ID: 1144855376

View in Genome Browser
Species Human (GRCh38)
Location 17:18264521-18264543
Sequence CCGGGGTCACCTGACCCAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144855369_1144855376 7 Left 1144855369 17:18264491-18264513 CCGTGGTTGCTCGGCTCTGGGGC 0: 1
1: 0
2: 2
3: 12
4: 146
Right 1144855376 17:18264521-18264543 CCGGGGTCACCTGACCCAGGTGG 0: 1
1: 0
2: 2
3: 16
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144855376 Original CRISPR CCGGGGTCACCTGACCCAGG TGG Exonic
901217989 1:7565386-7565408 CCTGGGTCAGCTGTCCCAGTAGG - Intronic
901448067 1:9320029-9320051 CAAGAGTCACCTGGCCCAGGGGG - Intronic
902833987 1:19035052-19035074 GCAGGGTCACTTGCCCCAGGAGG + Intergenic
903778648 1:25808512-25808534 CCGGGGTCTCCTGTACCATGTGG - Intronic
904674188 1:32188136-32188158 CCAGAGTCACCTGTTCCAGGGGG - Intronic
906535205 1:46547642-46547664 TCCGGGTCTCCTAACCCAGGAGG + Exonic
912733346 1:112128965-112128987 CCTGGGTCACATGGCCCAAGTGG + Intergenic
919113965 1:193257977-193257999 CTGGGGTCACTTGCCCCAGTTGG + Intergenic
923040890 1:230319119-230319141 CCGGGTTTGCCTGACGCAGGAGG - Intergenic
923098637 1:230795009-230795031 CTGGGGTCCCCAGACCCAGTGGG - Intronic
1063533773 10:6862619-6862641 CCTTGGTCACCTGGCCAAGGTGG + Intergenic
1066363521 10:34754097-34754119 AGAGGATCACCTGACCCAGGAGG - Intronic
1067525711 10:47037177-47037199 CCAGGGTCACCTTACCCACCTGG + Intergenic
1067806179 10:49395170-49395192 CCGGGGCGTCCTGGCCCAGGCGG + Intronic
1069847667 10:71384093-71384115 GGAGGATCACCTGACCCAGGAGG - Intergenic
1070238638 10:74655955-74655977 CCAGAGTCACCTTGCCCAGGAGG - Intronic
1071467969 10:85958114-85958136 CCAGGTTGACCTGACCCAGCAGG - Intronic
1072009599 10:91291623-91291645 CCGGAGTCAACGGACCCAGAGGG - Intergenic
1072336651 10:94403468-94403490 CCGCGATCACCTGCCCCCGGCGG + Exonic
1077049107 11:558806-558828 CCCTGGCCACCTGGCCCAGGAGG + Intronic
1077074056 11:692058-692080 CCGAGGTCACCTGACGATGGTGG - Intronic
1077160610 11:1110834-1110856 CCAGGGCCACCTGACCCTCGGGG - Intergenic
1077160633 11:1110958-1110980 CCAGGGTCACCTGACCCTCGGGG - Intergenic
1077160646 11:1111014-1111036 CCAGGGCCACCTGACCCTTGGGG - Intergenic
1077160660 11:1111062-1111084 CCAGGGCCACCTGACCCTCGGGG - Intergenic
1077490380 11:2858285-2858307 CCCGTGTCTCCTGAGCCAGGCGG - Intergenic
1083339474 11:61949861-61949883 CCGGGGTCACCACACACAGGTGG + Intronic
1084361172 11:68669568-68669590 TCTGGGTCAGCTGACCCTGGTGG - Intergenic
1084698629 11:70771377-70771399 CCCTGGGCGCCTGACCCAGGTGG + Intronic
1085512419 11:77095143-77095165 CGAGGGGCACCTGAGCCAGGAGG + Intronic
1090647541 11:128777841-128777863 TCGGGGACACCTGGGCCAGGGGG - Intronic
1091407105 12:215886-215908 CCTGGTTGACCTGGCCCAGGGGG + Intergenic
1091996410 12:4997512-4997534 CCGGGGTCTTCTGACCCAGGGGG + Intergenic
1092070592 12:5628273-5628295 CCTGGGTCATCTGACCCACACGG + Intronic
1093699607 12:22203956-22203978 CCTGGGTAATCTGACACAGGTGG + Intronic
1095954030 12:47796363-47796385 CCCGGGTCTCCTGCACCAGGCGG - Intronic
1096241276 12:49961641-49961663 TCCGGGCCACGTGACCCAGGCGG - Intergenic
1096594429 12:52685586-52685608 CCGGGCTCACCTGAGGCTGGAGG + Intergenic
1097280893 12:57845210-57845232 CCGGGGCCACCTGGCCCCGGAGG - Intronic
1103401092 12:120643154-120643176 CCAGGGTCACCTGAGTCAGGAGG + Intronic
1106111953 13:26785386-26785408 CCATGGGCACCTGACCCAGAGGG - Intergenic
1106414754 13:29537222-29537244 CCTCGGTCACCTGCCGCAGGCGG - Intronic
1108350325 13:49585573-49585595 CCGGGGCCACGTGACCCGGCGGG - Exonic
1108525345 13:51281203-51281225 CCGGGGCCAGCCGACCCTGGGGG - Exonic
1112326603 13:98446046-98446068 CAGCGGGCACCTGCCCCAGGAGG - Intronic
1116891416 14:50272405-50272427 GCCGGGTCATGTGACCCAGGTGG - Intronic
1116969017 14:51045440-51045462 GCTGAGTCACCTGACCCTGGAGG + Intronic
1118443972 14:65835510-65835532 CCAGGGGAACCTGACGCAGGAGG - Intergenic
1121033304 14:90677667-90677689 CCGGGGTCACTTGTCCCGGCAGG + Intronic
1122717334 14:103703505-103703527 GAGGGGTCACCTGGCCCCGGAGG - Intronic
1122918399 14:104869291-104869313 ACGTGGGCCCCTGACCCAGGTGG + Intronic
1123049363 14:105533244-105533266 CCAGGGTCACCTGGCCATGGAGG + Intergenic
1202935676 14_KI270725v1_random:85544-85566 CAGGGTTCACCTGCCCCTGGTGG - Intergenic
1124373643 15:29117100-29117122 GCGGGGTCTCCTGACCCGTGAGG - Exonic
1124687318 15:31793287-31793309 CTGGGGTCAGATAACCCAGGAGG - Intronic
1132147762 15:99438462-99438484 CCAGCGTCACCGGGCCCAGGCGG + Intergenic
1132286845 15:100669591-100669613 CAGGGCTCACTTTACCCAGGGGG - Intergenic
1135105494 16:19645764-19645786 CCTGGGTGACCTGAGTCAGGAGG + Intronic
1135725733 16:24852641-24852663 CCGGGGTCACTTCACCGAGTGGG + Intronic
1136070580 16:27784721-27784743 CCAGGGTGACGTGAGCCAGGCGG + Intergenic
1137502867 16:49024745-49024767 CCATGGTCTCCTGACCCAGTGGG - Intergenic
1138281022 16:55772396-55772418 CTGGGGTCACCTGGACCAGCTGG + Intergenic
1138287508 16:55821472-55821494 CTGGGGTCACCTGGACCAGGTGG - Exonic
1139472867 16:67187538-67187560 CCCGGGGGACCTGGCCCAGGGGG + Exonic
1140250423 16:73289880-73289902 CCCGGGTGACTTGACACAGGGGG - Intergenic
1141315478 16:82958687-82958709 TAGGAGTCACTTGACCCAGGAGG + Intronic
1141950271 16:87335250-87335272 CTGGGGGCACCTGGCCCAAGTGG - Intronic
1142144643 16:88487779-88487801 CTGGGGTCACCAGAGCCAGTGGG + Intronic
1142285491 16:89169912-89169934 GCGGGGGCACCTGCCCCTGGGGG + Intergenic
1142593994 17:1020829-1020851 ATGGGGTCACCTGCCCCAGGGGG - Intronic
1142685894 17:1576773-1576795 CCGGGGTCACCAGACACCTGGGG - Intronic
1142876356 17:2853834-2853856 GCGCGGTCACCTGACCCCCGGGG + Intronic
1143031915 17:3972720-3972742 TCGGGGTCACCTGGGCCTGGTGG + Intergenic
1143608337 17:8003416-8003438 CAGGGTTCACCGGACCCACGAGG - Exonic
1143781217 17:9230652-9230674 CTGGGGTCTCCAGGCCCAGGAGG + Intronic
1144764440 17:17725023-17725045 CCAGGGTCAGCAGCCCCAGGAGG - Intronic
1144855376 17:18264521-18264543 CCGGGGTCACCTGACCCAGGTGG + Exonic
1145034979 17:19534358-19534380 CCGGTGTCTCCTGGCGCAGGAGG - Intronic
1145271387 17:21406704-21406726 CCACTGTCACCTGTCCCAGGAGG + Intronic
1145309592 17:21694108-21694130 CCACTGTCACCTGTCCCAGGAGG + Intronic
1145900191 17:28485550-28485572 CCGAGAGTACCTGACCCAGGGGG + Intronic
1145900305 17:28486653-28486675 CCGAGAGTACCTGACCCAGGGGG - Intronic
1146572194 17:33962315-33962337 CCGATGTCACCTCCCCCAGGAGG - Intronic
1148131157 17:45263320-45263342 TCGGCGTCCCCTGCCCCAGGAGG + Exonic
1148459575 17:47831460-47831482 AGGGGGTCTCCTGCCCCAGGCGG - Intronic
1151946363 17:77322030-77322052 CCTGGGCCACCAGCCCCAGGAGG + Intronic
1151957729 17:77388777-77388799 CAGGGGCCACTTGGCCCAGGTGG - Intronic
1152146086 17:78569764-78569786 CCGGGGTCCCCTGTCCCTGGAGG - Intronic
1152230816 17:79113164-79113186 CTGGGGACACCTGAGCCAGCAGG + Intronic
1152579567 17:81160056-81160078 CCGGGGCCACCTGCCCCAGGGGG - Intronic
1152782055 17:82231019-82231041 CCGGGCTCCGCTGACCCCGGTGG + Intronic
1158125503 18:54095841-54095863 CAGGAGCCACCTCACCCAGGAGG + Intergenic
1159001893 18:62981863-62981885 CAGGGTTCACCTGTCCCCGGGGG + Intergenic
1160185481 18:76673438-76673460 CTGGGGCCACCAGACCCAGAAGG - Intergenic
1160903369 19:1440287-1440309 CTGGGGTCGCCTGATGCAGGCGG + Intronic
1160923908 19:1533892-1533914 CTGAGGTCACGTGACGCAGGGGG - Intronic
1161228965 19:3163028-3163050 CCGGTGCCGCCTGCCCCAGGTGG - Exonic
1161427990 19:4215044-4215066 CCCGAGTCCCCTCACCCAGGAGG + Intronic
1161553669 19:4928470-4928492 CTCGGGTCACCTGACTCAGCAGG - Intronic
1162109670 19:8393345-8393367 CAGGGCTCACCTGGCCCTGGAGG + Intronic
1162588833 19:11577745-11577767 CAGGGCTCACATGACCCAAGGGG - Intronic
1163155623 19:15438668-15438690 CCGGGGCCACCTGAACCGCGTGG - Intronic
1163237399 19:16037629-16037651 CCTGTGTTACCTGTCCCAGGGGG - Intergenic
1164989803 19:32675459-32675481 GCAGGGACACCTGACCCCGGCGG + Exonic
1165882418 19:39053370-39053392 CCGGCGGCACCTGGGCCAGGTGG - Intergenic
1165907476 19:39202890-39202912 CCGGGGCCCCAAGACCCAGGAGG - Exonic
925020695 2:565400-565422 TCGGGGTCACCTGAGGCAGTGGG + Intergenic
925369521 2:3334501-3334523 CCGGAGGCACCTGAAGCAGGAGG + Intronic
926849922 2:17185069-17185091 ACGGGGTCACCTGGCACAGTTGG - Intergenic
928210485 2:29320124-29320146 CTGGAGTCAGCTTACCCAGGAGG + Intronic
929485058 2:42345764-42345786 CTGGGTTCACATGACCCCGGGGG - Intronic
932064200 2:68536037-68536059 CTGGGGAGAACTGACCCAGGGGG + Intronic
933682188 2:85111989-85112011 CCTGGGTCACCTGGCCTAAGTGG - Intergenic
933902855 2:86861875-86861897 CCCGGGACACCTGGCCCCGGGGG + Exonic
935777690 2:106487395-106487417 CCCGGGACACCTGGCCCCGGGGG - Intergenic
936041493 2:109153553-109153575 ACCGGGTCACCTGCCCCAGGAGG + Intronic
939795699 2:146641991-146642013 GGGGTGTCACCTCACCCAGGAGG + Intergenic
943715879 2:191151491-191151513 CGAGGGTGACCTGACCCAGAGGG + Intronic
945085069 2:206122823-206122845 GGAGGATCACCTGACCCAGGAGG - Intronic
945529513 2:210932946-210932968 CCGGGGTCACCTTGGCCAAGAGG + Intergenic
947592889 2:231395457-231395479 CCGGGGACGCCTGTCCCTGGCGG - Intergenic
948091720 2:235301457-235301479 CCTGGATCACCGGACCCAAGGGG - Intergenic
948237598 2:236402230-236402252 CTGGGGACACTTGAGCCAGGAGG - Intronic
1169012254 20:2260373-2260395 CTGTGCTCACCTGGCCCAGGGGG + Intergenic
1172121873 20:32603343-32603365 CCGGGGGCCCCCAACCCAGGAGG - Intronic
1172122945 20:32609333-32609355 CCTGGGGCTCCTGACCCAGCGGG - Intergenic
1172639332 20:36431654-36431676 CCCGGGTCACCTCTCCCGGGCGG - Exonic
1172902745 20:38346756-38346778 CCAGAGCCACCTGACCCAGAAGG - Intronic
1174133139 20:48359886-48359908 CTGGAGCCACGTGACCCAGGGGG - Intergenic
1175106351 20:56617730-56617752 GCTGGGGCACCTGACCCTGGAGG + Intergenic
1176072967 20:63236308-63236330 CCGGGGCCACCTTGTCCAGGGGG + Exonic
1179490908 21:41741077-41741099 CCGGGGACCCCTGAACCAGACGG - Exonic
1179655504 21:42842043-42842065 CTGTGGCCACCTGACCCCGGGGG + Intergenic
1179985636 21:44919150-44919172 CTGTGGCCACCTGACCCCGGGGG - Intronic
1181433574 22:22897306-22897328 CTGGGGTCTCCACACCCAGGAGG - Intergenic
1181847443 22:25723045-25723067 CCGGGGCCCCCTCAGCCAGGTGG + Exonic
1183633858 22:39049236-39049258 CCGGGGTGACCTCTCCCAGCTGG - Intronic
1184407265 22:44307210-44307232 CCTGGGTCAGCAGCCCCAGGTGG - Intronic
1184783821 22:46662294-46662316 CTGTGGTCACCATACCCAGGGGG - Intronic
1185067199 22:48638460-48638482 CCTGGGTCACCGCACACAGGGGG + Intronic
1185067301 22:48638789-48638811 CCTGGGTCACCGCACACAGGGGG + Intronic
950522540 3:13505485-13505507 CAGGGGGCCGCTGACCCAGGTGG + Exonic
952485691 3:33807553-33807575 CTGTGGGCACCTGCCCCAGGGGG - Intronic
953198337 3:40754676-40754698 CTTGGGCCACCTCACCCAGGAGG + Intergenic
953627424 3:44582236-44582258 ACAGGGTCACTTTACCCAGGTGG + Intronic
954584569 3:51722164-51722186 CAGGGGTCTGCTGACCCAAGTGG + Intergenic
954745184 3:52783803-52783825 CAAAGGACACCTGACCCAGGGGG + Intronic
957231640 3:77525139-77525161 ACAGGGTCAACTGACCCAAGAGG + Intronic
966595185 3:181719545-181719567 CCCGGGTCACCTCACCCATGGGG + Intergenic
967220954 3:187247720-187247742 CCGGGGTCACCACAGCAAGGTGG + Intronic
968757846 4:2426099-2426121 CAGGGGTCACCCCATCCAGGAGG + Intronic
968807862 4:2787064-2787086 CTGGGGTCCCCTCTCCCAGGAGG + Intergenic
969464420 4:7347206-7347228 ACGGGGTCACCTGTCTCAGGTGG + Intronic
969609814 4:8220651-8220673 CCAGGATCACATGACCCAGAAGG - Intronic
972360954 4:38325174-38325196 CCGGTGCCACCGGCCCCAGGTGG - Intergenic
973598946 4:52522042-52522064 AGGGCGTCACCTCACCCAGGAGG + Intergenic
974746940 4:66089069-66089091 GCTGGGTCACCTAGCCCAGGTGG + Intergenic
982202268 4:152972649-152972671 TCGGGGACATCTGGCCCAGGTGG + Intronic
982712178 4:158768869-158768891 CCGGGCTCACGTAACCCCGGCGG - Intergenic
984834029 4:184002513-184002535 CAGGAGTCAGCTGAGCCAGGTGG + Intronic
985146002 4:186894980-186895002 CAGGGGTCACCTCACCCCCGTGG + Intergenic
985783231 5:1881610-1881632 GCCGGGTCATCTGTCCCAGGGGG + Intronic
986304343 5:6504417-6504439 CCGGGGCCACCAGACACTGGAGG - Intergenic
986402610 5:7395529-7395551 CCGGGGTCAGAGGACCCGGGGGG - Intergenic
988417694 5:30966857-30966879 CCAGGGTCAGCTGACTGAGGGGG - Intergenic
991703452 5:69336200-69336222 CAGGAGTCACCTGAACAAGGTGG + Intergenic
992754949 5:79895431-79895453 CTGGGGTCCCCTGGCCAAGGGGG + Intergenic
999093150 5:148955161-148955183 CAGGGCTCACCTGTCCCAGATGG + Intronic
999142422 5:149371364-149371386 CTTGGGTCACCTGCTCCAGGAGG - Intronic
999721214 5:154400512-154400534 CCTGGGTCACAGGCCCCAGGTGG + Intronic
999721952 5:154405115-154405137 CCGGGGTCTCCTGGCCGGGGCGG - Intronic
1001191713 5:169637819-169637841 CAGGAGTCATCTGACCCAGGAGG - Intronic
1001402290 5:171452555-171452577 CCCATGTCACCTGGCCCAGGAGG + Intronic
1001443236 5:171762367-171762389 CTGGGGGCACCTGACACAGATGG - Intergenic
1002570087 5:180135262-180135284 CCGGGGTCACTTCACACAGCAGG - Intronic
1003098199 6:3157899-3157921 CCGGGGGCCCCGGAACCAGGGGG + Intergenic
1007094306 6:39203928-39203950 CCCTGGTCACCTGACCCGGGGGG - Intronic
1007810317 6:44480942-44480964 CCGGGGCAAGCTGACCCTGGAGG - Intergenic
1008331261 6:50247388-50247410 GCTGGGTCACATGACCCAAGTGG - Intergenic
1011370242 6:86629441-86629463 AAGAGGTCACCTGACCCAGATGG + Intergenic
1015910177 6:138161858-138161880 CGGAGCGCACCTGACCCAGGCGG + Intergenic
1016383744 6:143511722-143511744 CCGCGGTCACCTGACCAAGTCGG + Intergenic
1017677327 6:156827468-156827490 CCTTGGGCACCTGACCCAGCTGG - Intronic
1018070074 6:160156683-160156705 CCTAGGTCACCTGACTCAGTAGG + Intronic
1019106081 6:169668044-169668066 CCGCAGTCACCGGGCCCAGGTGG + Exonic
1020103247 7:5407342-5407364 CCAGGCTCTCCTGCCCCAGGTGG - Intronic
1023720439 7:43088111-43088133 GGAGGATCACCTGACCCAGGAGG + Intergenic
1023995731 7:45157928-45157950 CGGGGTTCACCGGACCCGGGTGG + Intronic
1024007495 7:45237916-45237938 CCGGCCTCACCCGACCCAGGAGG + Intergenic
1026834302 7:73627821-73627843 CCAGGGTCCCCGGAGCCAGGAGG - Intergenic
1027882276 7:83855824-83855846 CTGGGGTCACATGAACCACGGGG + Intergenic
1029373944 7:100166890-100166912 CAGGAGTCACCAGCCCCAGGTGG + Intronic
1029409733 7:100401166-100401188 CCGGGAACCCCTGACCCAGGAGG - Exonic
1032786374 7:135203867-135203889 CCCAGGTCTCCTGACCCAAGGGG - Intronic
1035026776 7:155831448-155831470 CCGGGGTCTCCTGACAGCGGAGG - Intergenic
1035389969 7:158497281-158497303 GCTGGGTCACCTGGCCAAGGTGG - Intronic
1036663760 8:10725941-10725963 CCTGGATCAACTGAGCCAGGTGG - Exonic
1036785069 8:11680501-11680523 CCGAGGTGACCTGGCCCATGTGG - Intronic
1038037146 8:23696192-23696214 CCGGAGGCACCTGACCCAACTGG + Intergenic
1039591875 8:38756832-38756854 ACGGGGTCAGGGGACCCAGGCGG - Intronic
1040834242 8:51715747-51715769 CAGGTGTCAGCTGACTCAGGAGG + Intronic
1042194422 8:66220310-66220332 TCAGGGGAACCTGACCCAGGAGG + Intergenic
1044750509 8:95411232-95411254 ACGGGGTCACGTGAGCCATGTGG + Intergenic
1047955656 8:129973438-129973460 AGGGGGGCACCTGGCCCAGGCGG - Intronic
1048844529 8:138594164-138594186 CCGGGGGCATCTGGGCCAGGAGG + Exonic
1049414195 8:142487952-142487974 CTGGGCTCCCCTGTCCCAGGAGG + Intronic
1049621102 8:143598666-143598688 CCGGGGTCCCCTGCGCCCGGGGG - Exonic
1049670816 8:143869122-143869144 CGGGGTGCACCTGCCCCAGGCGG - Exonic
1055370634 9:75594462-75594484 ATGTGGTCACATGACCCAGGAGG + Intergenic
1056024779 9:82482503-82482525 CCTGGGTCACCTGCACTAGGTGG - Intergenic
1057171115 9:92963788-92963810 CCTGGGAGACCTGACCCACGAGG - Intronic
1058759719 9:108119264-108119286 CATGGGTCACCTGCCCCAGGAGG - Intergenic
1059251430 9:112890652-112890674 CCGAGGTCACCTGCCCGCGGAGG - Exonic
1061473042 9:130842644-130842666 CCGGGGTCAGCTGACACCAGAGG - Intronic
1062317423 9:135974975-135974997 CCTCGGTCACCTGGCCGAGGAGG + Intergenic
1062473900 9:136718332-136718354 CAGGGGTCCCCTGAGGCAGGTGG + Intronic
1190720524 X:53143796-53143818 CCGGGGTCACCTGATGATGGAGG + Intergenic