094 22:48815755-48815777 GCTGAAGGTGGGGGTGGCTGTGG - Intronic
1185151162 22:49164692-49164714 GCTGTGGGTGGGGCTGTAAGTGG - Intergenic
1185151183 22:49164742-49164764 GCTGTGGGTGGGGCTGTAGGTGG - Intergenic
1185151187 22:49164754-49164776 GCTGTGGGTGGGGCTGTGGGTGG - Intergenic
1185151197 22:49164778-49164800 GCTGTGGGTGGGGCTGTAAGTGG - Intergenic
1185151218 22:49164828-49164850 GCTGTGGGTGGGGCTGTAGGTGG - Intergenic
1185151222 22:49164840-49164862 GCTGTGGGTGGGGCTGTGGGTGG - Intergenic
1185259503 22:49853799-49853821 GCGCGGGGCGGGGCTGGCCGGGG - Intergenic
1203256792 22_KI270733v1_random:143101-143123 GCTCTGGGCGGGGCGGGGCGAGG + Intergenic
949749316 3:7332797-7332819 TCGTTGGGTGGGGCTTGCTGAGG - Intronic
949942339 3:9164578-9164600 AGTCTGGGTGGGGCTGGGTGCGG - Intronic
950115598 3:10448739-10448761 ACTCTGGTTGGGGATCGCTGGGG - Intronic
950426698 3:12928217-12928239 GATCTGGGTGGGGGTGGCCGAGG + Intronic
950520116 3:13493161-13493183 GCTGTGGGTGGGGCAGGTGGGGG - Intronic
950603552 3:14057776-14057798 TCTTTGGGTGGGTCTTGCTGTGG + Intronic
951302669 3:21017590-21017612 TCCTTGGGTGGGGCTTGCTGCGG + Intergenic
951691018 3:25396690-25396712 TCTTTGGGTGGGGTTTGCTGTGG + Intronic
951761108 3:26148340-26148362 GATCTGGGTGGGGCAGCCAGTGG + Intergenic
952154288 3:30626396-30626418 ACTCTTGGTGGGGCTGGTAGTGG + Intronic
952258206 3:31713685-31713707 GATCTGAGTGAGGCTGGGTGCGG - Intronic
952959402 3:38580178-38580200 GCACTGGCTGGGCCTGGCTGTGG - Intronic
953411865 3:42695132-42695154 GCCATGGGTGTGGGTGGCTGAGG - Intronic
953758781 3:45670451-45670473 GCTCTGTGTGGCATTGGCTGGGG + Intronic
953929757 3:47000036-47000058 GGCTTGGGTGGGGCTGGCTTGGG - Exonic
954107162 3:48415591-48415613 GCTCTTGGTGGGGCCAGCAGAGG + Exonic
954374266 3:50185831-50185853 GCTGTTGGTGGGGCTGGCTATGG + Intronic
954625045 3:52017866-52017888 ACTCAGGGCGGGGGTGGCTGAGG + Intergenic
954649166 3:52149745-52149767 GACCTGGGTGGGGATGGCTCTGG + Intronic
954736869 3:52714596-52714618 GCTCTGGGCGGGGCTCCCAGGGG - Intronic
956117977 3:65937278-65937300 TGTCAGGGTGGGGCTGGCTGAGG - Intronic
960599137 3:119437893-119437915 ACTGTGGGTGGGGATGGGTGTGG + Exonic
960717922 3:120596030-120596052 GAGCTGTGTGGGACTGGCTGTGG - Intergenic
961302821 3:125933234-125933256 CCACTGGGTGGGGCAGCCTGGGG - Intronic
961439821 3:126946048-126946070 GCTCTGTGTGGGGCTGCGGGAGG - Intronic
961449152 3:126994723-126994745 CCTGTGTGTGGGGCTGGCTGTGG + Intronic
961824044 3:129589515-129589537 GCTCTGGCTGGAGCTGGAAGAGG + Exonic
962007303 3:131361668-131361690 CCTCTGGGTTGGGCTTGCGGCGG - Intergenic
962068894 3:132012530-132012552 GCTCTAGGTGGTACTGGGTGTGG + Intronic
962626527 3:137231008-137231030 TGTCAGGGTGGGGCTGGATGTGG + Intergenic
962889147 3:139656114-139656136 GCCCTGGTTAGGGATGGCTGGGG + Intronic
963058156 3:141204418-141204440 GCTGTGGGTGTGAGTGGCTGAGG + Intergenic
963416896 3:145008176-145008198 CTTCTGCCTGGGGCTGGCTGGGG + Intergenic
963847905 3:150178635-150178657 GCTCCCTGTGGGGTTGGCTGAGG - Intergenic
965347918 3:167575223-167575245 GCTCAGTGTGGGGCAGCCTGTGG - Intronic
965403593 3:168243895-168243917 GCTATAGGTTGGGGTGGCTGTGG - Intergenic
966096128 3:176205474-176205496 GCTGAGGGTTGGGGTGGCTGTGG - Intergenic
966182894 3:177203192-177203214 GCTATGGGTGGGGCCAGATGAGG - Intergenic
966912491 3:184567180-184567202 ATTCTGGGTGTGGCTGGGTGCGG - Intronic
967759203 3:193204829-193204851 GCTCTGGGGAGGGGTGGCAGTGG - Intergenic
967880318 3:194297153-194297175 CCACTGGCTGGGGCTGGTTGTGG - Intergenic
967980279 3:195061305-195061327 GCTCTCTGTGGGACTGGCTGAGG + Intergenic
968442729 4:632642-632664 GATCTGCGTGGTGCTGTCTGGGG + Intronic
968610942 4:1556750-1556772 AGGCTGGGTGGGGCGGGCTGGGG - Intergenic
968613278 4:1566626-1566648 GTTCTGGGTGGGTGTGGCTCCGG + Intergenic
968613309 4:1566747-1566769 GTTCTGGGTGGGTGTGGCTCCGG + Intergenic
968658133 4:1787348-1787370 GCTGCGGGTGGGGCCGGGTGGGG + Intergenic
968913046 4:3485439-3485461 GCTCTTGGTGGAGTTTGCTGCGG + Intronic
968953630 4:3707295-3707317 GCTCTGGGTGCTGCTGGCTAGGG + Intergenic
968977866 4:3831234-3831256 GCTCTTGTTGGGGGTGGCAGTGG - Intergenic
968994435 4:3936740-3936762 CCACTGGGTGGGGCAGCCTGGGG + Intergenic
969104127 4:4792015-4792037 GCCCTGTGTGGAGCTGGCTTTGG + Intergenic
969174105 4:5385916-5385938 GCTGTGGGTGGGGCTGTGGGTGG - Intronic
969300640 4:6294974-6294996 GCTCTGTGTGAGGGTGGCAGTGG + Intronic
969471148 4:7389991-7390013 GCCTGGGGTGGGGCTGCCTGTGG + Intronic
969503559 4:7569948-7569970 GCTCTGGTAGCGGCTGGATGAGG + Intronic
969561595 4:7951538-7951560 GCTGGGAGAGGGGCTGGCTGCGG + Intergenic
969605336 4:8199573-8199595 GCTCTGAGTGGGGTCTGCTGAGG - Intronic
969618996 4:8269656-8269678 GGCCTGGGCGGGGCTGGCGGAGG + Intergenic
969666142 4:8558520-8558542 GGCCTGGGTGGGGCTGGGGGAGG - Intergenic
969819504 4:9709496-9709518 CCACTGGGTGGGGCAGCCTGGGG - Intergenic
970058509 4:12002342-12002364 GCTGGGGGTGGGGGTGGATGGGG + Intergenic
970312070 4:14793142-14793164 TCTTTGGGTGGGTCTTGCTGTGG - Intergenic
971231050 4:24800368-24800390 CCTCTGGGTGGAGAGGGCTGCGG - Exonic
971472300 4:27040292-27040314 CCCTTGGGTGGGGCTTGCTGTGG + Intergenic
973226435 4:47790220-47790242 CCTCTTCATGGGGCTGGCTGTGG + Intronic
973613462 4:52658451-52658473 CCTAAGGGTGGGGCGGGCTGTGG - Intronic
974003122 4:56530553-56530575 GCTCGGGGCGGGGCTGGGCGCGG + Intergenic
974410753 4:61538836-61538858 GCCCTGACTGGGGGTGGCTGGGG + Intronic
974459758 4:62172309-62172331 GCCCTGGGAGGGTGTGGCTGGGG + Intergenic
975019276 4:69467258-69467280 GCAATGGGTGGGTCTAGCTGTGG + Intergenic
975134671 4:70863076-70863098 GCTTGGGGTGGGGGTGGTTGAGG - Intergenic
975534591 4:75435874-75435896 TCTTTGGGTAGGGCTTGCTGTGG - Intergenic
975640436 4:76494754-76494776 CCTCTGTGTGGTGCTTGCTGTGG + Intronic
979037910 4:115748837-115748859 GCTCGGGGTGGGGCTAGGGGAGG - Intergenic
979448405 4:120840429-120840451 GCTCTGCGTGGGGCTGCCCAGGG - Intronic
980409953 4:132403974-132403996 TCTTTGGGTGGGACTTGCTGTGG + Intergenic
982451042 4:155552536-155552558 TCTTTGGATGGGGCTTGCTGCGG - Intergenic
983022816 4:162700207-162700229 AGTCTGGTTGGGGCTTGCTGTGG - Intergenic
983069741 4:163254250-163254272 GCTCTGGGGATGGCTGGGTGTGG - Intergenic
983425827 4:167582273-167582295 GCTGTGGGTGGGGCCGGATAAGG + Intergenic
983537863 4:168877790-168877812 GCGCTGCGCGGGGCTGGCGGAGG - Intronic
984544963 4:181090491-181090513 GCTCAAGGTTGGGGTGGCTGCGG + Intergenic
984729919 4:183058434-183058456 ACTCTGGTTTGGGCTGGGTGAGG - Intergenic
984758406 4:183343977-183343999 CCTCGGGCAGGGGCTGGCTGGGG + Intergenic
984781854 4:183533490-183533512 GCGGGGGGTGGGGGTGGCTGGGG + Intergenic
985421167 4:189786434-189786456 GCTCTGGGTGTGGAGGTCTGAGG - Intergenic
985579551 5:689653-689675 GCTCTGGGAGGGGGTGGCTCTGG + Intronic
985594397 5:781712-781734 GCTCTGGGAGGGGGTGGCTCTGG + Intergenic
985599336 5:818304-818326 AGTCTGGGCGGGGCAGGCTGGGG + Intronic
985615540 5:918329-918351 GCTCTGGGGGTGGCAGGTTGAGG + Intronic
985635909 5:1035830-1035852 GCAGTGGTTGGGGGTGGCTGGGG + Intronic
985677328 5:1238767-1238789 GTTCTGGGAGAGGCTGGCTGGGG + Intronic
985718155 5:1474485-1474507 GGTCTGGCGGGGGCTGCCTGGGG - Intronic
985720053 5:1484193-1484215 GCTCTAGCTGGGCCTCGCTGGGG - Intronic
985844375 5:2333435-2333457 GCTGTGGGTGTGTCTGGCTGTGG - Intergenic
985926657 5:3024677-3024699 GCTGGCGGTGGGGCAGGCTGGGG + Intergenic
985966622 5:3342925-3342947 GCTCTGGGATGTGGTGGCTGAGG - Intergenic
986408672 5:7453420-7453442 GCTGAAGGTGGGGGTGGCTGTGG - Intronic
988363626 5:30267645-30267667 GCTCAGGGTGCTGGTGGCTGGGG - Intergenic
989431545 5:41361058-41361080 TCCATGGGTGGGGCTTGCTGTGG + Intronic
990161907 5:52950331-52950353 GTTCTGGGTGGGTGTGGATGGGG + Intronic
991077636 5:62559145-62559167 GCTGTAGGTGTGGGTGGCTGTGG + Intronic
991559332 5:67932947-67932969 GATCTTGGTGGTGCTGGCTCTGG + Intergenic
992626965 5:78645096-78645118 GATCTGGCTGGGGCTGGGGGTGG - Intronic
992786300 5:80173669-80173691 GCTCTGGGTGGAGGTGGGTGGGG - Intronic
994239992 5:97408012-97408034 GATCTGGGTGGGGCCAGATGAGG + Intergenic
994887451 5:105582713-105582735 TCCTTGGGTGGGGCTTGCTGTGG - Intergenic
995022376 5:107381038-107381060 GCTGGGGGTGGGGCGGGGTGGGG + Exonic
995196168 5:109371240-109371262 GTGATGGTTGGGGCTGGCTGGGG - Intronic
997306129 5:132837972-132837994 CCTCTTGGTGAGGCTGGGTGAGG + Intergenic
997331194 5:133063210-133063232 TCACGGGGTGGGGGTGGCTGAGG - Intronic
997586184 5:135044979-135045001 GGTCAGGCTGGGGCTGGCTATGG + Intronic
997590716 5:135070474-135070496 GCTCTGGGGGGGCCTGACTTTGG + Intronic
998006772 5:138662286-138662308 CCTCTGTGTGGAGCTGGGTGTGG + Intronic
999011252 5:148043164-148043186 GCTCTGAGGGTGGCTGGCAGCGG - Intronic
999304671 5:150511879-150511901 GTGGTGGGTGGGGCAGGCTGTGG + Intronic
999326168 5:150645056-150645078 GCTCTGTGTGGGCCTCCCTGCGG + Intronic
999972247 5:156876419-156876441 AATCAGGGTGGGGCTGGCTATGG - Intergenic
1001922844 5:175613993-175614015 GCATTGGGTGCGGCTGGGTGAGG + Intergenic
1002051936 5:176576203-176576225 GGTGTGGGCGGGGGTGGCTGGGG + Intronic
1002070099 5:176674021-176674043 CCACTGGGTGGGGGTGGGTGAGG + Intergenic
1002196679 5:177504962-177504984 GCCCTGGGTGTGGGGGGCTGAGG + Intronic
1002255499 5:177955415-177955437 GCTCTGGGGGAGGGTGGCTCTGG + Intergenic
1002482552 5:179512662-179512684 GCTCTGGGGGAGGGTGGCTCTGG - Intergenic
1002488389 5:179555535-179555557 GCGCTGGGTGGTGCTGTCTCTGG - Intronic
1002534842 5:179870414-179870436 GCTCCAGGTAGGGCAGGCTGGGG + Exonic
1003086252 6:3063771-3063793 GCCCTGGGCGGGGCGGACTGGGG + Intergenic
1003291438 6:4782047-4782069 GCTCTGCGTGGAGGTGGGTGGGG + Intronic
1003614533 6:7642915-7642937 GCTCAGGGAGGGACAGGCTGTGG + Intergenic
1004204021 6:13574754-13574776 GCTCTGCGTGGGGGTCGCTGCGG + Intronic
1004289687 6:14355073-14355095 GGTCAGGGTGTGGCTGGGTGAGG - Intergenic
1004669863 6:17785576-17785598 GCAGTGGGTAGGGCTGACTGAGG - Exonic
1005885185 6:30092133-30092155 GCGCAGGGAGGGGCTGGATGAGG - Intergenic
1005896264 6:30181845-30181867 GCTCAGGTGTGGGCTGGCTGTGG + Intergenic
1005898230 6:30196127-30196149 GTTGTGGTTGGGGGTGGCTGAGG - Intronic
1005935612 6:30518598-30518620 GATGTGGGTGGGGCCGGATGGGG + Intergenic
1006154447 6:32006743-32006765 GCTCAGGGAGGGGCTGGGGGTGG - Intergenic
1006160760 6:32039479-32039501 GCTCAGGGAGGGGCTGGGGGTGG - Intronic
1006442921 6:34063242-34063264 ACTCTGGGTGGAGCTGCCAGGGG + Intronic
1006474962 6:34247680-34247702 GGTCGGGGTGGTGGTGGCTGTGG - Exonic
1006668722 6:35716427-35716449 GCTCTGGGAGGGGTGGGCAGAGG + Intronic
1006905818 6:37532789-37532811 GCACTGGGTGGGGAAGGCAGGGG + Intergenic
1007397674 6:41586915-41586937 GCCCTGGGAGGGGGTGGCCGCGG + Intronic
1007398336 6:41589867-41589889 GCTCTGGGAGGGGCGGGGAGGGG - Intronic
1007642540 6:43353989-43354011 ACTCTGGGAGAGGCTGGCAGGGG + Intronic
1007679810 6:43626272-43626294 GCTGCTGGTGGGGCTGGCTGAGG - Exonic
1007741511 6:44012695-44012717 TCTACAGGTGGGGCTGGCTGGGG - Intergenic
1008890393 6:56482127-56482149 CCTCTTGGAGTGGCTGGCTGAGG - Exonic
1009019799 6:57937827-57937849 GCTCTGCGGGAGGCTTGCTGGGG + Intergenic
1009736304 6:67680470-67680492 GAGCTGGGTGGGGCTGGTGGAGG - Intergenic
1010777201 6:79901079-79901101 GTTCTGGGGTGAGCTGGCTGTGG - Intergenic
1010817524 6:80376161-80376183 TCTCTGGGTGGGGCTTGCTGCGG + Intergenic
1011156624 6:84340805-84340827 TCTTTGGGTAGGGCTTGCTGTGG + Intergenic
1012203783 6:96436823-96436845 TCCTTGGGTGGGGCTTGCTGCGG - Intergenic
1013173039 6:107654730-107654752 GCTCTGGGGGAGGGTGGCTGAGG + Intronic
1013173050 6:107654773-107654795 GCTCTGAGGGAGGGTGGCTGAGG + Intronic
1013173070 6:107654858-107654880 GCTCTGGGGGAGGGTGACTGAGG + Intronic
1013633912 6:112010497-112010519 GCTCTGTGGGTGGCTGGTTGTGG + Intergenic
1014313180 6:119830686-119830708 TCCTTGGGTGGGGCTTGCTGTGG + Intergenic
1014559403 6:122872260-122872282 CCTCATGGTGGGGCTGCCTGGGG + Intergenic
1014826892 6:126056932-126056954 GCTCTGGGTTGGGCCCACTGAGG + Intergenic
1015631254 6:135234058-135234080 CCTCTGGATTGGGCTGGATGAGG + Intergenic
1015899854 6:138053259-138053281 TTTTTGGGTGGGGCTTGCTGTGG - Intergenic
1016183473 6:141175034-141175056 GCCCTCTCTGGGGCTGGCTGAGG + Intergenic
1016716792 6:147242480-147242502 GCTCTGGGTGAGTCTGTCAGTGG - Intronic
1018062796 6:160103662-160103684 GATGGGGGTGGGGCTGGCGGGGG + Intronic
1018733864 6:166673022-166673044 GCTCTGGGGAGGGCTGGGAGAGG - Intronic
1019159660 6:170061340-170061362 GCTGAAGGTGGGGGTGGCTGTGG - Intergenic
1019348435 7:541791-541813 GCTCAGGGTGGGGCACGCAGAGG + Intergenic
1019416183 7:927505-927527 AGTCTGGCTGGGCCTGGCTGCGG - Intronic
1019491584 7:1316276-1316298 GCACGCGGTGGGGCTGGCAGCGG + Intergenic
1019515386 7:1437735-1437757 GGTCTGGGTGGGCCAGGCGGGGG - Intronic
1019649668 7:2150087-2150109 TCCCTGAGTGGGGCTGGGTGGGG - Intronic
1019727801 7:2612575-2612597 GCTGTGGGCGGGGCGAGCTGTGG + Exonic
1019727819 7:2612640-2612662 GCTATGGGTGGGGTGAGCTGTGG + Exonic
1019933841 7:4241722-4241744 GCTCTGGCTTGGCGTGGCTGCGG + Intronic
1020318723 7:6925104-6925126 CCACTGGGTGGGGCAGCCTGGGG + Intergenic
1021006216 7:15397425-15397447 GCCCTCTGTGGGGCTGGCCGAGG - Intronic
1021284089 7:18757737-18757759 GCTCTGTGTGTGGGTGGGTGTGG + Intronic
1021486740 7:21175905-21175927 GCTCCCTGTGGGGCTGGCTGAGG + Intergenic
1021694223 7:23260728-23260750 GGTCTGGGTGGTGGTGGCGGTGG - Exonic
1021868443 7:24980447-24980469 GCACTGGGTGGGGCTCCCGGTGG + Intronic
1022046266 7:26624845-26624867 TCTGTGGGTGGTGCTGGCTTGGG + Intergenic
1022283761 7:28935614-28935636 GCTGGGGGTGGGGCAGGCAGAGG + Intergenic
1022454570 7:30547069-30547091 GTTCTGGGTGGAGGTGGGTGTGG - Intronic
1022495423 7:30850216-30850238 GCCCTGGGTGGGGCTGGTGAAGG - Intronic
1022717350 7:32910594-32910616 GCCCTAGGTGGGAATGGCTGAGG - Intergenic
1022925084 7:35048685-35048707 CCTCTGGTTGGGGGTGACTGGGG + Intergenic
1023240923 7:38146566-38146588 GCTGTGGGTGGTGATGCCTGGGG - Intergenic
1023356133 7:39369231-39369253 GCTGGAGGTTGGGCTGGCTGTGG - Intronic
1023780184 7:43647879-43647901 GCTCTGTGCTGGGCTGGCTGGGG - Intronic
1023968875 7:44977543-44977565 CATCTGGGTGGGGCTGGGTGGGG - Intronic
1024048497 7:45601375-45601397 GCCCTGAGTGTGGCTGGTTGTGG + Intronic
1024293640 7:47825963-47825985 CCTCTGGGGTGGGGTGGCTGGGG - Intronic
1024299064 7:47872193-47872215 GCTCTGGCTGGGGCAGACTGGGG - Intronic
1024633166 7:51265582-51265604 TCTGTGGGTGGCCCTGGCTGAGG - Intronic
1024639352 7:51316830-51316852 GCGCAGGGAGGGGCTGGCGGCGG + Intergenic
1025005221 7:55348803-55348825 CTTCTGGGTGGGGCCAGCTGGGG - Intergenic
1026019404 7:66696022-66696044 GAGCTGGGTGGGGCTGGACGTGG + Intronic
1026633093 7:72055230-72055252 GGGCTGGGTGGGGCAGGGTGAGG + Intronic
1027139645 7:75648122-75648144 GCTCCAGCTGAGGCTGGCTGGGG + Intronic
1028261690 7:88674198-88674220 TCCTTGGGTGAGGCTGGCTGTGG - Intergenic
1028962232 7:96761810-96761832 TCTTTGGGTGGGTCTTGCTGCGG + Intergenic
1029110980 7:98212886-98212908 GTCCTGGGTGGGGGTGGCGGTGG + Exonic
1029156346 7:98520610-98520632 GCTCTGGCTGGGAGTGGGTGCGG + Intergenic
1029156434 7:98520914-98520936 GCTCTGGCTGGGGGTGGGCGGGG + Intergenic
1029276065 7:99405061-99405083 GGTTTGGGTGGTGCTGGGTGAGG - Intronic
1029421207 7:100472706-100472728 GTGCTGGGTGGGGCTGGGCGGGG - Intronic
1029823099 7:103163393-103163415 CCTCTGGTTGGGGGTGACTGAGG + Intergenic
1029896792 7:103991083-103991105 GCTCTGCGGGGTGCAGGCTGTGG + Intergenic
1030527528 7:110672424-110672446 GATTTGGGAGGGGCTGGGTGTGG - Intronic
1031010248 7:116518972-116518994 GCTATGGGTTGGGTTGGCTGGGG - Intergenic
1031090419 7:117347897-117347919 TCCTTGGGTGGGGCTTGCTGTGG + Intergenic
1032061644 7:128730048-128730070 CCTATGGGTGGGGCCAGCTGTGG - Exonic
1032385699 7:131521794-131521816 CTTGCGGGTGGGGCTGGCTGGGG + Intronic
1032463108 7:132126306-132126328 GCTTTGGGTGGGGTAGGATGGGG + Exonic
1032485749 7:132286233-132286255 GCTCTGTGTGGGGCATGCAGTGG + Intronic
1032513384 7:132489731-132489753 GCGCTGGGAGGGGTTGGATGAGG - Intronic
1033345294 7:140521646-140521668 GTTCTGGGAGAGGCTGGCAGAGG + Intronic
1033657611 7:143383522-143383544 GCTGGGTGTGGGGCTGGGTGGGG + Intronic
1034286182 7:149884728-149884750 GCCCTGTGTGGGTCTGCCTGGGG - Intergenic
1034347657 7:150397221-150397243 GCCCCGAGTGGGCCTGGCTGGGG + Exonic
1034481022 7:151320632-151320654 GCTCTGTGCAGGGCTGCCTGGGG + Intergenic
1034706731 7:153152436-153152458 GCTCCCAGTGGAGCTGGCTGAGG - Intergenic
1034948348 7:155279124-155279146 GCCATGGGTGGGGCTCGCCGTGG - Intergenic
1035166870 7:156995971-156995993 GCTCAAGGTTGGGGTGGCTGTGG + Intronic
1035174405 7:157040099-157040121 GCTCCGGGGGGGGCTGGCTGGGG + Intergenic
1035436579 7:158864027-158864049 GCTCTGGGTGTGGCGGGGTGGGG + Intronic
1035542522 8:452982-453004 GCACTGAGTGGGGCAAGCTGGGG - Intronic
1035658985 8:1332884-1332906 GCTCTGGGTGTGTCTGGGAGTGG + Intergenic
1035702146 8:1644260-1644282 GCTCTTGGTCGGGCGGGCTTAGG - Intronic
1036591643 8:10173927-10173949 GCTGTGGGTTTGGTTGGCTGAGG + Intronic
1036642394 8:10592582-10592604 GCCCTGGGAGGGGCAGGCTGTGG - Intergenic
1036651875 8:10649480-10649502 GTCCTGGCTGGGGCAGGCTGTGG - Intronic
1037752683 8:21692900-21692922 GCTGTGCCTGAGGCTGGCTGGGG - Exonic
1037817086 8:22118017-22118039 GGGCTGGGTGTGGCTGGCCGTGG - Intronic
1037819377 8:22128383-22128405 GCTCAGGGTAGGGCTTGCTTGGG + Intronic
1037952533 8:23028314-23028336 GCTCAGGTAGGTGCTGGCTGAGG - Exonic
1037967490 8:23145651-23145673 GCTCAGGTAGGTGCTGGCTGAGG - Exonic
1037974595 8:23200488-23200510 GCTCAGGTAGGTGCTGGCTGAGG - Exonic
1038283698 8:26188436-26188458 GCTCTGGATGGGACTGGATATGG + Intergenic
1038492673 8:27981904-27981926 TTCCTGGGAGGGGCTGGCTGGGG - Intronic
1039920615 8:41891718-41891740 GCTCTGGGAGGCGCCGGCAGGGG - Intronic
1039926080 8:41933417-41933439 GCTCTGGGTGAGGCTGCTGGAGG + Exonic
1040038691 8:42896238-42896260 GCTCTAGGTGGGTTTGGCGGCGG - Exonic
1042884503 8:73532896-73532918 GCTGTGGAAGGGGCTGGGTGGGG - Intronic
1042995534 8:74693799-74693821 TCCTTGGGTGGGGCTTGCTGTGG - Intronic
1043034463 8:75178820-75178842 CCTCTCTCTGGGGCTGGCTGAGG - Intergenic
1044832194 8:96261593-96261615 GCGCTGTGTAGGGCGGGCTGAGG - Intronic
1045039791 8:98212651-98212673 GCTCTGGGTCTGGATGGCCGAGG - Intronic
1045111327 8:98941084-98941106 GCTCTGCGTGGCGCGGGCTGAGG - Intronic
1045470184 8:102505426-102505448 GCTGTGGGAGGGGATTGCTGGGG - Intergenic
1045680735 8:104657110-104657132 GGTCAGGGTGAGACTGGCTGAGG + Intronic
1045889468 8:107137293-107137315 GGTGGGGGTGGGGATGGCTGTGG + Intergenic
1046955965 8:120063199-120063221 GCTCAGGAGGGGGCTGGGTGTGG - Intronic
1047206303 8:122805148-122805170 GCGCTGGGTGGGGGTGGGGGTGG + Intronic
1047248812 8:123166497-123166519 GCTCTGCGTGGTGCTGACAGAGG + Intergenic
1047430289 8:124785261-124785283 GCTCGGGGTGGGGAGCGCTGAGG - Intergenic
1048122665 8:131599273-131599295 GCTACATGTGGGGCTGGCTGTGG - Intergenic
1048911580 8:139140445-139140467 ACACTGGATGGGGCTTGCTGTGG + Intergenic
1048965244 8:139610077-139610099 CCTCTGGGTGGTGGAGGCTGAGG - Intronic
1049098159 8:140560917-140560939 GCTGGGGCTGGGCCTGGCTGGGG - Intronic
1049532013 8:143159649-143159671 GCTCCGGGTGGGCCTGGGGGCGG + Exonic
1049579372 8:143404472-143404494 GCTCTGGGATGGACTGTCTGGGG - Intergenic
1049645478 8:143733917-143733939 GCGCGGGCTGGGGCTGGCGGCGG - Intergenic
1049659847 8:143815060-143815082 GAGAAGGGTGGGGCTGGCTGGGG + Intronic
1049766968 8:144359380-144359402 GATCTGGGTGGAGCTACCTGTGG + Exonic
1049766991 8:144359478-144359500 GATCTGGGTGGAGCTACCTGTGG + Intronic
1050133596 9:2439191-2439213 TCCTTGGGTGGGGCTTGCTGTGG + Intergenic
1050170430 9:2810100-2810122 GCGGTGGGGGGGGCTGGCGGGGG + Intronic
1050634175 9:7592691-7592713 GCTTTGGGGGAGGCTGCCTGAGG + Intergenic
1051819604 9:21149480-21149502 GCCCTGGTTGGGGAGGGCTGTGG + Intergenic
1051885653 9:21890098-21890120 TCCTTGGGTGGGGCTTGCTGTGG + Intronic
1052094634 9:24369458-24369480 GCTCTGGCAGGGGGTGGCTAGGG + Intergenic
1053201403 9:36153955-36153977 GGCCTGGGTGGGGCTGGGGGTGG - Intronic
1053345965 9:37378492-37378514 GGGCTGGATGGGGCTGGATGGGG - Intergenic
1053450668 9:38191835-38191857 CCTCTGGCTGCTGCTGGCTGCGG + Intergenic
1053786017 9:41653417-41653439 GCTCTTGGTGGGGCTGGGGTTGG - Intergenic
1054174733 9:61867350-61867372 GCTCTTGGTGGGGCTGGGGTTGG - Intergenic
1054662805 9:67713443-67713465 GCTCTTGGTGGGGCTGGGGTTGG + Intergenic
1054775458 9:69120854-69120876 GCTAAGGGTGAGGCTGGCGGGGG + Intergenic
1055065618 9:72115116-72115138 GTGCTGGTTGGGGCAGGCTGTGG + Intronic
1055555574 9:77470184-77470206 CCTCTGGGTGGGGAGGACTGGGG + Intronic
1055740387 9:79382127-79382149 CCTCTGGGAGGGGTGGGCTGGGG + Intergenic
1056116638 9:83447419-83447441 TCTCTGGTTGGTGCTGGCTAGGG - Intronic
1056733749 9:89186595-89186617 GCACTGGGTCAGGCTGGCTTTGG - Intergenic
1056757247 9:89389441-89389463 GCTCTGGGTGGGGCAAGTGGCGG + Intronic
1056948075 9:91017798-91017820 TCCTTGGGTGGGGCTTGCTGAGG - Intergenic
1057355483 9:94328074-94328096 CCTCTGGGTGGGCAAGGCTGGGG - Intronic
1057652272 9:96929548-96929570 CCTCTGGGTGGGCAAGGCTGGGG + Intronic
1057893870 9:98890683-98890705 GGTCTGGGAGGGGCTGAATGCGG + Intergenic
1058661058 9:107269398-107269420 GCTCTGGGTGGGGTGGGATGTGG - Intergenic
1059053461 9:110953335-110953357 GCTTTGGGTGTGGTTGGTTGTGG - Intronic
1059068562 9:111110412-111110434 GCTCTGGGATGGGCTGGCTCTGG - Intergenic
1059457700 9:114410115-114410137 TCTCTGGGAGGGCCTCGCTGAGG - Intronic
1059771924 9:117434750-117434772 TGGCTGGGTGGGGCTGGGTGGGG + Intergenic
1060151966 9:121294525-121294547 GCACTAGGTGGGGCTGGCTCCGG + Intronic
1060508706 9:124216806-124216828 GCTGTGGGTGGGGGTGTCCGGGG + Intergenic
1060523812 9:124309308-124309330 GATGTGGGTGGAGGTGGCTGGGG - Intronic
1060801376 9:126547792-126547814 GCTCTGGGTGGGGAGGGATGAGG - Intergenic
1060801767 9:126549547-126549569 GCGCGGGGTGGGGTGGGCTGGGG + Intergenic
1060973732 9:127753364-127753386 GCTCTGAGTGGGCAAGGCTGGGG + Intronic
1061023949 9:128035282-128035304 GCTCTGGGTGGGGACTGGTGAGG - Intergenic
1061063089 9:128260584-128260606 GCTCTGGGGGGAGCAGGCGGAGG - Exonic
1061264602 9:129497689-129497711 GCCCTGTGTGGGCCTGGCTGTGG - Intergenic
1061414419 9:130438589-130438611 GCTCTGGCTGTGGCTTGCTTGGG - Intergenic
1061429117 9:130519982-130520004 GTTCTGTGTGATGCTGGCTGGGG - Intergenic
1061431384 9:130533425-130533447 GGGCTGGGTGGGGGTGGATGAGG + Intergenic
1061517594 9:131098513-131098535 GCTCAGGGTCCCGCTGGCTGTGG - Intronic
1061578170 9:131520698-131520720 GCTCGGGGTGGGGCGGCCTCTGG - Intronic
1061579289 9:131527019-131527041 GCTCTGGGTGGGGCTGGGGCCGG + Intronic
1061777579 9:132975909-132975931 GGCCTGGGTGAGGCTGGCTGGGG + Intronic
1061871393 9:133522556-133522578 ACTCTGGGTGGGGCAGGGTGGGG + Intronic
1061917715 9:133763816-133763838 GCTCTGGGTGGGGCTAGCCCAGG + Exonic
1061922082 9:133787904-133787926 GCTGTGGGTAGGTCTGGCTGTGG - Intronic
1061923448 9:133794654-133794676 GCCCTGAGGGGGGCTGGCAGAGG + Intronic
1062063679 9:134514506-134514528 GCTCAGGGTGGGGCTGGGGTGGG - Intergenic
1062090658 9:134677054-134677076 GCTCTGGTTGTGGTTTGCTGGGG + Intronic
1062318426 9:135979092-135979114 GCTCCGGGTGGCTCTGGGTGGGG + Intergenic
1062318521 9:135979474-135979496 GCTCTGGCAGGGTCTGGCTGAGG - Intergenic
1062353240 9:136149232-136149254 GCTCAGCCTGGGGCTGCCTGTGG - Intergenic
1062383110 9:136297170-136297192 GCTGTGGGTGGCGTAGGCTGTGG + Intronic
1062413146 9:136434710-136434732 GCTGTGGGTGGTGCTGGGCGGGG - Intronic
1062448292 9:136604879-136604901 GGCCTGGGTGGGGCTGGGGGAGG - Intergenic
1062502975 9:136859126-136859148 GTTCCAGGTGAGGCTGGCTGTGG + Exonic
1062572116 9:137190535-137190557 GCTCAGGGTGGGGCTGGCCTGGG - Intergenic
1062641661 9:137521770-137521792 GCTCTGTGTGGTGCTGCCGGGGG - Intronic
1185672581 X:1824574-1824596 GTTAGGGGTGGGGCTGGGTGAGG - Intergenic
1185672767 X:1825501-1825523 GTTGGAGGTGGGGCTGGCTGAGG - Intergenic
1185672777 X:1825559-1825581 GTTAGGGGTGGGGCTGGGTGAGG - Intergenic
1185672967 X:1826429-1826451 GTTAGGGGTGGGGCTGGGTGAGG - Intergenic
1185673033 X:1826716-1826738 GTTAGGGGTGGGGCTGGGTGAGG - Intergenic
1185673061 X:1826832-1826854 GTTAGGGGTGGGGCTGGGTGCGG - Intergenic
1186308385 X:8289941-8289963 TCCTTGGGTGGGGCTTGCTGTGG - Intergenic
1186673680 X:11793505-11793527 GCTCTGGGAGGGACTGTCTCTGG + Intergenic
1187391199 X:18887540-18887562 GATCTGGGCTTGGCTGGCTGAGG - Intergenic
1187415758 X:19092134-19092156 GCTGTGGATTGGGCTGGCAGAGG - Intronic
1187727421 X:22217979-22218001 GCTCTGTATGGTGCTGGCCGGGG + Intronic
1188719009 X:33500123-33500145 TCTTTGGGTGGGGCTTGCTAAGG - Intergenic
1189106258 X:38238808-38238830 GTTCTTTGTTGGGCTGGCTGAGG - Intronic
1189216200 X:39326953-39326975 GCTCTGGGAGGGGAAGGCTTTGG - Intergenic
1189291514 X:39889224-39889246 GCTCGGGGAGGGGCTGCTTGTGG - Intergenic
1189962167 X:46333940-46333962 TCTTTGGGTGGGTCTTGCTGTGG - Intergenic
1190108006 X:47572943-47572965 GGCCTGGGCGGGGCTGGCTCTGG + Exonic
1190233785 X:48601114-48601136 GATCTGGGTTGGCCTTGCTGTGG + Intronic
1192261814 X:69510231-69510253 GCACTGGATGGGGAGGGCTGGGG + Intronic
1192522662 X:71815587-71815609 GTTCTGAGTTGGGCTGGCAGTGG - Intergenic
1192596117 X:72410160-72410182 GGTCTGGGTGGAGCTAGCTGAGG + Intronic
1192776314 X:74249212-74249234 GCTCTGGTGGGTGGTGGCTGTGG - Intergenic
1192994560 X:76498983-76499005 TCCTTGGGTGGGGCTTGCTGTGG + Intergenic
1193007928 X:76642202-76642224 TATTTGGGTGGGGCTTGCTGTGG + Intergenic
1193196952 X:78643586-78643608 TCCCTGGGTGGGGCTTGCTGTGG - Intergenic
1196218905 X:113088398-113088420 TCTTTGGGTGGGTCTTGCTGTGG - Intergenic
1196225182 X:113157868-113157890 TCTTTGGGTGGGTCTTGCTGTGG + Intergenic
1196463733 X:115952810-115952832 GATCTGGGCGGGACTGGCAGAGG - Intergenic
1196866768 X:120077733-120077755 GCTGTGGGTTGGGCCTGCTGAGG + Intergenic
1196866869 X:120078386-120078408 GCTGTGGGTTGGGCCTGCTGAGG + Intergenic
1196876230 X:120157896-120157918 GCTGTGGGTTGGGCCTGCTGAGG - Intergenic
1196876331 X:120158548-120158570 GCTGTGGGTTGGGCCTGCTGAGG - Exonic
1197699858 X:129591184-129591206 GCTCTAGATGGGCCTGCCTGAGG - Exonic
1197792354 X:130268654-130268676 GTTCTGAGGGCGGCTGGCTGAGG - Intronic
1198099635 X:133413544-133413566 TCTCCGGGTGGGGCGGGCAGGGG - Intronic
1198209940 X:134507320-134507342 GCTCCCCGTGGGGTTGGCTGAGG - Intronic
1198750566 X:139933089-139933111 GGCCTGGGTGGGGCGGGGTGGGG - Intronic
1198943283 X:141982238-141982260 TTTTTGGGTGGGGCTTGCTGCGG + Intergenic
1199059619 X:143339507-143339529 ACCATGGGAGGGGCTGGCTGTGG - Intergenic
1199411764 X:147532252-147532274 GCTCTGTGTGGTGGTGGGTGGGG - Intergenic
1199586839 X:149423662-149423684 TCCTTGGGTGGGGCTAGCTGTGG - Intergenic
1199600573 X:149539336-149539358 GCTGTGGGTGGAGCTGGGGGAGG - Intergenic
1200162467 X:154016548-154016570 GCTCTGGCTGGGGCTGGACCCGG + Exonic
1200817677 Y:7550362-7550384 GCTCTTGGTGATGATGGCTGAGG - Intergenic