ID: 1144860850

View in Genome Browser
Species Human (GRCh38)
Location 17:18300865-18300887
Sequence CATGGTCTGCAGAAGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 349}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144860838_1144860850 28 Left 1144860838 17:18300814-18300836 CCCAGTGGTCCAGGGTCAAAGGG 0: 1
1: 0
2: 2
3: 9
4: 138
Right 1144860850 17:18300865-18300887 CATGGTCTGCAGAAGGGGCAGGG 0: 1
1: 0
2: 2
3: 28
4: 349
1144860840_1144860850 27 Left 1144860840 17:18300815-18300837 CCAGTGGTCCAGGGTCAAAGGGT 0: 1
1: 0
2: 0
3: 10
4: 128
Right 1144860850 17:18300865-18300887 CATGGTCTGCAGAAGGGGCAGGG 0: 1
1: 0
2: 2
3: 28
4: 349
1144860842_1144860850 19 Left 1144860842 17:18300823-18300845 CCAGGGTCAAAGGGTGGAGTGAG 0: 1
1: 0
2: 1
3: 42
4: 628
Right 1144860850 17:18300865-18300887 CATGGTCTGCAGAAGGGGCAGGG 0: 1
1: 0
2: 2
3: 28
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144860850 Original CRISPR CATGGTCTGCAGAAGGGGCA GGG Intronic
900299699 1:1970439-1970461 CGTGGACTGGAGTAGGGGCAGGG + Intronic
900342697 1:2196212-2196234 CATGGTCTGCAGGAGGGCCTTGG + Intronic
900507167 1:3035433-3035455 CATGGTCAGCAGTTTGGGCAGGG + Intergenic
900703313 1:4061183-4061205 CGTGGTCAGCAGAGGAGGCATGG + Intergenic
901018383 1:6244178-6244200 CATGGACTGCAACATGGGCACGG + Exonic
901149147 1:7088745-7088767 CATGGTCCTGAGCAGGGGCATGG + Intronic
901261782 1:7876426-7876448 CATGTGCTGCAGAGGGGGGAGGG + Intergenic
901603956 1:10444576-10444598 TATGGTGAGGAGAAGGGGCAAGG + Intronic
902187125 1:14733883-14733905 CGTGGGCTGCAGATTGGGCAAGG - Intronic
902219171 1:14953993-14954015 GATGGGCTGCAGAAGGGCAAGGG + Intronic
902659785 1:17893040-17893062 CAGAGGCTGCAGAAGGGGAACGG - Intergenic
904054589 1:27661829-27661851 TCTGATCTGCAGAAGGGGTAGGG - Intergenic
904377061 1:30088316-30088338 CCTGGCCTGCAGAAGGAGCAGGG - Intergenic
905861837 1:41357319-41357341 GATGGTGTGCAGAATGGGCTTGG + Intergenic
905940728 1:41861171-41861193 CATGGTCCCCAGATGGAGCATGG - Intronic
906159479 1:43637155-43637177 GATGGGGTGCAGAATGGGCAGGG + Intergenic
906759368 1:48360717-48360739 AATAGTCTGCAGAGGGGCCAAGG + Intronic
906953774 1:50355562-50355584 CATGGGCTGCAGAATGGACCTGG - Intergenic
909523144 1:76592459-76592481 CATGGTATGGATAAGGTGCATGG + Intronic
910055854 1:83032301-83032323 CAAAGTCTGCTGCAGGGGCAGGG + Intergenic
912225544 1:107729547-107729569 CATGGTGCACTGAAGGGGCATGG + Intronic
912242324 1:107924106-107924128 CATATTCTGGAGAAGGGACATGG + Intronic
914754436 1:150554638-150554660 AGTGGTCTGCAGAAGGGTCGGGG + Intronic
916056792 1:161073637-161073659 CCTGGTCTGCAGAGGGGCCCAGG + Intronic
916747472 1:167695396-167695418 CATGGTCTCAAGAAAGGGCTTGG + Intronic
917488831 1:175479966-175479988 CATGTTCCTCAGAAGGTGCAAGG + Intronic
917597607 1:176544927-176544949 CAAGGTATGGGGAAGGGGCACGG + Intronic
917789178 1:178488442-178488464 CAGGGTCTGGGGAAGTGGCAAGG - Intergenic
919224598 1:194679722-194679744 CATTGTAAACAGAAGGGGCAGGG + Intergenic
919706694 1:200683061-200683083 CATGGTCATCTGAGGGGGCATGG + Intergenic
919742905 1:200991269-200991291 CTTGGGCTGCAAAAGGGCCAAGG + Intronic
920674357 1:208029083-208029105 AGTGGGCAGCAGAAGGGGCACGG - Intronic
920987180 1:210901654-210901676 CAGGGGCTGGAGATGGGGCATGG + Intronic
921259319 1:213371728-213371750 TATGTTATGCAGAAGTGGCAGGG - Intergenic
922728966 1:227940229-227940251 CCTGGACCCCAGAAGGGGCATGG + Intronic
923070547 1:230560601-230560623 CATGCTCTGCAGAAGGGGGTAGG - Intergenic
923222162 1:231905291-231905313 TATGGTCTTCAGAAGTGCCAAGG + Intronic
923256254 1:232223990-232224012 GATGGGTTGCAGAAAGGGCAGGG - Intergenic
923521630 1:234739428-234739450 AAGGGGCAGCAGAAGGGGCATGG - Intergenic
923785084 1:237058781-237058803 GCTGGTCTGGAGAAGGGGCGGGG + Intronic
923791623 1:237116182-237116204 CTTGTTTTGCAGAAGGGGAAGGG + Intronic
924920060 1:248619482-248619504 CAGGGGCTGCAGAAGAGGGAGGG + Intergenic
1062779639 10:190370-190392 GAGGGTGTGCAGAAGAGGCAGGG - Intronic
1066758984 10:38737168-38737190 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1066962645 10:42235601-42235623 CAGGGTCAGGACAAGGGGCAGGG + Intergenic
1067675492 10:48371956-48371978 CAAGGCGTGGAGAAGGGGCATGG + Intronic
1070527407 10:77307140-77307162 CAAGATCAGCAGAAGGGGCATGG + Intronic
1070675788 10:78410394-78410416 CATGGTCTGGAGAAGGCAAAGGG - Intergenic
1072008866 10:91286269-91286291 CAGGGTTTGCAGGAGGAGCAGGG - Intergenic
1074196874 10:111196608-111196630 CATGTTCTGCAGAAGGCAAATGG + Intergenic
1075616203 10:123892180-123892202 AATGGTCAGCACACGGGGCACGG - Intronic
1076425450 10:130364277-130364299 CCTGCTCTGGAGAAGGAGCAAGG - Intergenic
1077169670 11:1160595-1160617 CATGGCCTGCAGAAAGAGGAGGG - Exonic
1077249464 11:1554609-1554631 AACGGCCTGCAGAAGGGACAAGG + Exonic
1078099518 11:8321513-8321535 CAGGGGCTGGAGAAGGGACAGGG - Intergenic
1079137361 11:17783432-17783454 CACGGTCTGCATAAGGGGCTGGG - Intergenic
1079259424 11:18864039-18864061 GATGCTCTGCAGCAGGGACAGGG + Intergenic
1080359037 11:31491688-31491710 CATGCTCTGGAGAAGGGCCAAGG + Intronic
1080371620 11:31652840-31652862 CATGGTCTCAAAAGGGGGCAAGG + Intronic
1080735313 11:35008398-35008420 TCTGGTCTGCAGAAGGTGAAAGG - Intronic
1082901368 11:58256579-58256601 GATGGTCTGCTGCAGGGGAAAGG + Intergenic
1083674946 11:64319875-64319897 CCTGATCTTCAGAAGGGGAAGGG - Intronic
1083827508 11:65211793-65211815 CCTGGTCGGCAGCAGGGCCAGGG - Exonic
1084008214 11:66334219-66334241 CATGTTCTGCCGGAGGGACAGGG + Exonic
1084156266 11:67314466-67314488 CACAGGCTGCAGGAGGGGCAGGG - Intergenic
1084156846 11:67317935-67317957 CCCGGTCTGCAGAAGGTCCAGGG + Intronic
1084642053 11:70431943-70431965 CATGGGATGGAGAAAGGGCAAGG - Intronic
1086084120 11:82937718-82937740 CATGGCCTGCAGAAGGGGGAAGG + Intronic
1089281806 11:117379985-117380007 CATTGTCTGCTGATGGGGCCAGG + Intronic
1089929155 11:122292177-122292199 CATGGTATGTGGCAGGGGCATGG + Intergenic
1089977044 11:122741834-122741856 CTTGGTCAGCAGAAGGGTCCAGG - Intronic
1090412464 11:126518725-126518747 CCTGGTCTGGGGAAGGGGAATGG - Intronic
1090416421 11:126543671-126543693 CGTGGTCTTCAGGAAGGGCAGGG - Intronic
1090637415 11:128699011-128699033 CATGATCTGTAGAAGGGCCTGGG - Intronic
1091409017 12:227054-227076 GATGGTGTGAAAAAGGGGCAAGG + Intronic
1091593435 12:1858868-1858890 CTTGGTCTACAGAATGGCCAGGG - Intronic
1094569184 12:31626961-31626983 CATGGGCTCCTGAAGTGGCAGGG + Intergenic
1095183618 12:39175666-39175688 CATGGACTGGAGTTGGGGCAGGG - Intergenic
1095960034 12:47828742-47828764 CAGGGACTGCAGAAAGGGCCTGG + Intronic
1096652196 12:53067372-53067394 GAGGGTCTGCAGGAAGGGCACGG + Intronic
1098075430 12:66724789-66724811 CTTTGTCTGCAGAAGTGGAAGGG + Intronic
1099474344 12:83089759-83089781 CATTGTCTACAAAAAGGGCATGG - Intronic
1100524676 12:95408186-95408208 CAAGGTCTGCAGGAGGGCCAGGG + Intergenic
1100849989 12:98699517-98699539 CGTGGTCTGCTGATGGTGCAAGG + Exonic
1101595537 12:106161304-106161326 CATGGTCTGCAAAAGGAGAAAGG + Intergenic
1101972855 12:109328597-109328619 CATGAAATGCAGAAGGGGAAAGG - Intergenic
1103034388 12:117644647-117644669 CATGGTCAGCAGAAAGCCCATGG + Intronic
1103335269 12:120184630-120184652 CCTTGTCTGCAGAATGGGGATGG - Intronic
1103462677 12:121117515-121117537 CATGGTCAGCAGAATGAGGATGG + Intergenic
1105604568 13:21916202-21916224 TAGGGTCTGCAGAAGTGGAAGGG + Intergenic
1107265279 13:38546117-38546139 CAGAGTCTGGAGAAGGAGCATGG + Intergenic
1107389923 13:39953215-39953237 CATGCTCTGAAGGAGAGGCAGGG + Intergenic
1110167436 13:72460324-72460346 CTTGGTCTGTAGAATGGGGAGGG + Intergenic
1110236380 13:73221754-73221776 CATGGCCTGGGGAGGGGGCAAGG - Intergenic
1110236600 13:73223427-73223449 CATGTCCTTCAGAAGGGGCAGGG + Intergenic
1113649701 13:112026944-112026966 CATGGTTTGCAGAAAGGAAACGG + Intergenic
1114085757 14:19235880-19235902 CATGGGTTGAAGAAGGGGCCTGG + Intergenic
1114977240 14:28117120-28117142 CATGGTGTGCAGACTGGGCTTGG + Intergenic
1115260208 14:31444429-31444451 GATGGTCTGCAGAAAAGGAATGG + Intronic
1116093078 14:40333589-40333611 CAAGGTATGATGAAGGGGCATGG - Intergenic
1116411238 14:44626150-44626172 CATAGACTGCAGAAGGGAGAGGG + Intergenic
1117726476 14:58679717-58679739 CATGGTCTGGGGAAGAGGGATGG + Intergenic
1119643898 14:76334879-76334901 GCTGGTCTGCAGCAGGGACAGGG + Intronic
1120228241 14:81814757-81814779 CATGGCCTACAGAGAGGGCAAGG + Intergenic
1120497769 14:85257803-85257825 AATGGTCTGGAAAATGGGCAAGG - Intergenic
1121073066 14:91042764-91042786 CATGGTCCTGAGAAGGGGGATGG - Intronic
1121255663 14:92528502-92528524 CATGGTCTTCTGAAGGGCCCTGG + Intronic
1121808646 14:96857581-96857603 GATGGACTGCTGAAGGAGCAAGG + Intronic
1122021436 14:98840916-98840938 CATGGTCTGAACAAGAGGCCTGG - Intergenic
1122218191 14:100218216-100218238 CTTGGCAAGCAGAAGGGGCACGG - Intergenic
1122266325 14:100548598-100548620 CAGGGTGCCCAGAAGGGGCAGGG - Intronic
1122459770 14:101885162-101885184 CATGGCCTGGAGAAGGGGCCAGG + Intronic
1123053930 14:105560450-105560472 CAGGGACTGCGGATGGGGCAAGG - Intergenic
1202897309 14_GL000194v1_random:17593-17615 CATGGGTTGAAGAAGGGGCGTGG + Intergenic
1202929718 14_KI270725v1_random:26772-26794 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1123422583 15:20144472-20144494 CAGGGTCAGGACAAGGGGCAGGG + Intergenic
1123442431 15:20301892-20301914 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1123531811 15:21151012-21151034 CAGGGTCAGGACAAGGGGCAGGG + Intergenic
1123830982 15:24136879-24136901 CAGGGTATGCAGAAGGAACATGG + Intergenic
1123836064 15:24194254-24194276 CAGGGTATGCAGAAGGAACATGG + Intergenic
1123871471 15:24578974-24578996 CAGGGCATGCAGAAGGGGCATGG + Intergenic
1124609485 15:31198489-31198511 CATGGTGAGCTGAAGGGACAAGG - Intergenic
1124713105 15:32031009-32031031 CATGATCTGCAGGAGGCTCAGGG - Exonic
1128748398 15:70131213-70131235 CAAGGACTGCAGAAGGATCAGGG - Intergenic
1130827649 15:87565965-87565987 CCTGTTCAGCAAAAGGGGCAAGG - Intergenic
1130978184 15:88793105-88793127 CTTGGCATGCAGAGGGGGCAGGG + Intergenic
1131034757 15:89214942-89214964 CAAGGTCTGTAGAGGGGGAAAGG - Intronic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132329856 15:101004735-101004757 CCTGAACTGCAGAAGGAGCAGGG - Intronic
1132904333 16:2274465-2274487 GATGCCCTGCAGAAGGGCCATGG + Intergenic
1135543275 16:23348633-23348655 CATCGGCTGCAGAAGGGCCCCGG + Exonic
1136141008 16:28288726-28288748 CCTGGTCAGCAGAGAGGGCAGGG - Intergenic
1136862169 16:33710888-33710910 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1138336787 16:56259678-56259700 AGTGGTCTGCAGAAGGGGCAGGG + Intronic
1139029883 16:62867256-62867278 GAAGGTCTGGAGAAGTGGCAGGG - Intergenic
1139530916 16:67542346-67542368 CTAGGTGTGCAGATGGGGCAGGG - Exonic
1142001524 16:87667058-87667080 CAGAGGCTGCAGAGGGGGCACGG - Intronic
1142115672 16:88354918-88354940 CAGGGTCTCCAGTGGGGGCAGGG + Intergenic
1203123663 16_KI270728v1_random:1559071-1559093 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1143222353 17:5273230-5273252 TATGGTCTGCAGGCTGGGCATGG + Intergenic
1143368392 17:6423049-6423071 TATGGCCTGCAGAGGGAGCAAGG - Intronic
1143407024 17:6684394-6684416 CATGGCTAGCAGAAGGAGCAGGG + Intergenic
1143617840 17:8064226-8064248 CCGGGGCTGCAGGAGGGGCATGG + Intergenic
1144536793 17:16097616-16097638 CAAGGTGTGCAGAAGGGGTGTGG - Intronic
1144653703 17:17022246-17022268 CATGGTGTGCAGAATGAGCTCGG + Intergenic
1144708515 17:17385459-17385481 CAGGGGCTGCAGAGGGGGGATGG - Intergenic
1144860850 17:18300865-18300887 CATGGTCTGCAGAAGGGGCAGGG + Intronic
1146464715 17:33077148-33077170 CAAGGTCTGCAGGAGAGCCAAGG - Intronic
1146559321 17:33854624-33854646 CAAGATCTGCAGAAAGAGCAGGG + Intronic
1146974091 17:37096310-37096332 CCTGGTAGGAAGAAGGGGCAGGG - Intronic
1149553932 17:57559769-57559791 CAGTGTCTGCAGAAGGGCCAAGG + Intronic
1150470265 17:65431290-65431312 CCTCCTCTGCAGCAGGGGCATGG + Intergenic
1151181121 17:72329469-72329491 CATGTTCTGCAGGAAGGGCTGGG - Intergenic
1151378712 17:73710098-73710120 CAAGGTCTGCAGATGGAGCTTGG - Intergenic
1152215183 17:79027871-79027893 GATGGTCTCCAGCAGGGGCACGG + Intronic
1153741799 18:8137687-8137709 CAGGGTCTGGAGCAGGGGCTGGG - Intronic
1154111219 18:11570148-11570170 CTTGGTGTGCAGAGGGGGAATGG - Intergenic
1158318221 18:56235578-56235600 CATGGCCTCCAGAAGGAACAGGG - Intergenic
1158555699 18:58472938-58472960 GATGGCCTGAAGGAGGGGCAAGG + Intergenic
1159475596 18:68916874-68916896 CATGGTTTGCAGAGGGCCCAAGG + Intronic
1160559977 18:79750062-79750084 CAAGATCTGCAGATGAGGCATGG + Intronic
1161387987 19:4007207-4007229 CCTGGTGTGCAGATGGGGCGTGG - Intergenic
1163435502 19:17292826-17292848 CAGGATCTGCAGAAGACGCAGGG + Exonic
1165127898 19:33613700-33613722 CATGGCCTGCAGAAGGTTTATGG - Intergenic
1165245799 19:34497795-34497817 GATGGTCTGCAGAGGGGCCAGGG + Intronic
1165483777 19:36083046-36083068 CAGGGTCTGCAGGAAGGACAGGG - Exonic
1166067409 19:40367897-40367919 CCTGGCCGGCAGCAGGGGCAGGG + Intronic
1166277141 19:41761892-41761914 CCTGGTCTGTGGAAGGGCCACGG - Intronic
1167410038 19:49339084-49339106 CGGGGTCTGCAGGAAGGGCAGGG + Intronic
1167986799 19:53325247-53325269 CATGGATGGCAGAAGGGGGATGG - Intergenic
925288054 2:2728790-2728812 CATGGCCTGCCGGAGGGCCACGG + Intergenic
925348447 2:3186033-3186055 CATGAACTGCAGGAGCGGCACGG - Intergenic
925910358 2:8569759-8569781 CATGCACTGCAGAGGGGACACGG - Intergenic
926211536 2:10874421-10874443 CAGGGTTTGTAGAAGGTGCAAGG - Intergenic
927062723 2:19439698-19439720 CATGGTCTGCAAAAGGCACAGGG - Intergenic
927938568 2:27089291-27089313 CAGGGACTGGGGAAGGGGCACGG + Intronic
928175112 2:29028189-29028211 CATGGTCTCCAGTTGGGGCGAGG - Intronic
928240153 2:29578955-29578977 CATGGACTGCTGAATGGGGAGGG + Intronic
929314342 2:40459458-40459480 CAGGGTCAGCAGCAGAGGCATGG + Intronic
929686770 2:44041824-44041846 CATGATCTGCATGAGGGTCAAGG + Intergenic
932134754 2:69218569-69218591 GAAGATCTGCAGAAAGGGCAAGG + Intronic
934064686 2:88330105-88330127 CATGTTCTTCAGATGCGGCAGGG - Intergenic
934460617 2:94212330-94212352 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
934517327 2:94996904-94996926 CAAGGTATGGGGAAGGGGCATGG - Intergenic
934559929 2:95307746-95307768 GATGGGCTGCAGACGGGGCTGGG + Intronic
934714878 2:96537596-96537618 CTCGGTCTGCAGAAGGGACGGGG + Intronic
935266986 2:101403193-101403215 CAGGGTCTGCAAGAGGGGCAAGG - Intronic
935666690 2:105518534-105518556 CATGGTCTGCAGGCGGGGTGGGG + Intergenic
937333407 2:121045869-121045891 AATCGTCTGCAGAAAGTGCAGGG + Intergenic
937968983 2:127535539-127535561 GCTGCTCTGCAGAAGGGGCCTGG + Intergenic
938386404 2:130870218-130870240 CAGGGTAGGCTGAAGGGGCAAGG + Intronic
938446256 2:131381913-131381935 CATTGTCTGCAGTAGAGGCCTGG + Intergenic
938491005 2:131761204-131761226 CATGGGTTGAAGAAGGGGCCTGG - Intronic
939119417 2:138098987-138099009 CATGGTGAGCAGATAGGGCATGG + Intergenic
939569996 2:143829890-143829912 CATGTTTTGCAGTGGGGGCAAGG + Intergenic
939593329 2:144093699-144093721 CAAGAGCTGCAGAAGGGTCAGGG + Intronic
939897689 2:147811305-147811327 CATGGTCAGCAGCAGGGCAAAGG - Intergenic
943795445 2:191987177-191987199 GATTGTCTGGGGAAGGGGCAGGG - Intronic
946503600 2:220275864-220275886 CATGGCTGGCAGAGGGGGCAGGG + Intergenic
947700545 2:232230676-232230698 CATGGTCTGCAGAGTGGGTGAGG + Intronic
948017891 2:234704957-234704979 CAGCTTCTGCAGAGGGGGCAGGG + Intergenic
949006900 2:241654860-241654882 CATGGACAGCAGGAAGGGCAAGG - Intronic
1168914609 20:1475887-1475909 AAAGGGCTGCAGCAGGGGCAAGG + Exonic
1170825473 20:19790877-19790899 CATGGTCTGGACAAAGGGAAGGG - Intergenic
1171448255 20:25219566-25219588 CATGGTCTGCTTCAGGGGCTGGG + Intronic
1172082144 20:32350570-32350592 ACTGGTCTGCAGTTGGGGCAGGG - Intergenic
1173863117 20:46297185-46297207 CAAGGGCTCCAGGAGGGGCAGGG + Intronic
1175401164 20:58700867-58700889 CAGGGGCAGGAGAAGGGGCAGGG + Intronic
1175469937 20:59220370-59220392 CCTGGTCTTCACAAGGGGCCAGG + Intronic
1176118568 20:63444045-63444067 CTTTGTCTGCAGAATGGGCAGGG - Intronic
1176379201 21:6103367-6103389 CAGGGGCAGCAGCAGGGGCAGGG + Intergenic
1176379221 21:6103421-6103443 CAGGGGCAGCAGCAGGGGCAGGG + Intergenic
1176591740 21:8655371-8655393 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1176616994 21:9033582-9033604 CATGGGTTGAAGAAGGGGCGTGG + Intergenic
1176717388 21:10364586-10364608 CAGGTCCTGGAGAAGGGGCAAGG - Intergenic
1178414540 21:32393120-32393142 CGTGGCCTGCAGAAGGGGCGGGG + Exonic
1178578849 21:33819343-33819365 TATGTTCTTCAGAAGGGTCAAGG + Intronic
1178620687 21:34171767-34171789 CATGCTCAGGAGAAGGAGCAAGG - Intergenic
1178692598 21:34761818-34761840 CAAGGTCTGCAGAAGGAGTCAGG - Intergenic
1178711660 21:34922594-34922616 CATGGGCTGATGAAGGAGCATGG + Intronic
1179744252 21:43434816-43434838 CAGGGGCAGCAGCAGGGGCAGGG - Intergenic
1179744272 21:43434870-43434892 CAGGGGCAGCAGCAGGGGCAGGG - Intergenic
1180059431 21:45376919-45376941 CATGTTCTGCAGCAGAGGGAGGG + Intergenic
1180274587 22:10632483-10632505 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1180292217 22:10857313-10857335 CATGGGTTGAAGAAGGGGCCTGG - Intergenic
1180298612 22:11017506-11017528 CAGGTCCTGGAGAAGGGGCAAGG - Intergenic
1180495022 22:15886735-15886757 CATGGGTTGAAGAAGGGGCCTGG - Intergenic
1180549070 22:16527427-16527449 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1180800098 22:18627693-18627715 GAGGGTGTGCACAAGGGGCAGGG - Intergenic
1180851331 22:19023258-19023280 GAGGGTGTGCACAAGGGGCAGGG - Intergenic
1181034821 22:20164820-20164842 CAGGGGCAGGAGAAGGGGCAGGG + Intergenic
1181221617 22:21367573-21367595 GAGGGTGTGCACAAGGGGCAGGG + Intergenic
1181355630 22:22294425-22294447 CAGGGTCAGGACAAGGGGCAGGG + Intergenic
1181446916 22:22984124-22984146 CATGGTTTCCAGCAGGGTCAGGG - Intergenic
1181466444 22:23113083-23113105 CAGGGTCAGCCGCAGGGGCAGGG - Intronic
1182745439 22:32602220-32602242 CCTGGTCTGGAGAAGGGGAGTGG - Intronic
1184831115 22:46988487-46988509 CATGGTCTGCAGAACGAATATGG + Intronic
952043284 3:29285654-29285676 CCTGGTATGAAGAAGGGGCCAGG + Intronic
952337899 3:32420810-32420832 AATGGCCTGCAGAAGTGGCAAGG + Intronic
953542524 3:43834747-43834769 CATGAGGTGCAGAAGAGGCAAGG - Intergenic
953711386 3:45273893-45273915 CATGCACTGCAGATGGGGGATGG + Intergenic
953715973 3:45317369-45317391 CAAGCTCTTCAGAAAGGGCATGG - Intergenic
954106555 3:48412684-48412706 CATGCCCTGGAGAAGGGGCAGGG + Intronic
955399550 3:58581618-58581640 CATGCTCTGCAGAAAGGACTCGG + Intronic
955833227 3:63026600-63026622 GAGGGTCTGCTGCAGGGGCATGG - Intergenic
955867447 3:63400029-63400051 CATCCTCTGCAGAATGGGCTGGG - Intronic
956223749 3:66933344-66933366 CAAGGTAAGCAGAAGGGACAAGG - Intergenic
957435990 3:80177205-80177227 CATGGTCTGCAGCAAGGGACTGG - Intergenic
959584725 3:108015422-108015444 CAGGGCATGCAGGAGGGGCATGG - Intergenic
962254503 3:133861107-133861129 CCAGGCCTGCAGAAGGGGAAGGG + Intronic
962279034 3:134036371-134036393 GTTGGTCTGCAGACGGGGCCAGG - Intronic
967213526 3:187190590-187190612 CTTATTCTGAAGAAGGGGCAAGG - Intergenic
968743097 4:2341111-2341133 CATGGGCAGCAGCAGGGGCTGGG - Intronic
969606435 4:8204470-8204492 CATGGTGTTCTGGAGGGGCAGGG + Intronic
969610104 4:8223010-8223032 CAGGGGCTGCAGAAGGGAAAGGG - Intronic
970246159 4:14065993-14066015 TAAGGTCTGCAGAAAGGTCAGGG + Intergenic
974056480 4:56988162-56988184 CAGGGTTTGGAGAAGGGGCCGGG + Intronic
974981535 4:68963699-68963721 CTTGGAATGCAGAAGAGGCAAGG - Intergenic
975662200 4:76699028-76699050 CATGGCCTGCATAAGGGAGATGG - Intronic
977445279 4:97123974-97123996 CATGCACTGCAGGAGGGGCTTGG - Intergenic
979552019 4:122002091-122002113 CATGGTCTCCTGACAGGGCAGGG - Intergenic
983395891 4:167195280-167195302 CATGGTCTGAAAATGGGACAAGG - Intronic
983765227 4:171472356-171472378 CAGGGACTGTAGAAGGTGCAGGG + Intergenic
986782718 5:11081816-11081838 CAGGGGCTGGAGAAGGGGGATGG + Intronic
987719289 5:21614234-21614256 CAGGGTATGCAGAAGAGGCATGG - Intergenic
988202130 5:28082768-28082790 CATGTTCTGCAGAACCAGCAGGG + Intergenic
989821562 5:45800023-45800045 CATGCTCTGCAGAGCCGGCAGGG + Intergenic
990056557 5:51587784-51587806 CGTGGTTTTCAGTAGGGGCAAGG + Intergenic
990389916 5:55308126-55308148 CAGGGTCTGCAGACAAGGCAGGG + Exonic
990577231 5:57135197-57135219 TACGGTCTGAAGAATGGGCAAGG - Intergenic
991400351 5:66245217-66245239 CAGGGTCTGCACAGGGGACAAGG + Intergenic
996302952 5:122009770-122009792 CATGTTCTGCAGTAATGGCAAGG + Intronic
996564033 5:124861080-124861102 AAAGGTCTGCAGAAGGGAAAGGG + Intergenic
997352094 5:133238488-133238510 CTTGGTCTGGATAAGGGCCAGGG - Intronic
997475635 5:134140850-134140872 CAGGGGCTGCAGTGGGGGCAGGG - Intronic
998153228 5:139769162-139769184 CATAGTCTGAAGAAGGAGCATGG + Intergenic
999191221 5:149748871-149748893 GCTGCTCTGCAGAAGGGGAAAGG + Intronic
999620373 5:153466711-153466733 CAAGGTATGGAGCAGGGGCATGG + Intergenic
1000696058 5:164385642-164385664 CATGGTCTGCAAAGAGGGCTTGG + Intergenic
1001028797 5:168246740-168246762 CATGGACTGCAGAAAGGAAAGGG - Exonic
1001866142 5:175107170-175107192 CATGGTCAGCAGAATGGCAATGG - Intergenic
1002352192 5:178590665-178590687 GGTGGGCTGCAGAAGGGGCGCGG - Intergenic
1003235932 6:4295116-4295138 CATGCCCTGCAGAAGGGGTGAGG - Intergenic
1004171647 6:13299948-13299970 AATGCCCTGCAGAAGGGCCAGGG - Intronic
1006273783 6:32984920-32984942 CATGGCTTGCCGAAGGGGCAGGG + Intergenic
1006849777 6:37089939-37089961 TATGCTCTGCAATAGGGGCAGGG + Intergenic
1007070577 6:39035115-39035137 CATGGTAACCAGAAGGAGCATGG + Intergenic
1007187851 6:39987694-39987716 CATTGTCTGTACAATGGGCAAGG - Intergenic
1007224687 6:40304688-40304710 CATACTCTGCAGCAGGGTCATGG + Intergenic
1007722616 6:43894197-43894219 TATGCTCTGCAGGAGTGGCAGGG + Intergenic
1007848697 6:44782442-44782464 CTTGCTCAGCAGTAGGGGCAGGG - Intergenic
1007915661 6:45559341-45559363 GATGGTCTGCTGAAGGACCATGG + Intronic
1009818891 6:68773934-68773956 CATGGGATGCATAATGGGCAAGG + Intronic
1011399019 6:86939465-86939487 CATGGGCTGCAGAAGCTCCAAGG + Intronic
1011848616 6:91598376-91598398 CATGGTCTGAAGAATGGACAGGG + Intergenic
1012657437 6:101842231-101842253 CATGGCCTGAAGAAGAGGAATGG - Intronic
1013853472 6:114543079-114543101 CAGGGGCTGGAGAAGGGGGATGG - Intergenic
1015192368 6:130485439-130485461 GATGGTAAGCAGAAGAGGCAGGG + Intergenic
1017261513 6:152393032-152393054 GATTGTCTGCAGAAGTGGCCAGG + Intronic
1017780433 6:157711401-157711423 AAAGGTCTGCAAAATGGGCAGGG - Intronic
1017816788 6:158022033-158022055 CATGTTCTGCAGAAGGGAGGCGG + Intronic
1018362104 6:163081327-163081349 CAGGGACTACAGCAGGGGCATGG + Intronic
1018573313 6:165233235-165233257 CAGGGGCTGCAGCTGGGGCAGGG + Intergenic
1019497727 7:1348209-1348231 CAAGGTCTGCAGGGAGGGCAGGG - Intergenic
1019829083 7:3308210-3308232 CATGGCTGGAAGAAGGGGCAAGG + Intronic
1021991519 7:26145982-26146004 CAAGGTATGGGGAAGGGGCACGG - Intergenic
1022778647 7:33554963-33554985 CAAGGTCAGCAGATGGAGCAAGG + Intronic
1022799485 7:33761945-33761967 GGTGGTCTGCATAAGGGGCTGGG + Intergenic
1023713904 7:43023211-43023233 AATGGACTGCAGACTGGGCAGGG + Intergenic
1025142592 7:56478518-56478540 GATGAGCTGCAGAAGGAGCAGGG + Intergenic
1025610806 7:63074056-63074078 GATGAGCTGCAGAAGGAGCAGGG - Intergenic
1025708653 7:63889119-63889141 GATGAGCTGCAGAAGGAGCAGGG + Intergenic
1029160832 7:98550645-98550667 CATGGTCTGGAGGAGGAGGAAGG + Intergenic
1029205747 7:98868595-98868617 CATGGACTCCAGAAAGGGGAAGG + Intronic
1029274774 7:99397551-99397573 CAAGGTCTGTACTAGGGGCATGG + Intronic
1029484461 7:100830980-100831002 TTTGGTCTGCAGAACAGGCATGG - Intronic
1029528121 7:101107953-101107975 CATCTTCTGCAGAACAGGCACGG + Intergenic
1030112550 7:106039003-106039025 CTTGGTCTGCAGCGGGGGAATGG + Intergenic
1032388215 7:131538935-131538957 CATGGTCTGCTGCAGGGGAAGGG - Intronic
1032807749 7:135374154-135374176 GATGGGCAGCAGAAGGGGAAAGG - Intronic
1033131563 7:138749792-138749814 GAGGCTCTGCTGAAGGGGCAGGG - Intronic
1033150165 7:138907509-138907531 CATGGGCTGCAGCAGAGCCAAGG + Intronic
1036915175 8:12797573-12797595 CTTGGTCTGGGGAAGAGGCAGGG + Intergenic
1042125425 8:65533493-65533515 CATGGCCTGCAAAAGGAGGAAGG + Intergenic
1042912361 8:73840671-73840693 TTTGGTATGCAAAAGGGGCAGGG - Intronic
1043414673 8:80034393-80034415 CAGGCTCTGCAGAAGTGGCAGGG - Intronic
1043477522 8:80619735-80619757 CTTGGTCTCCAAAAGGGGCTGGG + Intergenic
1044035589 8:87299279-87299301 CATGGCCAGGAGAAGGGACAGGG - Intronic
1044938020 8:97311820-97311842 CAGTGTCTGCAGAAGGAGAAAGG - Intergenic
1045048382 8:98300858-98300880 CATGACCTGCTGATGGGGCAGGG + Intergenic
1045339231 8:101237257-101237279 CATAGACTGGAGAAGGGGTAAGG - Intergenic
1045540640 8:103081030-103081052 TGTGGCATGCAGAAGGGGCAGGG - Intergenic
1047167728 8:122459064-122459086 CACGGTCTGTAAAAAGGGCAGGG - Intergenic
1047206024 8:122803425-122803447 CCTGGTCTAGAGATGGGGCAGGG - Intronic
1048054745 8:130852743-130852765 CATGGGGTGCAGAAGGGTGAGGG - Intronic
1048092911 8:131260607-131260629 CAAGGGCTGCAAAAAGGGCAAGG - Intergenic
1048787364 8:138064181-138064203 CAGTGGCTGCAGAAGGGGCTGGG - Intergenic
1049455565 8:142684634-142684656 CATGGTGTGAGGGAGGGGCAGGG - Intergenic
1051471517 9:17448004-17448026 CATGGTTTGAAGAAAGGCCATGG + Intronic
1052102071 9:24460534-24460556 AAAGGACTGGAGAAGGGGCAGGG + Intergenic
1053196029 9:36119691-36119713 CATGGTCTCCAGAAGGAAAAGGG - Intronic
1053580504 9:39399254-39399276 CATGCCCTGCAAAAGGGACAAGG + Intergenic
1053691114 9:40588027-40588049 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1053845000 9:42227332-42227354 CATGCCCTGCAAAAGGGACAAGG + Intergenic
1054102091 9:60958059-60958081 CATGCCCTGCAAAAGGGACAAGG + Intergenic
1054273690 9:63049464-63049486 CAGGGTCAGGACAAGGGGCAGGG + Intergenic
1054302374 9:63388998-63389020 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1054434755 9:65199818-65199840 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1054495634 9:65821863-65821885 CAGGGTCAGGACAAGGGGCAGGG + Intergenic
1054584268 9:66948804-66948826 CATGCCCTGCAAAAGGGACAAGG - Intergenic
1057037103 9:91818924-91818946 CATGACCTGCAGAAGAGGGAGGG - Intronic
1057042884 9:91860073-91860095 CATGGTCTGAGGAAGGCACAGGG + Intronic
1057420167 9:94905869-94905891 CAGGGAGTGCAGAAGGGGCTGGG + Intronic
1057521059 9:95760743-95760765 CATGGTCTGCTAATAGGGCAAGG + Intergenic
1058834828 9:108851770-108851792 CCTGGTCTGGAGAAGGGACAAGG + Intergenic
1060886688 9:127159499-127159521 CTCGGTCTGCAGAAGGGGGCAGG - Intronic
1060890698 9:127186435-127186457 CATGTCCCGCAGCAGGGGCAAGG - Intronic
1061392957 9:130327867-130327889 CCTGGTCTGCAGAGCAGGCATGG - Intronic
1061937513 9:133866362-133866384 CCTGCTCTGCAGAAGGCGTAGGG - Intronic
1061938859 9:133873441-133873463 CAGTGTCTTCAGCAGGGGCATGG - Intronic
1062050334 9:134443759-134443781 CTTGGCCTGCAGCAGGAGCAGGG + Intergenic
1203621767 Un_KI270749v1:134135-134157 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1187210248 X:17223165-17223187 CATGGTCAGAAGATGGGGAAGGG + Intergenic
1188338932 X:28975246-28975268 CAAGAGTTGCAGAAGGGGCAGGG - Intronic
1189464294 X:41266654-41266676 CTTGGACTGCAGAAGAGGCACGG + Intergenic
1193583667 X:83294601-83294623 CATGGTGAGTAGTAGGGGCATGG - Intergenic
1193935980 X:87622349-87622371 CATGATGTGCAGAATAGGCAAGG + Exonic
1194100100 X:89693631-89693653 TATTTTCTGCAGTAGGGGCAGGG + Intergenic
1194275412 X:91874971-91874993 CATGTTCTGGACAAGTGGCATGG - Intronic
1196505887 X:116441308-116441330 CATGGGCTGCAGAAATGGGAAGG + Intronic
1197562982 X:128047347-128047369 CTTGGTGGGCAGAAGAGGCAGGG + Intergenic
1197873076 X:131078475-131078497 CATGGTATACTGAAGGGGTAAGG + Intronic
1197873664 X:131083071-131083093 CCTGATCTGCAGCAGGGGGAGGG - Intronic
1199628549 X:149761151-149761173 CATGGCTGACAGAAGGGGCAGGG - Intergenic
1200034909 X:153320865-153320887 CATGGGCTGCAGCAGTGGGAGGG - Intergenic
1200089077 X:153625969-153625991 CATGGTCTGAAGGAGGTGGAAGG + Intergenic
1200453102 Y:3354990-3355012 TATTTTCTGCAGTAGGGGCAGGG + Intergenic
1200592657 Y:5096372-5096394 CATGTTCTGGACAAGTGGCATGG - Intronic
1202583724 Y:26404879-26404901 CCAGGGCAGCAGAAGGGGCAGGG + Intergenic
1202583824 Y:26405245-26405267 CAGGGTCAGGACAAGGGGCAGGG + Intergenic