ID: 1144862679

View in Genome Browser
Species Human (GRCh38)
Location 17:18315352-18315374
Sequence CCGCGACGGTTTCTGCCCTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 48}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144862671_1144862679 14 Left 1144862671 17:18315315-18315337 CCGCGGTAGCAGGATCCGGGTTG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1144862679 17:18315352-18315374 CCGCGACGGTTTCTGCCCTCGGG 0: 1
1: 0
2: 0
3: 2
4: 48
1144862674_1144862679 -1 Left 1144862674 17:18315330-18315352 CCGGGTTGTGGCGTCCTAGGAGC 0: 1
1: 0
2: 1
3: 2
4: 59
Right 1144862679 17:18315352-18315374 CCGCGACGGTTTCTGCCCTCGGG 0: 1
1: 0
2: 0
3: 2
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144862679 Original CRISPR CCGCGACGGTTTCTGCCCTC GGG Exonic
903954040 1:27012688-27012710 CCCCCACGGTTTCTGCCGTCGGG - Exonic
916398243 1:164415470-164415492 ACGAGACATTTTCTGCCCTCAGG + Intergenic
921329290 1:214019583-214019605 CCACGACGGCTGCTGCCCTGAGG - Intronic
922083734 1:222325027-222325049 CCCCCAAGATTTCTGCCCTCTGG - Intergenic
1067556750 10:47278164-47278186 CCCCGCCGGTCTCTGCTCTCAGG + Intergenic
1068446617 10:57133338-57133360 CTGCCAAGGTTTCTACCCTCTGG + Intergenic
1073062041 10:100738980-100739002 GCGCGACGGATTAGGCCCTCGGG - Intronic
1077133995 11:989688-989710 CCACAAGGGTTTCTTCCCTCAGG - Intronic
1077473515 11:2775870-2775892 CAGTGACAGTGTCTGCCCTCGGG - Intronic
1078858594 11:15226735-15226757 CCCTGATGGTTTCAGCCCTCTGG + Intronic
1096512696 12:52140432-52140454 CAGCTATGGTCTCTGCCCTCGGG - Intergenic
1096981413 12:55729732-55729754 CCGCGTCGGGTCCCGCCCTCTGG + Intergenic
1102058668 12:109915629-109915651 CCGCGCCGGGGTCTGCTCTCCGG + Intronic
1106102995 13:26710300-26710322 CGGGGAGTGTTTCTGCCCTCAGG + Intergenic
1113590378 13:111494833-111494855 CCGCCACAGCTTCTGCTCTCAGG + Intergenic
1113959081 13:114115701-114115723 CTGCGGCTGTTTCTGACCTCTGG - Intronic
1133160054 16:3905098-3905120 CCCCTGGGGTTTCTGCCCTCAGG + Intergenic
1140955471 16:79860961-79860983 CAGAGACGGTGTCTGCCTTCAGG - Intergenic
1144625959 17:16844624-16844646 CTGGGACAGTTTCTGCCCTGGGG - Intergenic
1144862679 17:18315352-18315374 CCGCGACGGTTTCTGCCCTCGGG + Exonic
1144880475 17:18428096-18428118 CTGGGACAGTTTCTGCCCTGGGG + Intergenic
1145151760 17:20516291-20516313 CTGGGACAGTTTCTGCCCTGGGG - Intergenic
1151551101 17:74822936-74822958 CCACGAGGGTTTCTCGCCTCTGG + Intronic
1157550131 18:48575669-48575691 CCGGGAGGGTCTCTGCCCTCAGG + Intronic
1158648890 18:59269370-59269392 CCGCGACGCTGTCGCCCCTCGGG - Exonic
1160396055 18:78572903-78572925 CAGGGATGGTTTCTGCCCTAGGG + Intergenic
1160807404 19:998542-998564 CAGAGACTGTGTCTGCCCTCCGG - Intergenic
1161715949 19:5876501-5876523 CCGCGAGGATCTCTTCCCTCTGG + Intronic
944580573 2:201129155-201129177 CAGCAGAGGTTTCTGCCCTCAGG + Intronic
1170007772 20:11687273-11687295 CCGCGGGGGTATCTGCCATCAGG - Intergenic
1170658610 20:18315091-18315113 CCTCGATCCTTTCTGCCCTCCGG + Exonic
1175296592 20:57913077-57913099 CAGATACGGTTCCTGCCCTCAGG + Intergenic
1175806239 20:61830693-61830715 CTGCGATGGATTCTGGCCTCGGG - Intronic
1181177365 22:21045354-21045376 CCGGGGCTGTTGCTGCCCTCAGG - Intergenic
960237464 3:115300392-115300414 ACGTGATGGTTTCTGCCCTTGGG + Intergenic
964660764 3:159117758-159117780 TAGAGACAGTTTCTGCCCTCAGG + Intronic
971775955 4:30964636-30964658 CTGCTACTATTTCTGCCCTCAGG - Intronic
973696960 4:53499499-53499521 CAGCGAGAGTTTATGCCCTCAGG - Intronic
981061226 4:140427404-140427426 CCCCGACCGGTTCAGCCCTCTGG + Intronic
995224887 5:109690531-109690553 CCGCGAGGGCTCCTTCCCTCAGG + Exonic
1015132799 6:129832898-129832920 CTTTGACAGTTTCTGCCCTCAGG + Intronic
1017021224 6:150142338-150142360 CCGTCACGCTTTCTGCCCTTTGG + Intergenic
1022955337 7:35375144-35375166 CCCCGGCGGTATCTGCCCTGGGG - Intergenic
1025854883 7:65268046-65268068 CCTCGAGGGTACCTGCCCTCAGG + Intergenic
1026973916 7:74484835-74484857 CTGGGACGGTTTCTGCCTTTTGG + Intronic
1045550428 8:103166496-103166518 ACAAAACGGTTTCTGCCCTCAGG - Intronic
1051193150 9:14535309-14535331 CTGCGAAGGTTACTGTCCTCAGG - Intergenic
1054573085 9:66831264-66831286 CCCCGTCCGTGTCTGCCCTCCGG + Intergenic
1056621174 9:88216340-88216362 CTGTGAAGGTTTCTGCCTTCGGG - Intergenic
1057259939 9:93577477-93577499 CCGGGAGGGGTCCTGCCCTCGGG - Intronic
1062606548 9:137351147-137351169 CCACGATGGTTCCTGCCCACAGG - Exonic