ID: 1144862680

View in Genome Browser
Species Human (GRCh38)
Location 17:18315360-18315382
Sequence GTTTCTGCCCTCGGGCAGTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144862674_1144862680 7 Left 1144862674 17:18315330-18315352 CCGGGTTGTGGCGTCCTAGGAGC 0: 1
1: 0
2: 1
3: 2
4: 59
Right 1144862680 17:18315360-18315382 GTTTCTGCCCTCGGGCAGTGAGG 0: 1
1: 0
2: 1
3: 15
4: 162
1144862676_1144862680 -7 Left 1144862676 17:18315344-18315366 CCTAGGAGCCGCGACGGTTTCTG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1144862680 17:18315360-18315382 GTTTCTGCCCTCGGGCAGTGAGG 0: 1
1: 0
2: 1
3: 15
4: 162
1144862671_1144862680 22 Left 1144862671 17:18315315-18315337 CCGCGGTAGCAGGATCCGGGTTG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1144862680 17:18315360-18315382 GTTTCTGCCCTCGGGCAGTGAGG 0: 1
1: 0
2: 1
3: 15
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144862680 Original CRISPR GTTTCTGCCCTCGGGCAGTG AGG Exonic
902624968 1:17671255-17671277 CTTTCTGCGCTGGGGCAGTTAGG + Intronic
902653778 1:17853706-17853728 TTTTCTGCCCTCGGGCAGAAAGG - Intergenic
902721943 1:18309701-18309723 GCCTCTGCCCTCTGCCAGTGTGG + Intronic
904222474 1:28983839-28983861 GGTGCTGCCCTCTGCCAGTGAGG + Intronic
904770196 1:32876852-32876874 GTTCCTGCGCTGGGGCAATGTGG - Intergenic
905253949 1:36668013-36668035 GTTTCTCCCCTGGGGCAGAAAGG - Intergenic
905310103 1:37043146-37043168 CTCTCTTCCCTGGGGCAGTGAGG - Intergenic
905917936 1:41698821-41698843 GTTTCTGCCCTGGGCCTGTGGGG + Intronic
905928020 1:41765840-41765862 GTCCCTGCCCTCAGGCAGTAGGG + Intronic
906518804 1:46455512-46455534 GGATCTCCCCTCTGGCAGTGGGG + Intergenic
906725188 1:48039401-48039423 GTGTCAGCCCTTGGGCAGGGTGG + Intergenic
907924587 1:58943891-58943913 GCTTCTGCCCTTGGGCAGAGTGG - Intergenic
909055036 1:70810798-70810820 GTTTCTGCCCTTGACCTGTGGGG - Intergenic
909398665 1:75199708-75199730 GTTTCTGCACTGGGGGAATGGGG - Intergenic
912470560 1:109904078-109904100 CTTTGTGACCTGGGGCAGTGTGG - Intergenic
915142318 1:153775312-153775334 GTTTCTGCTCTCCGCCCGTGTGG + Exonic
915624591 1:157106902-157106924 GGTCCTGCCCAAGGGCAGTGGGG - Intergenic
918194122 1:182206064-182206086 CTTTCTGCCCTCTGGATGTGAGG - Intergenic
920813935 1:209313392-209313414 CTTTCTGCCCTCCAGCAGTGAGG - Intergenic
922014496 1:221631403-221631425 GGTTCAGCCCTGGGGAAGTGTGG - Intergenic
922909592 1:229204543-229204565 GGTGCTGGCCTCGGGCAGAGCGG + Intergenic
924075123 1:240325687-240325709 GTTTCAGCTCTCGTGCAGTAAGG + Intronic
924282899 1:242455948-242455970 GTCTCTGCCCTGGGGCACAGTGG - Intronic
1063537660 10:6900850-6900872 GTGGCTGCCCTCTGCCAGTGAGG + Intergenic
1064034287 10:11902693-11902715 CTTTCTTCCCTTGAGCAGTGGGG + Intergenic
1068777166 10:60880327-60880349 GCTTATGCACTCTGGCAGTGTGG + Intronic
1070640557 10:78165913-78165935 TTTCCTGCTCTCAGGCAGTGGGG + Intergenic
1074111194 10:110423814-110423836 GTTTCTGGACACGGGCAGTCGGG - Intergenic
1074291070 10:112138373-112138395 GTTCCTGCCCTCGAGGAGTTGGG + Intergenic
1076521175 10:131082334-131082356 GCTTCTGACCTCAGGCAGAGAGG - Intergenic
1077890545 11:6415087-6415109 CTTTTTGACCTCGAGCAGTGGGG - Intronic
1080701879 11:34650866-34650888 TTTTCTGCGATGGGGCAGTGGGG + Intronic
1080819722 11:35793754-35793776 GTTTTTGGCCCCGGGCAATGAGG - Intronic
1080873456 11:36256978-36257000 TTTTCTGCCCTGGGGCACAGAGG - Intergenic
1081022759 11:37968099-37968121 GTGGCTGCCCTCAGACAGTGAGG + Intergenic
1082944518 11:58743380-58743402 GTTCCTGCCCACATGCAGTGGGG + Intergenic
1086838224 11:91652788-91652810 GGTCCTGCCCTGGGCCAGTGGGG - Intergenic
1092057684 12:5521414-5521436 GTTTCTTCCCTCATGCAATGGGG - Intronic
1093592300 12:20917491-20917513 GTGGCTGCCCTCTGCCAGTGAGG + Intergenic
1096097885 12:48949140-48949162 GTTTCTGGCCTAGGGCTGGGTGG + Intronic
1096512694 12:52140424-52140446 GTCTCTGCCCTCGGGGAGAGAGG - Intergenic
1096873455 12:54609306-54609328 GTTTCTGGGCTGTGGCAGTGGGG + Intergenic
1096874192 12:54614498-54614520 GTTGCTGCCCTGGGGCAGTGGGG + Intergenic
1097899240 12:64856998-64857020 GGACCTGCCCTGGGGCAGTGGGG - Intronic
1100605742 12:96150636-96150658 GTTGCTGCCCCCGGGGAGTCTGG - Intergenic
1101609705 12:106279337-106279359 GTGGCTGCCCTCCGCCAGTGAGG + Intronic
1103356585 12:120325980-120326002 GCATCAGCCCTCGGGCCGTGTGG - Exonic
1104810310 12:131616583-131616605 GTTTCTGCCCCGCGTCAGTGTGG + Intergenic
1105595866 13:21837348-21837370 GTGTCTGCCCTGGAGCAGAGTGG - Intergenic
1107354886 13:39556497-39556519 GTTTATGCCCTAGGGATGTGTGG + Intronic
1111346575 13:86964229-86964251 GTTTATGCCCTAGGGAACTGTGG + Intergenic
1111373793 13:87352462-87352484 GCTACTGCCCTCTGGCAGGGAGG + Intergenic
1116084830 14:40221622-40221644 GCTTTTGCCCTTGGGCAGTAAGG - Intergenic
1116125956 14:40785249-40785271 GTGACTGCCCTCTGCCAGTGAGG + Intergenic
1117262124 14:54046495-54046517 TTTTCTGCTCTCTTGCAGTGAGG + Intergenic
1118420268 14:65594517-65594539 GTGGCTGCCCTCTGCCAGTGAGG + Intronic
1121553625 14:94820334-94820356 ATTTCTGCACTGGGGCAGAGAGG - Intergenic
1122892677 14:104740108-104740130 GTGTCTTCCCTGGGGCCGTGTGG - Intronic
1123424990 15:20163823-20163845 GCTTCAGCTCTCGTGCAGTGGGG + Intergenic
1123479483 15:20617773-20617795 GTTTCTGGCCTCAGTGAGTGAGG + Intergenic
1123534214 15:21170356-21170378 GCTTCAGCTCTCGTGCAGTGGGG + Intergenic
1123638524 15:22382591-22382613 GTTTCTGGCCTCAGTGAGTGAGG - Intergenic
1128311735 15:66635226-66635248 GGTTCAGCCCTCGGGCTGTAAGG + Intronic
1128559986 15:68658392-68658414 CTTCCTGCCTTCGGCCAGTGAGG + Intronic
1128705714 15:69836330-69836352 GCTGCTGGCCACGGGCAGTGAGG - Intergenic
1131982088 15:98004096-98004118 GTTTCTTCCCCAAGGCAGTGGGG - Intergenic
1132219789 15:100096775-100096797 GTCTCTGCCCCCAGGCAGTCAGG - Intronic
1132751140 16:1458256-1458278 GGTTCTGCCCTGGGGCAGGGAGG - Intronic
1134819123 16:17231349-17231371 CTTTCTCCCCACAGGCAGTGGGG + Intronic
1135503290 16:23015426-23015448 TTTTCTGCCCTCAGGCAGGTAGG - Intergenic
1135894143 16:26383222-26383244 GGTTCTGACCTGCGGCAGTGTGG - Intergenic
1136859867 16:33691922-33691944 GCTTCAGCTCTCGTGCAGTGGGG - Intergenic
1138405823 16:56793195-56793217 GTTTCAGCACCCTGGCAGTGAGG + Intronic
1203121372 16_KI270728v1_random:1540101-1540123 GCTTCAGCTCTCGTGCAGTGGGG - Intergenic
1144640509 17:16934144-16934166 CCTTCTGCCCTTGGGCAGTTAGG - Intronic
1144862680 17:18315360-18315382 GTTTCTGCCCTCGGGCAGTGAGG + Exonic
1145188256 17:20814849-20814871 GTTTCTGCCATTGGGCAGAATGG + Intergenic
1145752380 17:27364446-27364468 GTTGCTGGCCTGGGGCAGTCAGG + Intergenic
1146004418 17:29151864-29151886 ATTTCTGCCATGGAGCAGTGAGG + Intronic
1147632783 17:41942811-41942833 GGTTCAGCCCTCAGGCACTGAGG + Intronic
1151429306 17:74051684-74051706 GTCTCTGCCCTCAGCCTGTGGGG - Intergenic
1152930863 17:83109225-83109247 GTTTCCTCCCTTGTGCAGTGAGG - Intergenic
1153271329 18:3324928-3324950 GTTAGAGCCCTTGGGCAGTGTGG + Intergenic
1154384491 18:13880741-13880763 GTGGCTGCCCTCTGCCAGTGAGG - Intergenic
1155017838 18:21863290-21863312 GTAGCTGCCCTCCGCCAGTGAGG + Intronic
1156449545 18:37259248-37259270 GTTACAGCCCTCGGGCCCTGCGG + Exonic
1158691835 18:59667853-59667875 GTTTCTGTCTTCTGGTAGTGGGG - Intronic
1160348313 18:78152906-78152928 GTTTCTACTCTGCGGCAGTGAGG + Intergenic
1161126812 19:2562532-2562554 GTTTTTCCCCCCGGGCACTGTGG + Intronic
1162145548 19:8610801-8610823 GTTTCTGGCCGCGCGCAGTTTGG - Intergenic
1163663839 19:18594077-18594099 GATCCTGCCCTCGGGCAGACGGG - Exonic
1164923685 19:32109145-32109167 ATTTTTGCCCTTGGACAGTGAGG - Intergenic
1165838436 19:38773065-38773087 GCGGATGCCCTCGGGCAGTGAGG + Exonic
1165841123 19:38789632-38789654 GCGGATGCCCTCGGGCAGTGAGG - Exonic
927143561 2:20145743-20145765 TTTTCTGGCCTCGGGCTGGGTGG + Intergenic
927555277 2:24026659-24026681 GTTTCTGTCCCCGTGGAGTGGGG - Intronic
931177651 2:59869980-59870002 GGTTTGGCCCTGGGGCAGTGTGG + Intergenic
931198463 2:60074921-60074943 GTTCCTGCCATTGGGCAGGGTGG + Intergenic
933074614 2:77907423-77907445 GTGGCTGCCCTCTGCCAGTGAGG - Intergenic
934458226 2:94193030-94193052 GCTTCAGCTCTCGTGCAGTGGGG - Intergenic
934712415 2:96524800-96524822 TCTGCTGCCCTCGGGCAGTTAGG - Intergenic
940879580 2:158933344-158933366 GATTCTGCTCTGGGGCATTGTGG - Intergenic
943222828 2:185132706-185132728 GCCGCTGGCCTCGGGCAGTGAGG + Intergenic
943824317 2:192369878-192369900 GATTCTCCCCTAGGGGAGTGGGG + Intergenic
945656188 2:212627117-212627139 GTTTCTGCCCTCAGGGAGTTTGG + Intergenic
946907449 2:224430299-224430321 GTGGCTGCCCTCTGCCAGTGAGG - Intergenic
946908170 2:224435981-224436003 GGTTCTGCCCTGGGGGTGTGGGG - Intergenic
948281673 2:236751874-236751896 GTCTTTGCCCTGGGGCAGGGAGG + Intergenic
948897169 2:240932935-240932957 GTTTCTGCCCTCAGGGAGACAGG - Intronic
1171086461 20:22242573-22242595 CCTTCTGGCCTCTGGCAGTGGGG + Intergenic
1173823187 20:46031522-46031544 GTTGCTGACCTCGGGCAGGTGGG + Intronic
1174363882 20:50044597-50044619 CTTTCTCCCTTGGGGCAGTGGGG - Intergenic
1174743376 20:53038377-53038399 GTTTCTCCCCTGGGGAAGAGTGG + Intronic
1175478229 20:59292099-59292121 GTTTCTGCATTCGGAAAGTGGGG + Intergenic
1175690505 20:61062419-61062441 GCTTCTGCCCGCGGACTGTGGGG - Intergenic
1176072809 20:63235726-63235748 GTGTCTGCCCCAGGGCTGTGGGG - Intergenic
1176089713 20:63313436-63313458 GTTTGTGCACTCGGCCACTGGGG - Intronic
1177893305 21:26833133-26833155 GCTTCTGGCCTGGGGCAGTTTGG + Intergenic
1181306644 22:21920867-21920889 GGTTATGCCCACGGGCAGGGTGG + Exonic
1184508002 22:44915844-44915866 GATTGTGCACTTGGGCAGTGGGG + Intronic
1185332604 22:50258435-50258457 GGCTCTGCCCACTGGCAGTGTGG + Intronic
950868670 3:16210607-16210629 ATTTTTCCCCTAGGGCAGTGGGG + Intronic
951225561 3:20117002-20117024 GTTTCCTCCCTCAGGCAGTGGGG + Intronic
953018708 3:39100499-39100521 GTTTCTGGCCTTCGGCAGTCTGG - Exonic
953692811 3:45134093-45134115 GTTTCTCCCCTTGCTCAGTGGGG - Intronic
954141418 3:48608784-48608806 GATTATGACCTTGGGCAGTGAGG + Intronic
954711602 3:52507725-52507747 GTTTCTGCCCTGGGTCACAGGGG + Intronic
957270333 3:78022556-78022578 TTTTCTGCCACCCGGCAGTGTGG - Intergenic
960178222 3:114542717-114542739 GTTTTTCTCCTCTGGCAGTGAGG + Intronic
961594454 3:128006008-128006030 CTTTCTGCCCTCTGGCAGTAGGG + Intergenic
964349832 3:155791567-155791589 GGATCTGCCCTGGGCCAGTGGGG + Intronic
964727950 3:159834445-159834467 GTTTCTGCCCTCGAGAAGTTTGG - Intronic
964920519 3:161890595-161890617 GTGGCTGCCCTCTGCCAGTGAGG + Intergenic
968877518 4:3280798-3280820 GTGTCTGCCCTGGGGAAGTGAGG - Intergenic
969594670 4:8142300-8142322 GTCCATGCCCTCGGGCAGTGCGG - Intronic
970457568 4:16240093-16240115 CTTCCTGCCCTAGGGAAGTGGGG - Intergenic
971209140 4:24599369-24599391 GTCGCTGGCCCCGGGCAGTGAGG - Intergenic
974464699 4:62240109-62240131 GTTTCTGATCTCAGACAGTGGGG - Intergenic
976873445 4:89824222-89824244 GTTTCTGGTCTTGGGCTGTGTGG - Intronic
993987886 5:94618843-94618865 GTTTCTGCCTCCCGGCTGTGAGG + Intronic
994196739 5:96930521-96930543 GTTTCTGGCTTCTGGCTGTGGGG + Intronic
994346837 5:98697421-98697443 CCTTCTGCCCTCGGTCAGTTTGG + Intergenic
995600312 5:113789005-113789027 TTTTCTGTCCTCGGTCTGTGGGG - Intergenic
1003292277 6:4789512-4789534 GTTCCTGCCCACTGGGAGTGGGG - Intronic
1005835174 6:29703326-29703348 GCTTCTGATCTGGGGCAGTGGGG - Intergenic
1006239707 6:32666506-32666528 GTCTCTGCCCTCAGCCAGTAGGG + Exonic
1007106577 6:39287248-39287270 GTTTATGACCTGGGGCATTGTGG + Intergenic
1010203924 6:73306669-73306691 GTTGGTGCCCCGGGGCAGTGGGG + Intronic
1012616291 6:101283384-101283406 GCTTTTGCCCTCGGCCAGCGTGG - Intergenic
1014997803 6:128173303-128173325 GTTTCTGCCCTTGAGCAGGGAGG + Intronic
1015820660 6:137257210-137257232 GTTCCTGCCCTGCTGCAGTGTGG + Intergenic
1016949646 6:149566898-149566920 GTTTGTGTGCTCGGGAAGTGTGG + Intronic
1019618362 7:1977368-1977390 GTTGCCGGCCCCGGGCAGTGAGG - Intronic
1026575522 7:71568125-71568147 GTTTCTGGCCTTTGGCAGTGGGG + Intronic
1026734561 7:72941460-72941482 GTCTCTGCCCTTGAGCAGGGAGG - Intronic
1026784895 7:73296368-73296390 GTCTCTGCCCTTGAGCAGGGAGG - Intergenic
1026805227 7:73425151-73425173 GGATCTTCCCTCGGGCAATGAGG - Intergenic
1027109182 7:75423562-75423584 GTCTCTGCCCTTGAGCAGGGAGG + Intronic
1034359243 7:150479687-150479709 GTTTCTGCCTTCAGGCAGAAGGG - Intergenic
1035236490 7:157500807-157500829 GGTTCGGCCCTCTGCCAGTGCGG + Intergenic
1037417585 8:18667936-18667958 GCCGCTGGCCTCGGGCAGTGAGG - Intronic
1037581338 8:20247525-20247547 GGTACTGCCCTCAGGCAGGGAGG + Exonic
1047708430 8:127525618-127525640 TTTTCTGACCTAGGACAGTGGGG - Intergenic
1049672325 8:143875458-143875480 CTCTCTGCACTCGGCCAGTGAGG - Intronic
1049686860 8:143942537-143942559 GGTTCGGCCCACGGACAGTGCGG + Intronic
1049816533 8:144605691-144605713 GCTTCTCCCCTCTTGCAGTGCGG - Exonic
1050792852 9:9495808-9495830 GTGGCTGCCCTCTGCCAGTGAGG - Intronic
1052056672 9:23914667-23914689 CCTGCTGGCCTCGGGCAGTGAGG - Intergenic
1053688734 9:40568835-40568857 GCTTCAGCTCTCGTGCAGTGGGG - Intergenic
1054299974 9:63369746-63369768 GCTTCAGCTCTCGTGCAGTGGGG - Intergenic
1055717322 9:79132190-79132212 GTTACTGCCCTAGAGGAGTGAGG - Intergenic
1057194845 9:93111238-93111260 GCTCCTGTCCTCAGGCAGTGTGG + Intronic
1060926466 9:127458894-127458916 GTTTCTGCACTGGGGGTGTGAGG + Intronic
1060997952 9:127885686-127885708 TTTTCTGCCCTCTAGCAGGGAGG - Exonic
1061019196 9:128003084-128003106 CTATCTCCCCTCAGGCAGTGAGG + Intergenic
1062190452 9:135245357-135245379 CATTCGGGCCTCGGGCAGTGGGG - Intergenic
1190561769 X:51693498-51693520 GTTTCTGATCTCTGTCAGTGTGG + Intergenic
1197819169 X:130528927-130528949 GTCTCTGCCCTCTGGAAATGAGG + Intergenic
1198565053 X:137895776-137895798 GTTTCTGACCTCAGGCAGTCTGG - Intergenic