ID: 1144862677

View in Genome Browser
Species Human (GRCh38)
Location 17:18315351-18315373
Sequence GCCGCGACGGTTTCTGCCCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 29}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144862671_1144862677 13 Left 1144862671 17:18315315-18315337 CCGCGGTAGCAGGATCCGGGTTG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1144862677 17:18315351-18315373 GCCGCGACGGTTTCTGCCCTCGG 0: 1
1: 0
2: 0
3: 4
4: 29
1144862674_1144862677 -2 Left 1144862674 17:18315330-18315352 CCGGGTTGTGGCGTCCTAGGAGC 0: 1
1: 0
2: 1
3: 2
4: 59
Right 1144862677 17:18315351-18315373 GCCGCGACGGTTTCTGCCCTCGG 0: 1
1: 0
2: 0
3: 4
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144862677 Original CRISPR GCCGCGACGGTTTCTGCCCT CGG Exonic
900102108 1:966356-966378 GCCGTGCAGGTCTCTGCCCTGGG - Intergenic
903954042 1:27012689-27012711 ACCCCCACGGTTTCTGCCGTCGG - Exonic
922496736 1:226063013-226063035 GCCGCGGCGGTTGCTGCTGTTGG - Intronic
1077253621 11:1571426-1571448 GACGCGACGGCCTCTGGCCTGGG - Intronic
1077473516 11:2775871-2775893 GCAGTGACAGTGTCTGCCCTCGG - Intronic
1096178396 12:49538081-49538103 GCCGCGCGGGGTGCTGCCCTGGG - Intergenic
1104089950 12:125507956-125507978 GCATCTACTGTTTCTGCCCTAGG - Intronic
1108484549 13:50910450-50910472 GCCCCGGAGGTTTCTGCCCTTGG + Intronic
1121836282 14:97095502-97095524 GACGTGACGTTCTCTGCCCTAGG + Intergenic
1142151831 16:88515989-88516011 GCCCCTACGGTCTTTGCCCTTGG - Intronic
1144625960 17:16844625-16844647 TCTGGGACAGTTTCTGCCCTGGG - Intergenic
1144862677 17:18315351-18315373 GCCGCGACGGTTTCTGCCCTCGG + Exonic
1144880474 17:18428095-18428117 TCTGGGACAGTTTCTGCCCTGGG + Intergenic
1145151761 17:20516292-20516314 TCTGGGACAGTTTCTGCCCTGGG - Intergenic
1147935976 17:44011381-44011403 GCCGGTACTGTTTCTGCCCCTGG + Exonic
1160396054 18:78572902-78572924 TCAGGGATGGTTTCTGCCCTAGG + Intergenic
930808922 2:55520233-55520255 GTCCCGAACGTTTCTGCCCTCGG + Intronic
1168819916 20:765770-765792 GCCATGGCGGTATCTGCCCTGGG + Exonic
1180209503 21:46286251-46286273 TCCGCGGCGTTTTCTGCCCGCGG - Exonic
1180835475 22:18927419-18927441 GCCATGAGGGTTTCTGCCCTGGG - Intronic
1181712067 22:24697029-24697051 GCCATGAGGGTTTCTGCCCTGGG - Intergenic
1203285563 22_KI270734v1_random:152718-152740 GCCATGAGGGTTTCTGCCCTGGG - Intergenic
960237463 3:115300391-115300413 AACGTGATGGTTTCTGCCCTTGG + Intergenic
964876438 3:161372819-161372841 GCCGAGACGCTTTCTGCTCGAGG + Exonic
987038259 5:14038858-14038880 GCCAGGAAGGTTTCTCCCCTGGG - Intergenic
996493715 5:124129162-124129184 GCAGGGAGGGTTTCTGGCCTTGG - Intergenic
1016728897 6:147406933-147406955 GCTGCGCCGGTGGCTGCCCTTGG - Intergenic
1022955339 7:35375145-35375167 TCCCCGGCGGTATCTGCCCTGGG - Intergenic
1034493794 7:151408635-151408657 GCCGCGAGGCTTTCTGCTGTGGG - Intronic
1035021122 7:155801061-155801083 GCCAAGAGGGTCTCTGCCCTTGG - Exonic
1055891006 9:81123118-81123140 GCAGCCACGGTTTCAGACCTGGG - Intergenic
1060671215 9:125471394-125471416 GCCGCGACTGTCCCTGCCCCTGG - Intronic
1062171169 9:135135686-135135708 GCCGCAGCGGGCTCTGCCCTGGG - Intergenic
1196856640 X:119991001-119991023 GCCTCCACGGATTCTGCGCTGGG - Intergenic