ID: 1144852572

View in Genome Browser
Species Human (GRCh38)
Location 17:18251448-18251470
Sequence CAGATGCCCGGGCCCCCAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 268}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144852572_1144852578 -10 Left 1144852572 17:18251448-18251470 CCCGCTGGGGGCCCGGGCATCTG 0: 1
1: 0
2: 2
3: 15
4: 268
Right 1144852578 17:18251461-18251483 CGGGCATCTGCGCTCTCCTGGGG 0: 1
1: 0
2: 0
3: 8
4: 113
1144852572_1144852581 9 Left 1144852572 17:18251448-18251470 CCCGCTGGGGGCCCGGGCATCTG 0: 1
1: 0
2: 2
3: 15
4: 268
Right 1144852581 17:18251480-18251502 GGGGGCAGAGTCACAGAGCACGG 0: 1
1: 0
2: 4
3: 36
4: 507
1144852572_1144852579 -9 Left 1144852572 17:18251448-18251470 CCCGCTGGGGGCCCGGGCATCTG 0: 1
1: 0
2: 2
3: 15
4: 268
Right 1144852579 17:18251462-18251484 GGGCATCTGCGCTCTCCTGGGGG 0: 1
1: 0
2: 1
3: 17
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144852572 Original CRISPR CAGATGCCCGGGCCCCCAGC GGG (reversed) Exonic
900103979 1:974439-974461 CAGATGGTCGGTCCCCCAGGAGG + Exonic
900175964 1:1291489-1291511 CAGATGACCCGGAGCCCAGCGGG + Exonic
900367360 1:2316655-2316677 CGGATGACAGAGCCCCCAGCTGG - Intergenic
900908098 1:5575019-5575041 CACATGCAAGTGCCCCCAGCTGG - Intergenic
901766079 1:11501086-11501108 CAGAAGCCAGGGCCCCAACCTGG + Exonic
902291814 1:15440360-15440382 AGGATGCCCGGCCCCACAGCTGG + Exonic
907305443 1:53510414-53510436 CAGAGAGCCGGGCACCCAGCAGG - Intronic
913259167 1:116982918-116982940 CAGAGGCCCAGCCCACCAGCTGG + Intronic
913342192 1:117769673-117769695 CAGATGCCCCTCCCCCCACCTGG + Intergenic
915283724 1:154839750-154839772 CAGTGGCCAGGGCCCCCAGAAGG - Intronic
915512250 1:156392708-156392730 GAGAAGCCCAAGCCCCCAGCTGG - Intergenic
920820468 1:209375539-209375561 CAGTTGCCCTGGCCCTCAGTGGG - Intergenic
922766339 1:228158403-228158425 AAGCTGCCCTGGCCACCAGCTGG - Exonic
1065503051 10:26400555-26400577 AAGATGCCCAGGTCCCCAGCAGG - Intergenic
1065522897 10:26589129-26589151 CCTATGCCCAGGCCCCAAGCAGG + Intergenic
1065528821 10:26648400-26648422 CCTATGCCCAGGCCCCAAGCAGG + Intergenic
1065839856 10:29693544-29693566 TAGATGCCTGAGCACCCAGCAGG + Intronic
1067066336 10:43106090-43106112 CCGATGCCCAGGCACCCTGCTGG - Intronic
1067070005 10:43124359-43124381 CACCTCCCTGGGCCCCCAGCTGG + Intronic
1067097109 10:43308754-43308776 CAGATGCCCAGGGCCACACCTGG - Intergenic
1067105218 10:43362031-43362053 CAGGGTCCCGGGCCCCCTGCGGG + Intergenic
1067370576 10:45678434-45678456 CACATGCCTGGGCTCCCACCTGG + Intergenic
1067389205 10:45847722-45847744 CACATGCCTGGGCTCCCACCTGG - Intronic
1067416865 10:46109236-46109258 CACATGCCTGGGCTCCCACCTGG + Intergenic
1067445052 10:46336827-46336849 CACATGCCTGGGCTCCCACCTGG + Intergenic
1067498088 10:46776368-46776390 CAGCTGCGCGGGCCCCCGCCTGG - Intergenic
1067502268 10:46816119-46816141 CACATGCCTGGGCTCCCACCTGG + Intergenic
1067592320 10:47523901-47523923 CACATGCCTGGGCTCCCACCTGG - Intronic
1067596558 10:47564046-47564068 CAGCTGCGCGGGCCCCCGCCTGG + Intergenic
1067639436 10:48031974-48031996 CACATGCCTGGGCTCCCACCTGG - Intergenic
1067874059 10:49988331-49988353 CACATGCCTGGGCTCCCACCTGG + Intronic
1069744326 10:70705402-70705424 CCCATGCCAGGGCCGCCAGCCGG + Intronic
1069897021 10:71686312-71686334 GAGATGCCCAGGCACGCAGCTGG + Intronic
1069957929 10:72062980-72063002 CCCAGGCCTGGGCCCCCAGCAGG + Intronic
1070136423 10:73698124-73698146 CACATGCCTGGGCTCCCACCTGG - Exonic
1071086093 10:81870314-81870336 CAGATGCCCGCGACCACACCTGG - Intergenic
1073121508 10:101124999-101125021 CAGAGGCCTGGTCCCACAGCAGG + Intronic
1073631776 10:105156655-105156677 CAGATGCCAGGCCTCCAAGCTGG + Intronic
1075871033 10:125773003-125773025 CATCTTCCCAGGCCCCCAGCCGG - Intronic
1076147453 10:128135350-128135372 CAGATGCCCGCCACCACAGCTGG - Intergenic
1076605297 10:131685478-131685500 CAGGTGCCCGGGCTTTCAGCAGG - Intergenic
1077394203 11:2313169-2313191 CAGCTGCCCGGGCTTCCAGAAGG + Intronic
1077422678 11:2460383-2460405 CAGGTGCCCAAGCCCCCAGGTGG + Intronic
1079122293 11:17694943-17694965 CTGAGGCCAGGACCCCCAGCAGG + Intergenic
1079454016 11:20621876-20621898 CAGAGGCACGGGCGACCAGCAGG + Intronic
1080766979 11:35306046-35306068 CAGAATCCCGGACCACCAGCTGG + Intronic
1083476637 11:62919688-62919710 CAGAAGCTTGGGCTCCCAGCAGG - Intronic
1083689166 11:64396357-64396379 CAGACGCCTGTGCCCCCAGAGGG + Intergenic
1083764766 11:64836479-64836501 CAGACGGATGGGCCCCCAGCTGG - Exonic
1083881766 11:65552416-65552438 CAGATGCCCATGCCCCCCACTGG - Intronic
1084142034 11:67238977-67238999 CTGATCCCCGGATCCCCAGCTGG - Intronic
1084639461 11:70415946-70415968 CAGATGCCAGGGCTCCGAGGGGG - Intronic
1085530350 11:77188967-77188989 CACCTGCCTGGGCCACCAGCTGG + Intronic
1088580512 11:111311084-111311106 CAGATGCCTGGGCCCCACCCTGG - Intergenic
1088911675 11:114196989-114197011 CTGATGCCCAGGCCCCCACAGGG - Intronic
1089315451 11:117588183-117588205 CAGATGCCTGGGCCTCCTTCAGG - Intronic
1091613953 12:2035061-2035083 CAGGTGCCGGCGCCCCCTGCTGG + Intronic
1091916476 12:4274277-4274299 CGGATGCTCGGGTCCCCGGCCGG + Intronic
1092820669 12:12350482-12350504 CAGACCCTCGGGCCACCAGCAGG - Exonic
1102177886 12:110889416-110889438 CAACTGCCCGGGGCCCCAACCGG - Intronic
1102484576 12:113247178-113247200 CATGTGCAGGGGCCCCCAGCTGG - Intronic
1104676558 12:130715440-130715462 CAGATGTCCGGGCCCCCACCTGG + Intronic
1104942340 12:132400890-132400912 AGGAGGCCCCGGCCCCCAGCAGG - Intergenic
1105854619 13:24362573-24362595 CACAGGCCCTGGCCCACAGCAGG + Intergenic
1110119409 13:71865113-71865135 CAGATGCGAGGGCAACCAGCAGG - Intronic
1111965465 13:94857399-94857421 CAGGTGCCCGGTCCCCCTACAGG - Intergenic
1113956337 13:114101537-114101559 CCCATGCCAGGGGCCCCAGCCGG + Intronic
1119318464 14:73714547-73714569 CAAATGCCCGAGCCCCTCGCTGG - Intergenic
1119651916 14:76390029-76390051 CAGATCCGCCGTCCCCCAGCTGG + Intronic
1122297180 14:100712205-100712227 CAGATGCTCCGGCCCACTGCTGG - Intergenic
1122544258 14:102513498-102513520 GAGAGGCCCGAGGCCCCAGCCGG + Intergenic
1122770566 14:104095868-104095890 CAGCTCCCAGGGCCACCAGCAGG - Intronic
1122902323 14:104786984-104787006 CACCTGCCCAGGCCCTCAGCTGG - Intronic
1122904970 14:104797437-104797459 CAGATGCCAGGGCACCAGGCTGG - Intergenic
1123043347 14:105499513-105499535 CAGAGCCCCGGGCTCCCATCCGG - Intronic
1123119161 14:105909002-105909024 CCCTTGCCCGGGCCCCCTGCAGG - Intergenic
1123758871 15:23417210-23417232 CAGATCCCCCGGTCCCCAGGCGG - Intergenic
1124190832 15:27574816-27574838 CTGAAGCCCGGGCCCCAGGCTGG + Intergenic
1124635414 15:31361683-31361705 CAGGTGCCCGTGCTCCCAGCCGG - Intronic
1127842510 15:62843426-62843448 CAGATGGCCAGGGCCACAGCTGG - Exonic
1132207624 15:99997450-99997472 CTACTGCCCGGGCCCCCGGCCGG - Exonic
1132663611 16:1072125-1072147 CAGATTCCTGGGCCTCGAGCTGG - Intergenic
1132779371 16:1614367-1614389 CAGACGCCCGGGCCGGCGGCGGG - Intronic
1132789079 16:1675099-1675121 CAGATGTCTGGGCCCTCACCTGG - Exonic
1132810298 16:1793917-1793939 CCAGTGCCCGGGCCCCCTGCAGG + Intronic
1132880954 16:2161492-2161514 CAGGTGGCCAGGACCCCAGCAGG - Intronic
1133035294 16:3030871-3030893 AGGATGCCTGGGTCCCCAGCGGG - Intronic
1133268405 16:4598662-4598684 TAGGTGCTCTGGCCCCCAGCGGG + Intronic
1133333318 16:4989834-4989856 CAGATTCCTGGGCCCCAACCTGG + Intronic
1134055967 16:11170130-11170152 CAGAGACCCGGGCCCCGATCTGG + Intronic
1134073617 16:11275793-11275815 CAAATGCTCAAGCCCCCAGCTGG - Exonic
1134102667 16:11462909-11462931 CCGATGACCGGGGCTCCAGCTGG - Intronic
1134121321 16:11586793-11586815 CAGTGCCCGGGGCCCCCAGCAGG + Intronic
1135410235 16:22228557-22228579 CAGGTACCCGGGCCGACAGCAGG + Intronic
1136612681 16:31376844-31376866 CAGGTGCCCTGGCTCCCAACTGG - Exonic
1136652281 16:31683124-31683146 CTGATGCCAGGGCCCTAAGCTGG + Intergenic
1136671892 16:31865915-31865937 CTGATGCCTGGGCCCTAAGCTGG + Intergenic
1137590591 16:49691001-49691023 CAGATGCCTGGGCCTCAGGCTGG - Intronic
1141721176 16:85756134-85756156 CCTATGCCCGGGCCCCTGGCAGG + Intergenic
1143331415 17:6138867-6138889 CAGATTCTCGGGCACCCAGGAGG - Intergenic
1143378492 17:6480933-6480955 CAGGTGCCAGGGCCCACAGTGGG + Intronic
1143867012 17:9931409-9931431 AAGATTCCCGGGGACCCAGCAGG + Intronic
1144707592 17:17379905-17379927 CAGAGGCCCAGGGCCGCAGCAGG + Intergenic
1144852572 17:18251448-18251470 CAGATGCCCGGGCCCCCAGCGGG - Exonic
1144875743 17:18396276-18396298 CAGGGGCCCAGGCCTCCAGCTGG + Intergenic
1145156483 17:20548145-20548167 CAGGGGCCCAGGCCTCCAGCTGG - Intergenic
1145988365 17:29062594-29062616 CTGCTGCCAAGGCCCCCAGCAGG + Intergenic
1146786576 17:35726697-35726719 CATTTGCCTGGGGCCCCAGCAGG - Intronic
1147721850 17:42544282-42544304 CAGATTCCAGGGCCCAGAGCTGG + Exonic
1148048509 17:44758397-44758419 AAGATGCCCCGGCCTCCAGGAGG - Intergenic
1149225511 17:54465608-54465630 CAGATGCCCCTCCCCCCACCAGG + Intergenic
1150609775 17:66724638-66724660 CATTTGCTCAGGCCCCCAGCAGG + Intronic
1150653903 17:67027234-67027256 CAGCTGCCCGTGCCCCCAGGAGG + Intronic
1150692365 17:67377463-67377485 GAGGCGCCCGGGGCCCCAGCCGG + Intronic
1152108666 17:78344899-78344921 CAGATGGCCTGGCCACCAGCAGG - Intergenic
1152350577 17:79781969-79781991 CTGCTGCCAGGGGCCCCAGCCGG + Intronic
1157231475 18:45920510-45920532 CAGATGCCCAGTCTTCCAGCCGG - Intronic
1160005277 18:75064344-75064366 CAGAGGCCGGGGCCCCAAGCAGG + Exonic
1160146845 18:76372084-76372106 CTGAGGCCCCGGCCCCCAGAAGG + Intronic
1160752672 19:741774-741796 GAGATGCCAGGGACCCCAGGAGG + Intronic
1160905036 19:1447915-1447937 CAGCTCCCCAGGCCCCCATCAGG - Intronic
1160937201 19:1602330-1602352 CAGCTGTGCGTGCCCCCAGCTGG - Intronic
1161312957 19:3604798-3604820 AAGGTGCCCGGGCAGCCAGCAGG + Intronic
1161478480 19:4498977-4498999 CGGGAGCCCAGGCCCCCAGCAGG + Intronic
1161963679 19:7536068-7536090 CAAATGCCCGGGTCCCGAGGCGG + Intronic
1163526888 19:17826832-17826854 CAGCGCCCTGGGCCCCCAGCTGG - Exonic
1164595957 19:29530679-29530701 CAGGTGCCAGTGCCCCCATCTGG - Intronic
1164658662 19:29942753-29942775 CAGCTGCCCGGGCCCCCGGAGGG + Intronic
1165091134 19:33388942-33388964 CAGAGGCCCTGGCCGCCGGCCGG - Intronic
1167364340 19:49047045-49047067 CAGATCCCCAAGCCCCCACCTGG + Intergenic
1167433536 19:49466115-49466137 CAGCCGCCAGGGCCCACAGCAGG - Exonic
1167499434 19:49836872-49836894 CCGGGGCCCGGTCCCCCAGCCGG + Exonic
1168317410 19:55490224-55490246 CGGAGGCCTGGGCCCCCAGGTGG + Intronic
1168595686 19:57674333-57674355 CAGATGCTGGGGACTCCAGCGGG - Intronic
925177829 2:1797514-1797536 CAGAAGTCCGGGCCCCTGGCCGG - Intronic
925288300 2:2730144-2730166 CAGCTGCCCGGGGCTGCAGCAGG + Intergenic
926251483 2:11157537-11157559 CAGGGGCCCGGGGGCCCAGCTGG - Intronic
927621168 2:24660916-24660938 CAGATGCCCGGCACCACAACTGG - Intronic
927929236 2:27033454-27033476 CAGCTGCCCAGGGCCCTAGCTGG + Intronic
928083179 2:28327738-28327760 CAGAGGCCCTTGCCCTCAGCTGG - Intronic
928332524 2:30368585-30368607 CACAAGCCCAGGCCTCCAGCAGG - Intergenic
928432751 2:31234295-31234317 CAGATGCCGGGGTCCCAAGCCGG - Intergenic
931388312 2:61816906-61816928 CAGTTGCAGGGGCCCCAAGCAGG + Intergenic
934887475 2:98037719-98037741 GGCATGCCCAGGCCCCCAGCAGG + Intergenic
936093699 2:109516420-109516442 CAGAAGCACGGGCCTACAGCTGG + Intergenic
937098204 2:119249270-119249292 CTGATGCCTGGGTCCCCACCTGG - Intronic
937108272 2:119339667-119339689 CAGATGCCAGGGCCCAGAACCGG + Intronic
937631773 2:124109610-124109632 CAGATGCCCTGTCCCCAGGCAGG - Intronic
938207984 2:129439947-129439969 CAGAAGGCCAGGCCCCTAGCAGG - Intergenic
938322057 2:130372315-130372337 CAGAAGCGCGGGGCTCCAGCGGG + Exonic
941523800 2:166581633-166581655 CAGATGCCCCTCCCCCCACCAGG - Intergenic
945251247 2:207768171-207768193 CACACGAACGGGCCCCCAGCGGG + Exonic
947403733 2:229753554-229753576 CACTTGCCCGGGCTACCAGCTGG + Intergenic
948162854 2:235839374-235839396 TAGATGCCCGGGCCCCACCCAGG - Intronic
948907499 2:240986790-240986812 CAGAACCCTGGGCCCACAGCTGG - Intronic
1168853084 20:989835-989857 CAGAGGCCCGCGTCTCCAGCTGG - Intronic
1171448386 20:25220328-25220350 CAGAACCCCAGGACCCCAGCGGG - Intronic
1171448416 20:25220448-25220470 CAGACCCCCAGGACCCCAGCAGG - Intronic
1172211983 20:33206399-33206421 CAGCAGCTCAGGCCCCCAGCAGG + Intergenic
1172441839 20:34971534-34971556 CAGCTGCCCAGGGCCCCAGGAGG + Intergenic
1172895244 20:38295621-38295643 CAGGTGCCCAGGCTCCAAGCTGG - Intronic
1173162290 20:40662051-40662073 CACATGCCAGGGACCCCTGCAGG + Intergenic
1173720343 20:45252927-45252949 CATATGCCTGGGCCTCCAGAGGG + Intronic
1175856213 20:62122321-62122343 AATATGGCCGGGCCGCCAGCTGG - Intergenic
1175988836 20:62777591-62777613 CAGATGGCTGGGGCGCCAGCAGG - Intergenic
1176062542 20:63178727-63178749 CAGATCCCCGGCCCGGCAGCTGG - Intergenic
1176190076 20:63804302-63804324 CAGCTGCCCCGGCCCCCTCCTGG - Intronic
1179935646 21:44602087-44602109 AAGAGGCCCAGGCCCACAGCAGG - Exonic
1180054292 21:45349189-45349211 CGACTGCCCGGGTCCCCAGCAGG + Intergenic
1180105026 21:45612887-45612909 CAGACACGCAGGCCCCCAGCTGG - Intergenic
1180105074 21:45613123-45613145 CAGACACTCAGGCCCCCAGCTGG - Intergenic
1180833198 22:18916766-18916788 CAAATGCCCGACCACCCAGCAGG + Intronic
1181066626 22:20309490-20309512 CAAATGCCCGACCACCCAGCAGG - Intergenic
1181853613 22:25767348-25767370 CAGAAACCAGGGCCCTCAGCTGG + Intronic
1183465194 22:37976615-37976637 CAGATGCCCGGGAGCCAAACTGG + Intronic
1183726090 22:39590425-39590447 CACAGGCCTGGGTCCCCAGCAGG + Intronic
1184617112 22:45645751-45645773 CACCTCCCCGGGCGCCCAGCAGG + Intergenic
1184657029 22:45947031-45947053 CCCATGCCAGGGCACCCAGCTGG + Intronic
1184783658 22:46661534-46661556 CAGATACCCCCTCCCCCAGCAGG + Intronic
1184843016 22:47063533-47063555 AACATTCCCGGACCCCCAGCAGG - Intronic
1185258691 22:49849842-49849864 CAAATGCCCCGGCGGCCAGCAGG + Intergenic
1203283283 22_KI270734v1_random:142070-142092 CAAATGCCCGACCACCCAGCAGG + Intergenic
950221031 3:11196245-11196267 CAGTTGCCCGGCTCCTCAGCCGG + Intronic
950526434 3:13526800-13526822 CATATACCCTGGCCCCCACCTGG - Intergenic
950551730 3:13670143-13670165 CAGCTGCGCTGGACCCCAGCGGG - Intergenic
950645830 3:14376188-14376210 CAGGTGCCTGGGCCCACACCTGG + Intergenic
950673905 3:14543256-14543278 CAGATGCTCGGGCCCCGCCCAGG + Intergenic
950696243 3:14703304-14703326 CAGAAAGCCTGGCCCCCAGCTGG + Intronic
950964078 3:17134141-17134163 CAGCGGCCCAGGTCCCCAGCAGG - Intergenic
952220738 3:31321601-31321623 AAGATGCACGGTCCTCCAGCAGG - Intergenic
953212784 3:40891160-40891182 CAGATGCCAGGGGCCTCAGATGG - Intergenic
960488011 3:118276878-118276900 TAGATGAGAGGGCCCCCAGCGGG + Intergenic
961322330 3:126084275-126084297 CAGCCCCCCGGGCCCCCGGCGGG - Exonic
961330163 3:126133754-126133776 CAGATGCAGGGGTGCCCAGCAGG + Intronic
961456513 3:127027287-127027309 CACAGCCCCGGGCCCTCAGCGGG - Intronic
966256002 3:177917497-177917519 GAGATGCCCAGGTCCACAGCCGG - Intergenic
966378694 3:179322888-179322910 CAGCGGCCCGCGCCCCCTGCCGG - Intergenic
967085989 3:186095842-186095864 CAGCTGCCCCAGCCTCCAGCTGG - Intronic
967867701 3:194204039-194204061 CTGATGCTCGCGGCCCCAGCAGG + Intergenic
971093198 4:23369524-23369546 CAGATTCCCAAGGCCCCAGCTGG - Intergenic
975744628 4:77464309-77464331 CAGATGCCCCTCCCCCCACCAGG + Intergenic
979674779 4:123398686-123398708 CAGAAGCCGCGGCCCCCAGGGGG - Intronic
985666689 5:1184728-1184750 CGGATGCTTGGGCCCCCAGCTGG + Intergenic
985802348 5:2013022-2013044 CTGCTGCCAGGGGCCCCAGCGGG + Intergenic
985889754 5:2706152-2706174 CAGGTGCCCCGGCCCACAGAGGG + Intergenic
986200012 5:5571404-5571426 CTGATGTGCGGGCTCCCAGCTGG - Intergenic
987312083 5:16690688-16690710 CAGATGCCCTGGCCTTAAGCTGG - Intronic
988511240 5:31866420-31866442 CAGATGCCCGGGCCGACAGCAGG - Intronic
988511704 5:31869823-31869845 CAGATGCCCGAGCCGACAGCAGG - Intronic
992195661 5:74336537-74336559 CAGCTGCCGGGGCCCTCCGCAGG + Intergenic
993407223 5:87526373-87526395 CAGCTGCCAAGTCCCCCAGCTGG - Intergenic
997583830 5:135033470-135033492 CAGATGCACGAGCCTACAGCTGG - Exonic
998658167 5:144205444-144205466 CGGAGCCCCGGGCCCCCCGCCGG + Exonic
999731502 5:154479114-154479136 CAGATGCCCCGGGCCCAAGGCGG - Intergenic
1001873852 5:175182271-175182293 CACATTTCCGGGCCCCAAGCTGG - Intergenic
1002179160 5:177421147-177421169 AAGATGCCAGGGACCTCAGCTGG + Intronic
1004293415 6:14388807-14388829 CAGATACCCAGACCCCCATCAGG + Intergenic
1007649845 6:43412656-43412678 GAGATGCCTGGGTCCACAGCTGG - Intergenic
1007750554 6:44068325-44068347 CAGGAGCCCGCTCCCCCAGCTGG + Intergenic
1010085909 6:71917890-71917912 CAGATGCCCAGGCCCCAAAGTGG - Intronic
1011702741 6:89970751-89970773 CATATGCCCAGGCCCCCACCTGG + Intronic
1012234280 6:96795126-96795148 CAGATTCCTGGGCCTCCAGAGGG - Exonic
1012845423 6:104381674-104381696 CAAATGCACTGGCCCCCAGTGGG - Intergenic
1015046272 6:128779952-128779974 CAGATGCCCCTCCCCCCACCAGG + Intergenic
1018027986 6:159820410-159820432 CAGTGGCCGGGGCACCCAGCAGG - Intronic
1018073864 6:160191809-160191831 CACATGCCTGTGCCCCCAGCCGG + Intronic
1018652392 6:166003109-166003131 CAGCTGCCCCATCCCCCAGCAGG + Intergenic
1018654720 6:166024418-166024440 CAGCTGCTCTGGGCCCCAGCAGG + Intergenic
1019337382 7:491793-491815 CAGAGTCCCTGGCCCCGAGCGGG - Intergenic
1019360385 7:601752-601774 GGGATGGCCGGGCCCCCTGCGGG - Intronic
1019448939 7:1086579-1086601 CAGATGCCTTGAGCCCCAGCAGG + Intronic
1019569599 7:1704740-1704762 CAGGTGCCCAGCCCCCCAGTAGG + Intronic
1019571812 7:1716369-1716391 CACATGCCAGGGCCCCAAGAGGG - Intronic
1019788894 7:2997532-2997554 GAGATGCTCAGGCCCACAGCAGG + Intronic
1023879292 7:44309286-44309308 CAGATGGCCTGGGCCCCAGGTGG - Intronic
1024172743 7:46807220-46807242 CAGATGCCAAGCCCACCAGCAGG + Intergenic
1027234001 7:76287154-76287176 CAGATGCCCCGGGCTCCAGTGGG + Exonic
1027938261 7:84637100-84637122 CAGATTCCTGGGCCTCCAGGTGG + Intergenic
1029095921 7:98085153-98085175 CAGATGCCCGCCACCACAGCCGG + Intergenic
1029207877 7:98879644-98879666 CAGTTGCCAGGTCCCCTAGCAGG + Intronic
1029516442 7:101026298-101026320 CATAGGCCCAGGCCCACAGCAGG - Intronic
1032355602 7:131207704-131207726 CAGAAGCCTGGGCCCACAGAGGG + Intronic
1033232972 7:139616097-139616119 CAGGTGCCAGGACCCCCAGCAGG - Intronic
1033343147 7:140507376-140507398 TTGGTGCCCTGGCCCCCAGCAGG + Intergenic
1033714044 7:143981249-143981271 CATAGGCCATGGCCCCCAGCAGG - Intergenic
1034275189 7:149820927-149820949 CCGATGCCCAGGGCCACAGCTGG + Intergenic
1034284249 7:149873992-149874014 CAGGTGCGCGGGTCCCCAGCCGG - Exonic
1034601554 7:152262150-152262172 CAGAACCCCAGGTCCCCAGCTGG - Intronic
1034890912 7:154838574-154838596 AAGATGCCCAGGACCGCAGCGGG + Intronic
1034991030 7:155548344-155548366 CAGAATCCCGGGCCCACAGGTGG + Intergenic
1035201917 7:157273108-157273130 CACATCCCAGGGCCCCAAGCCGG - Intergenic
1035202916 7:157278449-157278471 CAGATGCCCGCCCCCCCTCCAGG + Intergenic
1037761579 8:21745269-21745291 GAGATGCCCAGGCCTCCTGCAGG - Intronic
1038300668 8:26344019-26344041 CTGGTACCTGGGCCCCCAGCTGG - Intronic
1039936491 8:42051362-42051384 CGGATCCCCGCGCCCCCGGCCGG + Intronic
1042549301 8:69980235-69980257 CAGATGGCAGGGGCCCCACCTGG - Intergenic
1043438505 8:80256731-80256753 CAGATGCCCGGTCTCCGAGCAGG - Intergenic
1043980515 8:86633217-86633239 ATGATGACCGGGCCCTCAGCTGG + Intronic
1045010794 8:97956891-97956913 CAGATGCCCTGCCTCCCAGGAGG - Intronic
1045254798 8:100510370-100510392 CAGGTGCCCGGGCTGCCTGCAGG + Exonic
1047334441 8:123922273-123922295 TAAATGCCCCTGCCCCCAGCAGG - Intronic
1047441154 8:124879832-124879854 CAGAGGCCGGGACCCCGAGCAGG + Intergenic
1049614329 8:143569494-143569516 CAGGCGCCCGGGGCCGCAGCAGG + Exonic
1049692737 8:143969731-143969753 CAGCTGCCCAGGCCCCCGGCTGG - Intronic
1049757720 8:144318211-144318233 CTGCTGCCCAGCCCCCCAGCAGG + Intronic
1050086249 9:1968828-1968850 CAGAGGGCAGGGGCCCCAGCTGG + Intergenic
1055142310 9:72889508-72889530 CAGATTCTCAGGCCCCAAGCAGG + Intergenic
1056808736 9:89747887-89747909 GGGATGCGGGGGCCCCCAGCTGG + Intergenic
1057036048 9:91812387-91812409 CACATGCCCGGCCCCCGCGCAGG - Intronic
1060119320 9:120973423-120973445 CAGAGGCCCGGGCACAAAGCAGG + Intronic
1061218345 9:129234958-129234980 CAGAGGCACGAGCTCCCAGCAGG - Intergenic
1061975456 9:134066195-134066217 CAGAGGCCCGGTGCCTCAGCAGG - Intronic
1062039454 9:134397364-134397386 CAGCTCCCTGGGCCCCCAGATGG - Intronic
1062293036 9:135805967-135805989 CAAATGCCCAGGCAACCAGCAGG + Intergenic
1062383321 9:136298176-136298198 CCATGGCCCGGGCCCCCAGCTGG - Intronic
1062443502 9:136583840-136583862 CCAATGCCAGGGCCCTCAGCCGG - Intergenic
1062623095 9:137431365-137431387 CAGAAGCACCGACCCCCAGCAGG - Intronic
1189324795 X:40105808-40105830 AGGAGACCCGGGCCCCCAGCAGG - Intronic
1190246920 X:48696870-48696892 CGGACGCCGGGGCCCCGAGCCGG - Intronic
1190302993 X:49067308-49067330 CAGCGGCCCGGTCCACCAGCAGG - Exonic
1190335322 X:49258382-49258404 CTGGGCCCCGGGCCCCCAGCAGG + Exonic
1195808382 X:108801237-108801259 CAGATGCCCCTCCCCCCACCAGG - Intergenic
1198854684 X:141003428-141003450 CAGATGCCGGAGACCCCAACTGG + Exonic
1198908017 X:141583940-141583962 CAGATGCCGGAGACCCCAACTGG - Exonic
1198908774 X:141590484-141590506 CAGATGCCGGAGACCCCAACTGG + Exonic
1200047108 X:153408992-153409014 CAGGTGCCCAGGGGCCCAGCAGG - Intergenic