ID: 1144849654

View in Genome Browser
Species Human (GRCh38)
Location 17:18237635-18237657
Sequence CAGGCACTGCACCAGGACAC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 387}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144849654_1144849661 19 Left 1144849654 17:18237635-18237657 CCCGTGTCCTGGTGCAGTGCCTG 0: 1
1: 0
2: 3
3: 35
4: 387
Right 1144849661 17:18237677-18237699 CTGTCACACTCCACACCGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 60
1144849654_1144849663 29 Left 1144849654 17:18237635-18237657 CCCGTGTCCTGGTGCAGTGCCTG 0: 1
1: 0
2: 3
3: 35
4: 387
Right 1144849663 17:18237687-18237709 CCACACCGAGTGGAGCCTCGTGG 0: 1
1: 0
2: 2
3: 7
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144849654 Original CRISPR CAGGCACTGCACCAGGACAC GGG (reversed) Exonic
900463082 1:2810625-2810647 CAGGCCCTGCACAGGGGCACAGG - Intergenic
901150562 1:7098546-7098568 CAGACACTCCATCAGGATACAGG - Intronic
901240660 1:7691297-7691319 CAGGCAGTGAATCAGGCCACAGG + Intronic
903400089 1:23036993-23037015 CATGCACCACACCAGGCCACTGG - Intronic
903854912 1:26331394-26331416 CAACCCCTGCACCAGCACACAGG + Intronic
904097741 1:27994680-27994702 CAGCCACTGCACCTGGCCAGGGG - Intronic
904339897 1:29827978-29828000 CAGGCAATGCACCAGGCATCAGG + Intergenic
904559784 1:31388697-31388719 CAGGCATCCCACCAGGGCACAGG + Intergenic
904612148 1:31731653-31731675 CGGGACCTGCACCAGGACACTGG - Intronic
905167432 1:36091277-36091299 CAGGGACTGCACCAGGGCCCTGG - Exonic
906343424 1:45000901-45000923 CAGGCACTGCACTAGGTGAATGG - Intergenic
906459695 1:46027905-46027927 AAGACACTGCGCCAGGACAAGGG - Intronic
906475693 1:46167869-46167891 GAGTCACTGCACCCGGCCACAGG - Intronic
906791050 1:48659110-48659132 CAGGAATTCCACCAGGTCACTGG - Intronic
907457615 1:54585537-54585559 CAGGCACTGTTCCAGGACTGGGG + Intronic
908857004 1:68441922-68441944 CAGGCACTGTATCAGGGCTCAGG + Intronic
911189360 1:94932512-94932534 GAGCCACTGCACCAGGCCAGGGG - Intergenic
911582009 1:99644832-99644854 CAAGGACTGCCCAAGGACACGGG - Intergenic
912846439 1:113079058-113079080 GAGCCACCGCACCAGGTCACAGG - Intronic
915723157 1:157998780-157998802 CAGGCAGTTCCCCAGGGCACAGG - Intronic
916342255 1:163749632-163749654 AGGGCACTGCACCTGGCCACAGG - Intergenic
917536145 1:175876064-175876086 CAGGCGCTGACCCAGTACACTGG + Intergenic
921834218 1:219761035-219761057 TAGATACTGCACCAGAACACAGG + Intronic
922210597 1:223483651-223483673 CAGGCACTGACCCAGGCCCCAGG + Intergenic
922548065 1:226473409-226473431 CAGGCACTGTGCTTGGACACTGG + Intergenic
922762016 1:228139200-228139222 GAGCCACTGCACCTGGCCACGGG - Intergenic
922875968 1:228940197-228940219 AAGGCACTGGACAAGGACACAGG + Intergenic
924893462 1:248309701-248309723 CAGGAAATGCTCCAGGACATTGG - Intergenic
1062910691 10:1209778-1209800 CATTCAGTGCACCAGGGCACAGG - Intronic
1063128389 10:3155286-3155308 CACGCACTGCAGCAGAACAATGG + Intronic
1064295393 10:14074520-14074542 TGGGCATTGCGCCAGGACACAGG - Intronic
1064436704 10:15317108-15317130 CAGTCACGGAAACAGGACACAGG + Intronic
1064615518 10:17151401-17151423 CAGTCACAGAACCAGGACAGAGG + Intronic
1067077501 10:43196575-43196597 CAGACACTGCATGGGGACACAGG - Intronic
1067221635 10:44348152-44348174 AAGGCACTGAACCTGGACATAGG + Intergenic
1067404368 10:46007871-46007893 GAGCCACTGCACCTGGCCACTGG + Intronic
1067497287 10:46772946-46772968 CTGGCCCTGCTCCAGGACTCAGG + Intergenic
1067597365 10:47567469-47567491 CTGGCCCTGCTCCAGGACTCAGG - Intergenic
1067755228 10:49000102-49000124 CTGGCACTGCAGCAGGAGTCAGG - Intergenic
1069033766 10:63627251-63627273 GAGCCACTGCACCCGGTCACAGG - Intergenic
1069717681 10:70531411-70531433 CAGGCTCTCCACCCGGACCCCGG - Exonic
1073123072 10:101133656-101133678 CAGGCACGGGACAAGCACACAGG - Intronic
1073620159 10:105038337-105038359 CAGGCAATGCATCAGCTCACAGG - Intronic
1074057783 10:109938378-109938400 CAGGCACTGCTCCGGGGCACTGG - Intergenic
1074947663 10:118296913-118296935 CAGGCACTGTACTAGGTCATGGG - Intergenic
1075977604 10:126709162-126709184 AAGGCAATACACCAAGACACTGG - Intergenic
1076444949 10:130507869-130507891 CAGGCAGTGGATCAGGACAGAGG - Intergenic
1076579394 10:131496531-131496553 CAGGCTCTGCACATGGACCCAGG + Intergenic
1076745419 10:132510358-132510380 CAGGCACGGGACCAGGCCCCAGG - Intergenic
1077164159 11:1127587-1127609 CAGGGGCGGCACCAGGGCACTGG - Intergenic
1077249552 11:1555026-1555048 CTGGCCCTGCTCCAGGACTCAGG + Exonic
1077505406 11:2927879-2927901 CAGGTACTGGCCCAGGACATTGG - Intergenic
1077646424 11:3929456-3929478 CAGCCACTCCACCAGGAGAGAGG - Intronic
1078424519 11:11238484-11238506 CAGGCTCTGCAGCAGCACATGGG - Intergenic
1080572399 11:33568127-33568149 CAGGCGCTGCTCCATGACCCGGG - Exonic
1080586046 11:33683519-33683541 CAGACACTGTGCCAGGAGACAGG + Intergenic
1081761156 11:45577181-45577203 CAGGCACTGCACCAGGCACCAGG - Intergenic
1081866067 11:46361454-46361476 CAGGCCCTGCAGCAGGCGACGGG - Intronic
1083225792 11:61283681-61283703 GAGCCACTGCACCTGGCCACTGG + Intronic
1083418278 11:62539359-62539381 CTGGCACAGCACCAGGATGCTGG - Intronic
1084040066 11:66537412-66537434 CAGGAACTCCACCAGGACCATGG - Intronic
1084155996 11:67312801-67312823 CAGGCCCTGCCCCAGGAGATGGG - Intergenic
1084562743 11:69913657-69913679 CAGGCACTGCAACAGGGCCCGGG - Intergenic
1084876116 11:72135229-72135251 AAGGCCCTGCAACAGGACAGAGG + Intronic
1084880983 11:72171708-72171730 AAGGCCCTGCAACAGGACAGAGG + Intergenic
1085026109 11:73237610-73237632 GAGCCACTCCACAAGGACACAGG + Intergenic
1085033305 11:73285703-73285725 CAGGCAATGAAACAGGACAGAGG + Intronic
1085530689 11:77190444-77190466 CAGGCACTGCCACAGGCCAGGGG - Intronic
1086202237 11:84217881-84217903 GAGCCACTGCACCAGGCCACAGG - Intronic
1087192517 11:95269937-95269959 CAGGCAGTGAACCAGCTCACAGG + Intergenic
1090431836 11:126652778-126652800 CAGGCAATTCACCAGGACAGAGG + Intronic
1090934165 11:131327005-131327027 CAGGCTCTGCATCAGGGCAGAGG - Intergenic
1091400383 12:177501-177523 CAGCCACTGCACCAACCCACGGG - Exonic
1091409689 12:231107-231129 CAGGCACAGGGCCAGGACCCGGG + Intronic
1093718803 12:22414312-22414334 GAGCCACTGCACCTGGACTCAGG - Intronic
1094345178 12:29460471-29460493 CAGGCACAGAGCCAGGACATGGG - Intronic
1095096693 12:38152985-38153007 CAGCCCCTGCGCCAGGACAGTGG + Intergenic
1096517744 12:52166508-52166530 CAGGCATTGCACCAGCACCTGGG + Intergenic
1097174842 12:57136523-57136545 CAGGCACTGCACTAGGCATCAGG - Intronic
1101143684 12:101821323-101821345 CAGGCACTCTGCCAGGGCACAGG + Intronic
1101828605 12:108240178-108240200 CAGGCACTGTGCTAGGACCCCGG - Intronic
1101878254 12:108609523-108609545 CAGGCACTCCACAAGGCTACGGG + Intergenic
1102246302 12:111358501-111358523 GAGCCACTGCACCTGGCCACAGG + Intergenic
1103139234 12:118534337-118534359 CATGCACTTCACCAAGAAACTGG + Intergenic
1104431124 12:128717233-128717255 CAGGTACTGCACCTGGACTGTGG - Intergenic
1104725975 12:131075965-131075987 CAGCGACTCCACCAGGACCCAGG - Intronic
1104987331 12:132604260-132604282 CAGGCACTGGGCCAGGATCCCGG + Exonic
1105048667 12:133028315-133028337 CAGCCACTGCACCGACACACTGG - Intergenic
1105070889 12:133234016-133234038 CCGGCACTGCAGCAGTACCCAGG - Intronic
1106023843 13:25939409-25939431 CAGGCACAGGACCAGGACGGAGG + Intronic
1106206405 13:27600111-27600133 CAGGCACTGCACCAGAGGATAGG + Intronic
1107013817 13:35693592-35693614 CAGCCACTCCACCATGACAGGGG + Intergenic
1107721751 13:43256215-43256237 GAGGAAATGCTCCAGGACACTGG + Intronic
1108023217 13:46150722-46150744 GAGACACTGCACTAGGACTCTGG + Intronic
1108413651 13:50175734-50175756 TAGCCATTGCACCAGGGCACAGG - Intronic
1109297865 13:60556918-60556940 CAGCCACTGCACCCGGCCTCTGG - Intronic
1109516767 13:63453273-63453295 GAGGAAATGCACCAGGACACTGG + Intergenic
1112989561 13:105495532-105495554 AAGGCACTTCACCAGGAATCTGG - Intergenic
1112991206 13:105515773-105515795 CAGACACTGGACAAAGACACTGG + Intergenic
1113432338 13:110261803-110261825 CAGGCACTGCACCAGGCCCGGGG - Intronic
1113905171 13:113815993-113816015 CAGTCACTGCTCAGGGACACGGG + Exonic
1113905182 13:113816069-113816091 CAGTCACTGCTCAGGGACACGGG + Exonic
1115279757 14:31648396-31648418 CAGTCAGTGCATCAAGACACAGG - Intronic
1115754285 14:36517693-36517715 CAGCAACTGCAGCAGGACAGCGG - Exonic
1115813046 14:37131956-37131978 GAGCCACTGCACCAGCCCACGGG + Intronic
1117106201 14:52399360-52399382 CAGAGACTGCACTAGAACACTGG - Intergenic
1117807497 14:59509448-59509470 CAAGCAATGCCCCAGAACACAGG + Intronic
1118817649 14:69324371-69324393 CAGATACTGCACCAGGCCCCAGG - Intronic
1119206585 14:72799011-72799033 AATGCACTGCCTCAGGACACAGG - Intronic
1119739558 14:77005329-77005351 CAGGCACAGGAACAGGGCACCGG + Intergenic
1119803257 14:77464092-77464114 GAGCCACTGCACCTGGCCACTGG - Intronic
1120867938 14:89311540-89311562 GAGCCACTGCACCCGGCCACAGG - Intronic
1121016925 14:90554528-90554550 CTGGCACAGCACCAGGACATTGG - Intronic
1121539442 14:94714030-94714052 CAAGCACAGCACCAGCACCCAGG + Intergenic
1122455871 14:101850721-101850743 CAGACACTGCTCTAGGACACAGG + Intronic
1122622885 14:103069921-103069943 CAGGCTGTACACCAGGACACAGG + Intergenic
1123020930 14:105397635-105397657 GAGGCACTGAACCAGGACACTGG - Exonic
1123123599 14:105929359-105929381 CAGGCCCTGGACAAGGAAACAGG - Intronic
1123151961 14:106190684-106190706 TAGCCACTGCACCTGGTCACTGG - Intergenic
1123457499 15:20439279-20439301 ACGGCTCTTCACCAGGACACAGG + Intergenic
1123457526 15:20439403-20439425 ACGGCTCTTCACCAGGACACAGG + Intergenic
1123660572 15:22561142-22561164 ACGGCTCTTCACCAGGACACAGG - Intergenic
1123904180 15:24905872-24905894 CAGGAAGTTCACCAGAACACTGG - Intronic
1124458388 15:29865917-29865939 CAGGCACTGTGCTAGGAGACAGG + Intronic
1125740229 15:41957651-41957673 CAGGCACAGCACCATCACCCTGG + Intronic
1127261697 15:57331378-57331400 CTGGGGCTACACCAGGACACTGG + Intergenic
1127716073 15:61650531-61650553 CAGGCACTGCACTAGGTCCCAGG - Intergenic
1127903112 15:63355598-63355620 CAGGCTCTGCAGCAGGAGCCAGG - Intronic
1128022615 15:64405436-64405458 GAGCCACTGCACCCGGCCACTGG + Intronic
1128265767 15:66265538-66265560 CAGGCACTGCAGCATAACGCTGG - Intergenic
1128805565 15:70528477-70528499 CAGGCACTGACCCAGGGCACAGG + Intergenic
1129994967 15:79996561-79996583 AAGCCACTGCACCCGGACCCAGG + Intergenic
1130235766 15:82132214-82132236 CTGCCTCAGCACCAGGACACAGG - Intronic
1130561456 15:84962687-84962709 GAGTCACTGCACCAGGCCAAGGG + Intergenic
1130976247 15:88777589-88777611 GAGCCACTGCACCCGGCCACTGG + Intergenic
1132301981 15:100781683-100781705 CAGGCACTGCACCAGCCCAGGGG + Intergenic
1132574237 16:657307-657329 CAGTCGGTGCACCAGGAAACCGG - Intronic
1133763959 16:8822276-8822298 CAGATACTGCATCAGAACACAGG + Intronic
1134001467 16:10786287-10786309 AAGCCACTGCACCTGGCCACAGG - Intronic
1134026523 16:10958236-10958258 CAGGGACTCCCCCAGGGCACAGG - Intronic
1134318417 16:13140459-13140481 CAGCCACTGCACCTGGCCAATGG + Intronic
1134458641 16:14413080-14413102 GAGCCACTGCACCCGGCCACTGG + Intergenic
1136704101 16:32171891-32171913 CAGGCACGGCATCAGAACTCAGG + Intergenic
1136763808 16:32757516-32757538 CAGGCACGGCATCAGAACTCAGG - Intergenic
1136804291 16:33112870-33112892 CAGGCACGGCATCAGAACTCAGG + Intergenic
1137249988 16:46734327-46734349 GAGCCACTGCACCTGGCCACAGG - Intronic
1137617797 16:49857344-49857366 CGGGCACCGCACCAGCACGCGGG + Intronic
1138171558 16:54854823-54854845 CAGGTACTGCACCAGGGAAGAGG + Intergenic
1138302760 16:55946332-55946354 AAGGCTCCCCACCAGGACACAGG - Intronic
1138406662 16:56800690-56800712 CTGGCATTTCAGCAGGACACTGG - Intronic
1138999531 16:62492642-62492664 CGGGTACACCACCAGGACACAGG + Intergenic
1139699456 16:68698686-68698708 CAGGCCCAGGCCCAGGACACAGG - Exonic
1141637315 16:85321157-85321179 CAGGAACTGTTCTAGGACACCGG - Intergenic
1141797313 16:86283982-86284004 GAGGCACTGCCCCAGGCCAAGGG + Intergenic
1142232530 16:88906533-88906555 GGGCCATTGCACCAGGACACTGG - Intronic
1142717200 17:1753763-1753785 CAGGCACTGTACCAGGTACCGGG + Intronic
1143884537 17:10056088-10056110 CAACCACTGCACCCGGACATTGG - Intronic
1144849654 17:18237635-18237657 CAGGCACTGCACCAGGACACGGG - Exonic
1146084933 17:29818940-29818962 GAGCCACTGCACCTGGCCACTGG - Intronic
1146279154 17:31533846-31533868 CTGGCACTGCAGCAGGTCCCGGG - Exonic
1147014885 17:37483660-37483682 CAGACACTGCTCCAGGGCTCTGG + Intergenic
1147612119 17:41807999-41808021 CATTCACTGCAGCAGGACAGGGG + Exonic
1148203856 17:45767445-45767467 CAGGTACTGCGCCAGGCCCCTGG - Intergenic
1148208876 17:45796281-45796303 CAGGCACTGGATCAGAACCCTGG + Intronic
1148426195 17:47598862-47598884 GAGCCACTGCACCAGGCCATTGG - Intronic
1148428205 17:47619267-47619289 GAGCCACTGCACCTGGCCACAGG - Intronic
1148748153 17:49929858-49929880 CAGGTAATGCACCAGGACCCGGG - Intergenic
1149452592 17:56761386-56761408 CAAGCCCTGGGCCAGGACACAGG - Intergenic
1150441983 17:65198538-65198560 GAGCCACTGCACCAGGACTGTGG + Intronic
1151060306 17:71084490-71084512 TAAGCAAAGCACCAGGACACAGG - Intergenic
1152517182 17:80832424-80832446 CAGACACTGCCACAGGACAGGGG - Intronic
1152699587 17:81812367-81812389 CAGACAGGACACCAGGACACTGG + Intronic
1152860015 17:82691071-82691093 CAGGCCCTGCACCTGCACCCCGG + Intronic
1152908807 17:82985114-82985136 CAGGCACCACCCCAGGCCACTGG + Intronic
1153615535 18:6929911-6929933 CAACCACTGCTCCAGGCCACGGG + Intergenic
1154220463 18:12448965-12448987 GAGACACTGAACCAGGGCACTGG + Exonic
1154450850 18:14474223-14474245 CAGGCCCTAGACCAAGACACGGG + Intergenic
1154968578 18:21383996-21384018 GAGCCACTGCACCCGGCCACTGG + Intronic
1155153800 18:23142097-23142119 CAGACCCTGCAGCAGGCCACAGG - Intronic
1155351861 18:24914843-24914865 CTAGCACAGCACCAGGACTCAGG + Intergenic
1157336108 18:46738723-46738745 CAGGCACAGCCCCAGGAGATTGG - Intronic
1157490738 18:48121980-48122002 CAGGGACTGCAGCATGTCACTGG - Intronic
1157560297 18:48640721-48640743 CATGCCCTGCACCAGGGCCCAGG + Intronic
1157745335 18:50130117-50130139 CAGGCAGGCCACCAGGAGACTGG + Intronic
1161238283 19:3208535-3208557 CAGGCACTGGCTCAGGACTCAGG - Exonic
1162080023 19:8212254-8212276 AAGGGACTGCACCAGGCCAGGGG + Intronic
1162145914 19:8611898-8611920 CAGGCACTGTACCAGGCGCCTGG - Intergenic
1162233353 19:9284990-9285012 GAAGCACTGCCCCAGGACACTGG - Intergenic
1162305451 19:9870519-9870541 CAGGCACTGAACCAGGATGTAGG + Intronic
1163746808 19:19053681-19053703 GAGGCGCTGCACCAGGAAGCAGG - Intronic
1164073180 19:21788206-21788228 TAGGCACTGGGCCAAGACACTGG + Intergenic
1164426499 19:28146470-28146492 CAAGCATTGTACCAGGACACAGG - Intergenic
1164982752 19:32626595-32626617 GGGGCACAGCACCAGGAGACAGG + Intronic
1165309178 19:35020252-35020274 AAGCCACTGCACCTGGACCCTGG - Intronic
1165356875 19:35309913-35309935 CAGGCACTGCACCGTGTCTCGGG - Exonic
1167254112 19:48417027-48417049 GAGCCACTGCACCCGGACAAGGG + Intronic
1167312227 19:48743640-48743662 AAGGCACAGGACCAGGACGCAGG + Intronic
1167963754 19:53127305-53127327 CAGGCACTGCCTGAGGACACAGG + Intronic
1168140581 19:54384141-54384163 GAGCCACTGCACCCGGCCACAGG - Intergenic
1168527931 19:57103629-57103651 CAAGCACTCCAACAGGACGCCGG - Intergenic
925833621 2:7920528-7920550 CAGGCACTGTTCCTGGGCACTGG - Intergenic
926141627 2:10371527-10371549 CCCTCACTGCAACAGGACACAGG - Intronic
927205733 2:20609187-20609209 CAGGCGCTGCATCAGGATCCTGG + Intronic
928167627 2:28982280-28982302 CAGTCACTTCTCCAGGACAAGGG + Intronic
928380055 2:30809915-30809937 CAGGCACTGCACCAGGCTCAGGG + Intronic
929657081 2:43744581-43744603 AAGCCACTGCACCCGGACACAGG - Intronic
930047233 2:47183442-47183464 GAGCCACTGCACCAGGCCAGGGG + Intergenic
930053508 2:47235012-47235034 CAGGGACTGCATCAGCACAGGGG - Intergenic
932319507 2:70811414-70811436 CAGGCAGGGCACCAAGGCACAGG - Intronic
932635043 2:73380673-73380695 CAGGCACTGTACTAGGAAACAGG - Intergenic
933745313 2:85566441-85566463 GAGCCACTGCACCAGGCCAAAGG + Intronic
934614927 2:95764863-95764885 CAGGTGCTGCACAAGGCCACAGG - Intergenic
934645976 2:96059624-96059646 CAGGCGCTGCACAAGGCCACAGG + Intergenic
934839379 2:97615714-97615736 CAGGTGCTGCACAAGGCCACAGG + Intergenic
935619479 2:105116561-105116583 CAGGCACTGCACAGGGCCATGGG - Intergenic
935984006 2:108654760-108654782 TAAACACTGCACCAGGAGACCGG - Intronic
936024686 2:109022153-109022175 CAGCCACTGCCCCTGGATACAGG - Intergenic
936136442 2:109898414-109898436 TAAACACTGCACCAGGAGACCGG - Intergenic
936208255 2:110473071-110473093 TAAACACTGCACCAGGAGACCGG + Exonic
938207609 2:129437546-129437568 CAGGCAGCTCAGCAGGACACAGG + Intergenic
938763654 2:134446116-134446138 CAGACGCTTCACCAGGCCACAGG - Intronic
939640039 2:144629218-144629240 CAGGCTCTACCCCAGAACACTGG - Intergenic
947543518 2:230994626-230994648 GAGCCACCGCACCAGGCCACTGG + Intergenic
947709900 2:232307081-232307103 CAGGCACGGCACAGGGCCACGGG - Intronic
948184951 2:236013793-236013815 AAGGCACAGCCCCAGGTCACAGG - Intronic
948197458 2:236106386-236106408 CAGGCACTGCGGCAGCGCACAGG + Intronic
948785487 2:240350228-240350250 CAGGCACTGTCCCAGGCCCCAGG - Intergenic
948975443 2:241460880-241460902 GAGGCACAGCACCTGGGCACTGG + Intronic
1169809684 20:9596820-9596842 TACGCACTGCATTAGGACACGGG - Intronic
1170406794 20:16046557-16046579 CTGGCACTTCATCTGGACACTGG - Intronic
1171275689 20:23855183-23855205 GAGGGCCTGCACCAGGAGACGGG - Intergenic
1171769493 20:29311508-29311530 AAGCCACTGCACCTGGACTCCGG - Intergenic
1172301635 20:33854624-33854646 CTGGCACTGCCCATGGACACTGG - Intergenic
1172554699 20:35830884-35830906 AAAGCACTGCAGCAGGACAGGGG - Intronic
1172982373 20:38953590-38953612 CTGCCACTGGACCAGGAAACTGG - Intergenic
1173822082 20:46026005-46026027 CATCCACTGAACCAGGACAAGGG - Intronic
1174311783 20:49661694-49661716 CAGGCACCGTACGAGGGCACTGG + Intronic
1174422548 20:50409079-50409101 CAGGCACTGCACTAGGAGGTTGG - Intergenic
1177218816 21:18164145-18164167 CAGACACAGCAACAGGACCCAGG + Intronic
1179170513 21:38969406-38969428 CAGGCTCTGGACCAATACACAGG + Intergenic
1179594177 21:42431017-42431039 TAAGCCCTGCACCAGGACCCTGG - Intronic
1179615324 21:42579719-42579741 CAGGAACTGCACCAAAACAAAGG - Exonic
1179631383 21:42680579-42680601 CAGGCAGTGCAGGAGGGCACAGG - Intronic
1180144557 21:45912109-45912131 CTGGCACTGCACCGGGACGCAGG - Intronic
1180179595 21:46111901-46111923 CAGGCACGGGGCCAGGAAACGGG + Intronic
1180688092 22:17686169-17686191 CAGGCACCGCACCTGGTCTCGGG - Intronic
1181740757 22:24919691-24919713 TATCCACTGCACCAGGGCACAGG + Intronic
1181951672 22:26558279-26558301 CAGGCACTGGGCCACAACACTGG + Intronic
1182228203 22:28816440-28816462 GAGCCACTGCACCAGGCCAGAGG - Intergenic
1182367516 22:29788995-29789017 CTGGCCCTGCACCAGGTCTCAGG + Exonic
1183304759 22:37076644-37076666 CAGCCACTCCCCCAGGACAGTGG + Intronic
1183346757 22:37312348-37312370 CAGGCCAGGCCCCAGGACACAGG + Intronic
1183426840 22:37744598-37744620 AGGGCACTGGACCAGGACCCTGG + Intronic
1183602985 22:38850786-38850808 CAGCCACTGCACTTGGAGACAGG + Intergenic
1183956916 22:41386152-41386174 GAGCCACTGCACCTGGCCACAGG - Intronic
1184427754 22:44423211-44423233 CAGGCCCTGCACCAGGCCTGGGG - Intergenic
949836717 3:8278113-8278135 CAGGCTCTGCAGCACTACACTGG - Intergenic
949945951 3:9190351-9190373 CAGGCAATTCAGCAGGACTCAGG + Intronic
950181288 3:10915231-10915253 CTGCCACTGCCCCAAGACACAGG - Intronic
953023480 3:39130818-39130840 CAGGCACTGGAACATGACATTGG + Exonic
954114827 3:48460727-48460749 AAGGCACTGGGTCAGGACACTGG - Exonic
955929004 3:64037032-64037054 CAGGCATAGTTCCAGGACACGGG - Intergenic
960761020 3:121074047-121074069 CATGTACTGCAACAGGACACAGG + Intronic
961056692 3:123794609-123794631 CAGGCCCTGGACCAGGAGTCAGG - Intronic
961323808 3:126097837-126097859 CAGTCACCACACCAGCACACAGG + Intronic
961416837 3:126765383-126765405 CAGGCACTTGACGGGGACACTGG + Intronic
962013757 3:131419953-131419975 GAGCCACTGCACCTGGCCACAGG + Intergenic
962423371 3:135248068-135248090 CAGGCCCTGCACCAGGAGCTGGG + Intronic
963635292 3:147787252-147787274 TAAGCATTGCACCAGCACACAGG - Intergenic
964763784 3:160158798-160158820 CAGGCACTGTACCAGGTGTCAGG - Intergenic
966390590 3:179448948-179448970 CAGTCACTGAAGCAGAACACTGG + Intronic
966815987 3:183890258-183890280 CATACACTGCTCCAGGCCACCGG + Intergenic
967886788 3:194338737-194338759 CAGACACATCACCAGGAGACGGG - Intergenic
968447999 4:662129-662151 CAGGAACCGCACCAGGACCTGGG - Exonic
968873740 4:3254586-3254608 CAGGCACTGGAGCAGGGCCCTGG + Intronic
969566460 4:7981689-7981711 CAGGGAGGGGACCAGGACACTGG - Intronic
969688622 4:8690910-8690932 CAGGCCCTGCAGCAGGGCATCGG - Intergenic
969689217 4:8694986-8695008 CAGGAACAGCCCCAGGACCCTGG + Intergenic
970076040 4:12222144-12222166 CAGGCACTGCCCCAGACAACTGG + Intergenic
971171353 4:24236404-24236426 AAGGTACTGCACCAGGTCCCTGG - Intergenic
972249137 4:37280912-37280934 GAGCCACAGCACCAGGCCACAGG - Intronic
973868333 4:55137599-55137621 CTGGCACTGCAGCAGGATACTGG - Intergenic
974102473 4:57432401-57432423 CATGAACTGCACCAGCAGACAGG - Intergenic
974300943 4:60066913-60066935 CATGCACTGCCCCAGTCCACTGG - Intergenic
974803370 4:66847815-66847837 CAGGCACTAGACTAGAACACAGG + Intergenic
976216172 4:82717629-82717651 GAGCCACTGCACCAGGCCAAAGG - Intronic
980364073 4:131776549-131776571 CAGGTTCTGCACATGGACACAGG - Intergenic
982296743 4:153836720-153836742 GAGGCAGTGCACCAGGACCATGG - Intergenic
983764286 4:171458092-171458114 GAGCCACTGCACCTGGCCACTGG - Intergenic
983882902 4:172952948-172952970 AAGGCTGTGCACCAGGACAGAGG - Intronic
984407879 4:179357015-179357037 CAGGGACTGCGCCAGGGTACCGG + Intergenic
985725618 5:1514460-1514482 CAGGCTGTGTCCCAGGACACTGG + Intronic
985921906 5:2984097-2984119 CAGGCACTGGGACAGGTCACGGG - Intergenic
986424279 5:7614767-7614789 CAGCCCCTGTGCCAGGACACAGG + Intronic
987805926 5:22768390-22768412 CAGGAACTGAGCCAAGACACAGG + Intronic
991310230 5:65231823-65231845 GAGCCACTGCACCTGGCCACAGG - Intronic
991965427 5:72085993-72086015 CAGGGACTCCCCCTGGACACAGG + Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
993868390 5:93221397-93221419 GAGCCACTGCACCTGGCCACAGG - Intergenic
994338483 5:98598211-98598233 AAGGCCCTGGACCAGGAGACTGG + Intergenic
994389698 5:99177205-99177227 GAGGCACTGCACCAGATGACAGG - Intergenic
996047168 5:118886212-118886234 CAGGCACTGTTCTAGGGCACTGG + Intronic
996837060 5:127804976-127804998 CCGGCACTGCACTAGGAATCAGG - Intergenic
997951987 5:138249739-138249761 CAGCCACTGCACCCCGACCCAGG + Intergenic
999265059 5:150261435-150261457 CAGTCACTCCACCAGGAGACAGG - Intronic
999313789 5:150570693-150570715 CAGGCCCTTTACAAGGACACAGG + Intergenic
1002701927 5:181130571-181130593 CAGGTACTGAACCCAGACACGGG + Intergenic
1002704070 5:181148609-181148631 CAGGCACTGGTCCAGGAGCCAGG + Intergenic
1003716269 6:8649803-8649825 GAGCCACTGCACCAGGCCAAGGG - Intergenic
1004851577 6:19704952-19704974 CACGGACTGCACCAGGACTGTGG + Intergenic
1006446071 6:34080461-34080483 CAGGCATTGGACCAGGACACTGG - Intronic
1007482677 6:42160355-42160377 CAGGCTCAGCCCCAGGGCACAGG - Intronic
1007500908 6:42296110-42296132 CCACCACGGCACCAGGACACAGG + Intronic
1007744687 6:44036321-44036343 CAGGAACTGAACCAGGAGCCTGG - Intergenic
1008761685 6:54859342-54859364 GAGCCACTGCACCCGGCCACGGG + Intronic
1009292121 6:61895458-61895480 CAGGGACTGCACCAGTTCAGGGG - Intronic
1010926428 6:81751741-81751763 CATGTCCTGCACCAGGACAGCGG - Exonic
1012244175 6:96908067-96908089 AAGGCACAACACCAGTACACAGG - Intergenic
1012487017 6:99733499-99733521 CAGGGACTGAACCAAGAAACAGG - Intergenic
1012981298 6:105832709-105832731 AAGGAAGTGCACCAGGACAAAGG - Intergenic
1013315466 6:108937982-108938004 GAGCCACTGCACCCGGCCACAGG + Intronic
1014552938 6:122809991-122810013 CAGGCACTGGACTAGGACCCAGG - Intergenic
1015005006 6:128269289-128269311 CAGGCACTGCTGCAGGGCAATGG + Intronic
1016935585 6:149447075-149447097 CAGGCAGTTCCCAAGGACACAGG - Intergenic
1017588651 6:155954160-155954182 AAAGCACTGCACGAGGACTCAGG - Intergenic
1017608782 6:156162330-156162352 GAGCCACTGCACCAGGCCACTGG + Intergenic
1017989190 6:159471369-159471391 CCTGCACTGCTGCAGGACACTGG - Intergenic
1018066973 6:160131306-160131328 CAGTCACTGCCCCAGGAGACAGG + Intronic
1018066984 6:160131344-160131366 CAGGCACTGCCCCAGGAGACAGG + Intronic
1018641332 6:165907204-165907226 CCTGCACTGCACCAGGACTCTGG - Intronic
1019142621 6:169957705-169957727 CTGGCGCAGCACCTGGACACGGG + Intergenic
1019324680 7:432300-432322 CTGGGCCTGCACCAGGAGACTGG + Intergenic
1019452494 7:1106971-1106993 CTGGGACTGCACCAGGCCACGGG + Intronic
1019490172 7:1309009-1309031 CAGGCCCTGCACCAGAACCTTGG + Intergenic
1019990795 7:4689260-4689282 GAGCCACTGCACCCGGCCACCGG + Intronic
1021781272 7:24109098-24109120 CAGGCACTGAAACAGGAAAGAGG - Intergenic
1021860803 7:24904165-24904187 GAGTCACTGCACCTGGCCACTGG + Intronic
1021900593 7:25281204-25281226 CAGTCAGTGGACCAGGGCACAGG - Intergenic
1022467780 7:30662912-30662934 CAGGCAGGGCAACAAGACACAGG + Intronic
1025248277 7:57334373-57334395 CAGGCACTGCACTAGGAGGTTGG + Intergenic
1026256703 7:68718514-68718536 CAGGCTCTGAACCCAGACACTGG + Intergenic
1026952201 7:74355069-74355091 CAGGGACTGCACAGGGACTCAGG - Intronic
1027129013 7:75577624-75577646 CAGGCACTGGACTAGAACAGAGG + Intronic
1030264078 7:107598785-107598807 CAGCCACTGCACCTGGCCAGTGG - Intronic
1031922867 7:127614251-127614273 CAGGCCCTGGAACAGAACACAGG - Intronic
1032013343 7:128360675-128360697 CAGGCCCAGCCCCAGGAAACGGG - Intronic
1032101041 7:128977878-128977900 GAGGCACTGCACCTGGCCAGGGG + Intronic
1032864738 7:135914313-135914335 CAGGGGCTGCAGCAGGACTCTGG - Intergenic
1033059869 7:138095914-138095936 GAGCCACTGCACCAGGCCTCAGG - Intronic
1035732981 8:1865595-1865617 CAGGGCCATCACCAGGACACGGG + Intronic
1036173701 8:6515373-6515395 CACACCTTGCACCAGGACACTGG - Intronic
1036209622 8:6831729-6831751 GAGCCACTGCACCTGGCCACAGG - Intronic
1037303080 8:17473436-17473458 CATGGACTGAACCAGGTCACCGG - Intergenic
1038778276 8:30550150-30550172 CAGGCCCTGCATCAGGAGGCAGG - Intronic
1039047770 8:33465758-33465780 GAGCCACTGCACCCGGCCACAGG + Intronic
1040110743 8:43566260-43566282 CAGGCCCTGCACCAGAACTGGGG - Intergenic
1040558831 8:48505659-48505681 CAGGCACTGTACGAGGTCCCGGG + Intergenic
1040734659 8:50490997-50491019 CAAGCTCTGCATCAGGAGACTGG + Intronic
1041151504 8:54940085-54940107 CAGGGACTGCCGCATGACACAGG - Intergenic
1046101674 8:109621604-109621626 CTGGCACTGAACCAGCCCACAGG + Intronic
1047841117 8:128754433-128754455 CAGGCACTGCCCCAGTCCACTGG - Intergenic
1048589613 8:135809249-135809271 CAGCCAGTGAACCAGGATACAGG + Intergenic
1048829279 8:138460330-138460352 CAGGCACTGCAGCATAGCACTGG - Intronic
1049804118 8:144531223-144531245 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804130 8:144531282-144531304 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804143 8:144531341-144531363 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804155 8:144531400-144531422 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804169 8:144531459-144531481 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804181 8:144531518-144531540 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804195 8:144531577-144531599 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804209 8:144531636-144531658 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804222 8:144531695-144531717 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804236 8:144531754-144531776 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804250 8:144531813-144531835 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804262 8:144531872-144531894 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804276 8:144531931-144531953 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804289 8:144531990-144532012 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804302 8:144532049-144532071 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049867162 8:144946630-144946652 CAGGCCCAACAGCAGGACACAGG - Intronic
1049867227 8:144946885-144946907 CAGGCCCCACAGCAGGACACAGG - Intronic
1049867262 8:144947030-144947052 CAGGCCCAACAGCAGGACACAGG - Intronic
1049867281 8:144947102-144947124 CAGGCCCCACAGCAGGACACAGG - Intronic
1049867316 8:144947249-144947271 CAGGCCCCACAGCAGGACACAGG - Intronic
1049867341 8:144947341-144947363 CAGGCCCCACAACAGGACACAGG - Intronic
1050031031 9:1385866-1385888 CAGGCACTGCTCCAGGTAATGGG + Intergenic
1053628423 9:39902434-39902456 CAGGTTCTGCACATGGACACAGG - Intergenic
1053777636 9:41563893-41563915 CAGGTTCTGCACATGGACACAGG + Intergenic
1054215464 9:62348267-62348289 CAGGTTCTGCACATGGACACAGG + Intergenic
1054672017 9:67807080-67807102 CAGGTTCTGCACATGGACACAGG - Intergenic
1056023820 9:82469958-82469980 CAGGCATTGCAGCAGGAAATAGG - Intergenic
1056499065 9:87190179-87190201 GAGTCACTGCACCTGGACACAGG - Intergenic
1056659282 9:88533032-88533054 CAGGCACAGGAGCAGGACTCAGG + Intergenic
1056813375 9:89781752-89781774 CAGGCACTGCAGGAGCACCCTGG + Intergenic
1056965655 9:91161253-91161275 CAGACACAGCAACAGGACAGAGG + Intergenic
1057850835 9:98565670-98565692 AAGGCAATGCACCAGCACCCAGG + Intronic
1057857049 9:98609842-98609864 CAGGCTCAGGGCCAGGACACTGG + Intronic
1058663136 9:107283813-107283835 CAGGGCCGGCACCAGGACCCAGG - Intronic
1058748289 9:108013597-108013619 CCTGCACTGCACCAAGAAACTGG + Intergenic
1059701524 9:116779542-116779564 CAGGGAATGCTCCAGGAAACAGG - Intronic
1059788058 9:117608239-117608261 CAGGCACTGTACTAGTACATGGG - Intergenic
1059985116 9:119813846-119813868 CAGGCCCTGCAGCAGCACTCAGG - Intergenic
1060212941 9:121721553-121721575 CAGCCCCTGCACCATGGCACTGG + Intronic
1060310368 9:122454231-122454253 GAGCCACTGCACCCGGCCACTGG - Intergenic
1060411269 9:123401968-123401990 TAGACACTGTACCAGGATACAGG - Intronic
1060658604 9:125389372-125389394 CAGGGACCGTCCCAGGACACTGG - Intergenic
1060781279 9:126415120-126415142 CAGGAGCTGCACTAGGCCACTGG - Intronic
1060865361 9:126990846-126990868 CAGGCACTGCATTAGATCACAGG - Intronic
1061422550 9:130480117-130480139 TAGGCAGGGCCCCAGGACACAGG + Intronic
1061820025 9:133222188-133222210 AAGCCCCTGCACCAGGAGACAGG + Intergenic
1062087491 9:134656287-134656309 CAGGCTCTGCAGAAGGACAGAGG - Intronic
1062240625 9:135535757-135535779 AAGCCCCTGCACCAGGAGACAGG - Intergenic
1062468709 9:136692717-136692739 CTGACACGGCCCCAGGACACAGG - Intergenic
1062495584 9:136830089-136830111 GGGGCCCTGCACCAGGACACTGG - Intronic
1185919154 X:4069958-4069980 CAGGAACTGCAGCAGCACATAGG + Intergenic
1186078669 X:5907432-5907454 CAGGCACTCCAGCAGGGCTCAGG + Intronic
1187822100 X:23298624-23298646 CAGCCACTGAGCCAGGACAGGGG - Intergenic
1188671718 X:32889227-32889249 CAGGCACTTCAGCAGGATATAGG + Intronic
1188675400 X:32933854-32933876 CAGGCACACCACTAGAACACGGG + Intronic
1189539963 X:41976879-41976901 CAGGCACTGCACCATGAGCTGGG + Intergenic
1191250190 X:58256519-58256541 CAGCCACTGCACCAGGCCCGTGG + Intergenic
1192330707 X:70173153-70173175 AAGACCCTGAACCAGGACACTGG + Intergenic
1196057350 X:111369964-111369986 CAGGCACTGCACTAGGTATCAGG + Intronic
1198176783 X:134164356-134164378 CAGCCACTGCACCCGGCCTCAGG - Intergenic
1201075102 Y:10180922-10180944 GAGCCACTGCACCTGGACTCTGG + Intergenic
1201357316 Y:13111681-13111703 CAGGCAGAGCACCAGGATGCAGG - Intergenic
1202052900 Y:20798901-20798923 CAGGAAGGGCACCAGGACAGAGG + Intergenic