ID: 1144862674

View in Genome Browser
Species Human (GRCh38)
Location 17:18315330-18315352
Sequence GCTCCTAGGACGCCACAACC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 59}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144862674_1144862679 -1 Left 1144862674 17:18315330-18315352 CCGGGTTGTGGCGTCCTAGGAGC 0: 1
1: 0
2: 1
3: 2
4: 59
Right 1144862679 17:18315352-18315374 CCGCGACGGTTTCTGCCCTCGGG 0: 1
1: 0
2: 0
3: 2
4: 48
1144862674_1144862682 9 Left 1144862674 17:18315330-18315352 CCGGGTTGTGGCGTCCTAGGAGC 0: 1
1: 0
2: 1
3: 2
4: 59
Right 1144862682 17:18315362-18315384 TTCTGCCCTCGGGCAGTGAGGGG 0: 1
1: 0
2: 3
3: 26
4: 301
1144862674_1144862677 -2 Left 1144862674 17:18315330-18315352 CCGGGTTGTGGCGTCCTAGGAGC 0: 1
1: 0
2: 1
3: 2
4: 59
Right 1144862677 17:18315351-18315373 GCCGCGACGGTTTCTGCCCTCGG 0: 1
1: 0
2: 0
3: 4
4: 29
1144862674_1144862685 22 Left 1144862674 17:18315330-18315352 CCGGGTTGTGGCGTCCTAGGAGC 0: 1
1: 0
2: 1
3: 2
4: 59
Right 1144862685 17:18315375-18315397 CAGTGAGGGGCAGCAGCGCTTGG 0: 1
1: 0
2: 4
3: 30
4: 283
1144862674_1144862681 8 Left 1144862674 17:18315330-18315352 CCGGGTTGTGGCGTCCTAGGAGC 0: 1
1: 0
2: 1
3: 2
4: 59
Right 1144862681 17:18315361-18315383 TTTCTGCCCTCGGGCAGTGAGGG 0: 1
1: 0
2: 1
3: 18
4: 154
1144862674_1144862680 7 Left 1144862674 17:18315330-18315352 CCGGGTTGTGGCGTCCTAGGAGC 0: 1
1: 0
2: 1
3: 2
4: 59
Right 1144862680 17:18315360-18315382 GTTTCTGCCCTCGGGCAGTGAGG 0: 1
1: 0
2: 1
3: 15
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144862674 Original CRISPR GCTCCTAGGACGCCACAACC CGG (reversed) Exonic
908640277 1:66215463-66215485 GCTCCTATGACTCCACAAGAGGG + Intronic
908651944 1:66343409-66343431 GCTCCTAGGACGCCAAACTGTGG + Intronic
913960044 1:143332517-143332539 GCTCCTGGCAAGGCACAACCAGG - Intergenic
914054399 1:144158090-144158112 GCTCCTGGCAAGGCACAACCAGG - Intergenic
914124747 1:144808271-144808293 GCTCCTGGCAAGGCACAACCAGG + Intergenic
923459353 1:234195196-234195218 GCTCCTAGGTAGGCACAGCCTGG - Intronic
1063149065 10:3320528-3320550 GCTCCTTGGACCCCACAGTCTGG - Intergenic
1067028450 10:42864569-42864591 GCTCCTGGCAAGGCACAACCAGG - Intergenic
1070427964 10:76307758-76307780 GCTCCTGGGAGGCCACCACGTGG + Intronic
1078949705 11:16116719-16116741 GTTCCTAACAGGCCACAACCTGG - Intronic
1090403790 11:126465494-126465516 GCTCCTAGAACCCCACATTCTGG + Intronic
1091696282 12:2630405-2630427 CCTCCTAGGACCCAACCACCTGG + Intronic
1100459033 12:94780372-94780394 CCTCCCAGGACCCCACAACCTGG + Intergenic
1103945399 12:124523352-124523374 GCTCCTGGGAACCCACACCCCGG + Intronic
1104246816 12:127050992-127051014 GCTCCTAACAGGCCACAAACTGG - Intergenic
1110461632 13:75751570-75751592 GCTCCCAGAACGACACCACCTGG - Intronic
1115955788 14:38777573-38777595 GCTCCTAACAGGCCACAAACTGG + Intergenic
1118374721 14:65166921-65166943 GCTCCAAGAAAGCCACAGCCAGG + Intergenic
1119705729 14:76781541-76781563 CCTCCTAAGACTCCAGAACCAGG - Exonic
1121078121 14:91085928-91085950 GTTCCTAAGAGGCCACAAACTGG - Intronic
1122775621 14:104115864-104115886 GCCCCTCGGACTCCACACCCAGG + Intergenic
1130694751 15:86119768-86119790 GCTACTAGGACCCCACAACCAGG - Intergenic
1134045547 16:11098486-11098508 GCTCTTAGGAAGCCACAGCTGGG - Intronic
1134684461 16:16148936-16148958 GCTCCAAGGACACAAAAACCAGG - Exonic
1138022497 16:53497281-53497303 GCTTCTTGCACTCCACAACCAGG + Intronic
1144862674 17:18315330-18315352 GCTCCTAGGACGCCACAACCCGG - Exonic
1148547418 17:48528795-48528817 GCCCCCAGCAAGCCACAACCAGG - Exonic
1152644785 17:81463756-81463778 GCACCTACGACCCCACCACCGGG + Exonic
1165716101 19:38046715-38046737 GCTCCTCTGACCCCGCAACCCGG + Intronic
1202693878 1_KI270712v1_random:110768-110790 GCTCCTGGCAAGGCACAACCAGG - Intergenic
933952683 2:87343807-87343829 GCTCCTGGCAAGGCACAACCAGG + Intergenic
934236925 2:90240153-90240175 GCTCCTGGCAAGGCACAACCAGG + Intergenic
945030044 2:205654983-205655005 GCTGGTGGGACACCACAACCGGG + Intergenic
1169344711 20:4821231-4821253 GCTCCTAAGATGGCACAAACTGG + Intronic
1172668038 20:36614227-36614249 ACCCCTGGGAAGCCACAACCCGG - Intronic
1172869569 20:38127339-38127361 GTTCCTTGGACGCTACAACCTGG - Intronic
1176103910 20:63376855-63376877 GCTCTGAGGACACCTCAACCTGG + Intronic
1177832215 21:26151810-26151832 GCTCCTAACACGCCACAGACCGG + Intronic
1178370339 21:32021820-32021842 GCTCCTGGGCAGACACAACCGGG + Intronic
1180980769 22:19877039-19877061 GCTCCTCGGAGGCCAGACCCAGG - Exonic
1182526900 22:30926227-30926249 GCTGTTTGGACGCCACAGCCAGG + Intronic
1183301049 22:37059366-37059388 GCTCCTTGGACACCACACACAGG - Exonic
1184890377 22:47375475-47375497 GCTGCTAGGTAGCCACGACCCGG - Intergenic
961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG + Intronic
971212936 4:24637242-24637264 GCTCCTAACAGGCCACAGCCAGG - Intergenic
996355463 5:122591669-122591691 GCACCTAGGAAGCCAGAACTGGG - Intergenic
1008130235 6:47712939-47712961 GATCCTAAGAGGCCACAGCCCGG - Intronic
1010454093 6:76035117-76035139 GCCCCTAGCACTCCACAAACTGG - Intronic
1014235073 6:118944958-118944980 GCTCCAAGGAAGCCCCATCCAGG + Intergenic
1014313116 6:119830252-119830274 GCTCTCAGGAAGCCACATCCTGG - Intergenic
1019320368 7:412500-412522 GCTCATACCACGCCACAACATGG + Intergenic
1026904144 7:74053237-74053259 GCTCCTGGGACACCAACACCTGG - Exonic
1028838762 7:95403226-95403248 GCTCCTATTACTCCACATCCTGG - Intergenic
1034666559 7:152822854-152822876 GGTCCCAGCACGCCACAAGCCGG - Intronic
1035883229 8:3265893-3265915 TCTCCTTGGAGGCCACAAGCAGG + Intronic
1051344088 9:16136993-16137015 GCTCCTAGGGTGTCACAGCCAGG - Intergenic
1051893291 9:21965108-21965130 GCTCCGAGGTCGCCGCACCCGGG + Intronic
1187020234 X:15373864-15373886 GCTACTTGGACCCCAAAACCAGG - Intronic
1196645714 X:118116241-118116263 TCTTCTAGGACCCCAGAACCCGG - Intronic
1199079142 X:143557004-143557026 GCTCACAGGAAGCCACAGCCAGG + Intergenic
1199213759 X:145244167-145244189 GCTCACAGGAAGCCACAGCCAGG - Intergenic
1201439674 Y:13994177-13994199 GCTCGGAGGCCTCCACAACCAGG + Intergenic
1201444897 Y:14048531-14048553 GCTCGGAGGCCTCCACAACCAGG - Intergenic