ID: 1144858202

View in Genome Browser
Species Human (GRCh38)
Location 17:18282569-18282591
Sequence GCCTGCAGGTTGGCAACAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 130}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144858191_1144858202 24 Left 1144858191 17:18282522-18282544 CCTCAAAGGCCTGATCCCACCCT 0: 1
1: 0
2: 1
3: 18
4: 214
Right 1144858202 17:18282569-18282591 GCCTGCAGGTTGGCAACAACAGG 0: 1
1: 0
2: 0
3: 9
4: 130
1144858194_1144858202 9 Left 1144858194 17:18282537-18282559 CCCACCCTGCTATGCTTTTAGGC 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1144858202 17:18282569-18282591 GCCTGCAGGTTGGCAACAACAGG 0: 1
1: 0
2: 0
3: 9
4: 130
1144858197_1144858202 4 Left 1144858197 17:18282542-18282564 CCTGCTATGCTTTTAGGCCAACA 0: 1
1: 0
2: 1
3: 3
4: 83
Right 1144858202 17:18282569-18282591 GCCTGCAGGTTGGCAACAACAGG 0: 1
1: 0
2: 0
3: 9
4: 130
1144858195_1144858202 8 Left 1144858195 17:18282538-18282560 CCACCCTGCTATGCTTTTAGGCC 0: 1
1: 0
2: 0
3: 16
4: 116
Right 1144858202 17:18282569-18282591 GCCTGCAGGTTGGCAACAACAGG 0: 1
1: 0
2: 0
3: 9
4: 130
1144858196_1144858202 5 Left 1144858196 17:18282541-18282563 CCCTGCTATGCTTTTAGGCCAAC 0: 1
1: 0
2: 1
3: 3
4: 108
Right 1144858202 17:18282569-18282591 GCCTGCAGGTTGGCAACAACAGG 0: 1
1: 0
2: 0
3: 9
4: 130
1144858192_1144858202 15 Left 1144858192 17:18282531-18282553 CCTGATCCCACCCTGCTATGCTT 0: 1
1: 0
2: 1
3: 19
4: 228
Right 1144858202 17:18282569-18282591 GCCTGCAGGTTGGCAACAACAGG 0: 1
1: 0
2: 0
3: 9
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144858202 Original CRISPR GCCTGCAGGTTGGCAACAAC AGG Intronic
911766561 1:101683336-101683358 GCCTGCAGGAGGGCAAGTACTGG - Intergenic
913214303 1:116607765-116607787 GTATGCAGGTGGGCTACAACAGG + Intronic
915970194 1:160349465-160349487 GCCTGCAGGATGGAAACAAATGG - Intronic
918091390 1:181298096-181298118 GGCTGCAGAGTAGCAACAACTGG + Intergenic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
1063420735 10:5910930-5910952 GCTTGCAGGGTGTCAACATCTGG + Exonic
1064287091 10:14001154-14001176 GGCTGCAGGTTGGAATCACCTGG + Intronic
1065929574 10:30467754-30467776 GGCTACAGGATGGCAACAGCTGG + Intergenic
1067415480 10:46098646-46098668 TCCTGCATGTTGACAACACCAGG + Intergenic
1067435519 10:46273721-46273743 TCCTGCATGTTGACAACACCAGG + Intergenic
1067437234 10:46286922-46286944 TCCTGCATGTTGACAACATCAGG - Intronic
1068012267 10:51466779-51466801 GCCTGAAGTTTGGCAAACACTGG + Intronic
1071487127 10:86109755-86109777 GCCTGCAGGTTAGAATCACCTGG - Intronic
1072501381 10:96021511-96021533 GGCTGCACATTGGCATCAACTGG - Intronic
1072611388 10:97019590-97019612 CTCTGCAGGTTGGCCACACCAGG + Intronic
1073510065 10:104037350-104037372 GCATGAAGGTTGGCAGCATCTGG - Intronic
1076858665 10:133129441-133129463 GCCTGCCGTTTGGCACCGACGGG + Exonic
1077146578 11:1049206-1049228 GGCTGCATGTGGGCACCAACTGG - Intergenic
1082122740 11:48397001-48397023 CCCAGCAGCTTGGCAACCACTGG + Intergenic
1082251889 11:49991673-49991695 CCCAGCAGCTTGGCAACCACTGG - Intergenic
1082556443 11:54568282-54568304 CCCAGCAGCTTGGCAACCACTGG + Intergenic
1085326467 11:75610466-75610488 GCCTGCAGGTTGGTCCCCACAGG - Intronic
1089617527 11:119703324-119703346 GCCTTCATGCTGGCACCAACGGG + Intronic
1090075751 11:123579097-123579119 GCCTGGAGGTTGGCAAACATTGG + Intronic
1094118268 12:26940169-26940191 GCCTGTAGGTTAGAAATAACTGG + Intronic
1095203653 12:39414597-39414619 GCATGCAGGCTGGTAAAAACAGG + Intronic
1096848774 12:54422070-54422092 GCAAGCAGGCTGGCGACAACAGG - Intergenic
1098079847 12:66772476-66772498 GGCTGAAGCTTGGCACCAACAGG - Intronic
1098237834 12:68434962-68434984 GCTTGGAGGCTGACAACAACAGG - Intergenic
1100223869 12:92536270-92536292 GCCTGCACTTTGGGAAGAACTGG + Intergenic
1100328418 12:93563906-93563928 ACCTGCAGGCTGGCAATCACGGG - Intergenic
1102414532 12:112749046-112749068 GCTTCCAGGTAGGCAACAAATGG - Intronic
1102577249 12:113863522-113863544 GCCTGCATGCTGGCACCAAGTGG + Intronic
1106334002 13:28766128-28766150 GCCTGAAGGTTGGAATCAACTGG + Intergenic
1108329229 13:49368482-49368504 GCCTGCGGGTTGCAAAAAACTGG - Intronic
1110719971 13:78750133-78750155 GTCTGCAGCTTAGCAGCAACAGG - Intergenic
1114155436 14:20098710-20098732 GTCTGCAGGTTGGCAACTGAGGG - Intergenic
1118710850 14:68518378-68518400 GTCTGCAGGCGGGAAACAACAGG + Intronic
1120559760 14:85976099-85976121 GCCTGGAGGTTGGCAATACAGGG + Intergenic
1122249616 14:100428562-100428584 GCTAGCAGGTCGGCATCAACAGG - Intronic
1126881951 15:53108822-53108844 GCCTGCAGGTTGGAGACAAGTGG + Intergenic
1127562372 15:60151980-60152002 GCCTCCAGGTTATCAACATCAGG + Intergenic
1129559503 15:76551974-76551996 ACCTGCAGGTTGTAAAGAACAGG + Intronic
1130515739 15:84624580-84624602 GCCTGGAGGTGGGAAACAGCGGG - Intronic
1131049627 15:89337937-89337959 GCCTGGAGCTTGGTAATAACCGG + Intergenic
1132980647 16:2737287-2737309 GCCTGCAGGAGGGCGACAAAAGG + Intergenic
1134642974 16:15844043-15844065 GCCTGCAGATGGGCCACTACAGG + Intronic
1135491922 16:22916795-22916817 CCCTGCAGCATGGCAACAATTGG + Intergenic
1135975268 16:27104613-27104635 GCCTGCTGGTTGGGAGGAACTGG - Intergenic
1138496593 16:57412731-57412753 GCCTTCAGGTGGGCAGCACCAGG - Intronic
1144858202 17:18282569-18282591 GCCTGCAGGTTGGCAACAACAGG + Intronic
1145252985 17:21306452-21306474 GCCTGTAGGTTCGCAAGCACAGG - Intronic
1145277121 17:21438845-21438867 TCCTGCAGGTGGCCAACAGCAGG - Intergenic
1145312314 17:21707455-21707477 GCCAGCAGGGTGGCAGCATCTGG - Intergenic
1145314957 17:21724738-21724760 TCCTGCAGGTGGCCAACAGCAGG - Intergenic
1145323590 17:21781464-21781486 GCCTGTAGGTTGGCAAGCACAGG + Intergenic
1145713394 17:26996676-26996698 TCCTGCAGGTGGCCAACAGCAGG - Intergenic
1149458978 17:56811938-56811960 GGCTGCAGGTTGGCATCACTGGG + Intronic
1149597839 17:57874626-57874648 GCCTGCAGCGTGGCAACCGCAGG + Intronic
1150308698 17:64109387-64109409 GCCTAAAGTTTGGCAACATCTGG - Intronic
1152178451 17:78802763-78802785 GCCTGCACATTGGCGTCAACAGG - Intronic
1152730553 17:81967653-81967675 GGCTGCATGTTGGCACCAGCCGG - Intergenic
1155065837 18:22268161-22268183 GCCAGCAGTTTGGCAACCAAGGG - Intergenic
1155532490 18:26781597-26781619 GACTGCAGGTTGGAATCACCTGG + Intergenic
1157090190 18:44627682-44627704 GCCTGCAGGTTAGAATCACCTGG - Intergenic
1157580184 18:48769529-48769551 CCCTGAAGGTGGGCACCAACAGG + Intronic
1157724655 18:49954670-49954692 GCCTGCTGGTTGGCAGACACTGG + Intronic
1159532008 18:69666814-69666836 GCCTGCAGGCTGCCATCAGCAGG + Intronic
1160367996 18:78345486-78345508 GTCTGTAGGCTGGCAGCAACAGG - Intergenic
1162688576 19:12409372-12409394 GCCTGGAGGCTGGCAACTCCTGG + Intronic
1164306230 19:24005995-24006017 GGCTGCAGGTTGTTTACAACAGG + Intergenic
1164548337 19:29187327-29187349 AGCTGCAGTTTGGCCACAACTGG + Intergenic
927448613 2:23187377-23187399 GCCTGTAGGGTGGCAGCAAAAGG + Intergenic
928359240 2:30649452-30649474 GCCTGCAGCCAGGCAACAGCAGG + Intergenic
928416597 2:31097686-31097708 GCCTGCTGGGTGTGAACAACAGG - Intronic
934650883 2:96090897-96090919 GCCTGCATGCTTGCAACAAAAGG + Intergenic
936043806 2:109170926-109170948 GCCTGCAGGTAGCCCACACCGGG + Intronic
938390054 2:130897898-130897920 GGCTGCAGATTGGCAAATACCGG + Intronic
938722553 2:134079432-134079454 GCCTGAAGGTTGGAAGCATCTGG - Intergenic
943566625 2:189524178-189524200 GGTTGCAGGTTGGAAACACCTGG + Intergenic
946749799 2:222882651-222882673 GACAGCAGGTAGGCAACAGCAGG - Intronic
948070359 2:235116414-235116436 GCCTGCAGGATGGGAGCATCGGG - Intergenic
1169492770 20:6085238-6085260 GCCTGCATGTTGGCATCGAAGGG - Exonic
1173698247 20:45041871-45041893 GCCTCCAGGTTGTTAACACCTGG - Intronic
1174446475 20:50594471-50594493 GCCTTCAGGGTGGCCACAGCTGG - Intronic
1175626384 20:60491455-60491477 CCCTGCAGGCTGGGAACAGCAGG - Intergenic
1175963596 20:62649083-62649105 GCCTCCAGCTTGCCAACGACAGG - Intronic
1179179551 21:39034118-39034140 GCCTGTAGGTTGGAAATAGCTGG + Intergenic
1181356694 22:22301343-22301365 TCCCTCAGGTGGGCAACAACAGG - Intergenic
1181489248 22:23251387-23251409 GGCTGCACGTCGGCAACACCTGG - Intronic
1183927194 22:41214685-41214707 GCCTGCATGTTGGGATCACCTGG + Intronic
1184996689 22:48212252-48212274 GACTGGATGTAGGCAACAACTGG + Intergenic
949860776 3:8502783-8502805 GCATTCAGGTAGGCAACAAGTGG - Intronic
950405951 3:12804694-12804716 GACTGCAGGTTAGCATCACCTGG + Intronic
950459774 3:13114338-13114360 GCCTGCAGGTGGGCAAAAGGGGG + Intergenic
954442724 3:50530563-50530585 GCCCGCAGGGTGCCAACATCGGG + Intergenic
955547384 3:60045688-60045710 GCCTCCAGGATGGAAACAAATGG + Intronic
957309105 3:78496663-78496685 GCCTGCAGGATAGGAACAGCAGG - Intergenic
958046655 3:88292945-88292967 GCCTGCAGGATGGCAAGCAAAGG - Intergenic
960970364 3:123135018-123135040 GCCTGCAGGGTGGGAAAACCGGG - Intronic
961649092 3:128408549-128408571 GCCTGCAGGTGGCCAACAGATGG - Exonic
969868306 4:10089612-10089634 GCCTGCAGGTGGGCAGCAAGAGG - Intronic
975179416 4:71327143-71327165 GCCTGCAGGGTGGCCACAGTGGG + Intronic
975943679 4:79678787-79678809 CCCTGCAGTTTGGCAACCAGTGG + Intergenic
977634767 4:99284576-99284598 CCCTGCAGGATGGCACCAGCAGG - Exonic
978325562 4:107550047-107550069 CCCTGCAGCATGCCAACAACAGG + Intergenic
981954516 4:150453751-150453773 GCTCACAGGTTGGGAACAACTGG + Intronic
982128872 4:152208931-152208953 TCCTGCAGATTGGCAAAAAAAGG - Intergenic
984789040 4:183597120-183597142 GCCTGCATGTTGGAAATACCTGG + Intergenic
984846790 4:184115228-184115250 CCCTGGAGGTTGCCAACCACAGG - Intronic
985224744 4:187747990-187748012 GCCTGCAAGTTGGCAGCCAAAGG - Intergenic
992170477 5:74096821-74096843 GCCTGCAGACAGGCAAAAACAGG - Intergenic
992680031 5:79144221-79144243 GACTGCATGTTGGAATCAACTGG - Intronic
994681180 5:102889318-102889340 GGCAGCAGGTTGGCAGTAACTGG + Intronic
998163708 5:139828384-139828406 GCCTGAAGGGTGGCAACAGCGGG + Intronic
1004707830 6:18141039-18141061 GCCTGCAGATTGGAATCAAGGGG + Intronic
1008878613 6:56356583-56356605 GCCTGCAAGTTGTCACCATCTGG - Intronic
1010394530 6:75375332-75375354 GCCTCCAAGTAGACAACAACTGG + Intronic
1022078218 7:26994307-26994329 CCCTGCAGTTTGGCCACAACCGG + Intronic
1022363664 7:29686825-29686847 GCTTGCAGTTTGGAAACAATTGG + Intergenic
1022697705 7:32726903-32726925 GCTTGCAGTTTGGAAACAATTGG - Intergenic
1032814412 7:135457205-135457227 GACTGGATGTTGGCAACAACAGG + Intronic
1032941749 7:136801051-136801073 TTCTGTAGGTTGGCCACAACAGG + Intergenic
1036181220 8:6586968-6586990 GCCTGCAGGCTGCCTGCAACGGG - Intronic
1038243494 8:25832063-25832085 GCATGGAGGTTGGCACAAACAGG + Intergenic
1044639392 8:94362653-94362675 ACCTGCTGGTTGTCAACAAAGGG - Intergenic
1045136030 8:99219398-99219420 GCCTGCAGCTTGGCTTCAAGTGG + Intronic
1047074013 8:121379144-121379166 GCCTGGAGGTAGCCAAAAACAGG + Intergenic
1048412401 8:134188797-134188819 GCCAGCAGCTTTGCAACAGCAGG - Intergenic
1049429239 8:142551488-142551510 GCCTGGAGGATGGCAACAGTTGG - Intergenic
1049720687 8:144114155-144114177 GCCTGCAGGTTGGAGGGAACTGG + Exonic
1056814789 9:89793224-89793246 GCCTGCAGGTTGACATCCACTGG - Intergenic
1056927109 9:90844308-90844330 ACCTGCAGGTGGGCCACAGCTGG + Exonic
1059994570 9:119896487-119896509 GACTGCAGTTTGAAAACAACTGG - Intergenic
1060519557 9:124286691-124286713 GCCTGCAGATGGGACACAACTGG - Intronic
1185449955 X:276586-276608 GCCTGGACGTTGGCAGCCACAGG + Intronic
1186979544 X:14944573-14944595 GCCTGCAAGTTGGAATTAACTGG + Intergenic
1187740750 X:22352975-22352997 GCCTGCAGATTGTCAAAACCAGG + Intergenic
1199593399 X:149488425-149488447 GCCTGCAGGATGGCAACGTGAGG + Intronic
1199598620 X:149527006-149527028 GCCTGCAGGATGGCAACGTGAGG - Intronic