ID: 1144862681

View in Genome Browser
Species Human (GRCh38)
Location 17:18315361-18315383
Sequence TTTCTGCCCTCGGGCAGTGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144862671_1144862681 23 Left 1144862671 17:18315315-18315337 CCGCGGTAGCAGGATCCGGGTTG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1144862681 17:18315361-18315383 TTTCTGCCCTCGGGCAGTGAGGG 0: 1
1: 0
2: 1
3: 18
4: 154
1144862676_1144862681 -6 Left 1144862676 17:18315344-18315366 CCTAGGAGCCGCGACGGTTTCTG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1144862681 17:18315361-18315383 TTTCTGCCCTCGGGCAGTGAGGG 0: 1
1: 0
2: 1
3: 18
4: 154
1144862674_1144862681 8 Left 1144862674 17:18315330-18315352 CCGGGTTGTGGCGTCCTAGGAGC 0: 1
1: 0
2: 1
3: 2
4: 59
Right 1144862681 17:18315361-18315383 TTTCTGCCCTCGGGCAGTGAGGG 0: 1
1: 0
2: 1
3: 18
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144862681 Original CRISPR TTTCTGCCCTCGGGCAGTGA GGG Exonic
900115577 1:1026507-1026529 TTTCCACCCTCCTGCAGTGATGG - Intronic
900749319 1:4384526-4384548 TTTCTGCTCTAGGGTATTGAGGG - Intergenic
900947060 1:5837004-5837026 TTTCTGCCCTGGAGCTGGGAAGG - Intergenic
901330277 1:8402310-8402332 TTTCTGCCACCTGGCTGTGATGG - Intronic
902624969 1:17671256-17671278 TTTCTGCGCTGGGGCAGTTAGGG + Intronic
902653777 1:17853705-17853727 TTTCTGCCCTCGGGCAGAAAGGG - Intergenic
903552604 1:24168424-24168446 TTTCTGACCTCGGGCAGGGCCGG - Intronic
903670143 1:25030755-25030777 TTTCTGCTCTGGAACAGTGAGGG - Intergenic
905850650 1:41272126-41272148 TTTAGCCCCTCAGGCAGTGAGGG + Intergenic
907924586 1:58943890-58943912 CTTCTGCCCTTGGGCAGAGTGGG - Intergenic
908299917 1:62753539-62753561 CTGCTGGCCCCGGGCAGTGAAGG + Intergenic
910689830 1:89954571-89954593 TTTTCCCCCTTGGGCAGTGAGGG - Intergenic
917445414 1:175102553-175102575 CTGCTGGCCCCGGGCAGTGAGGG - Intronic
917446369 1:175108710-175108732 CTGCTGGCCCCGGGCAGTGAGGG - Intronic
918001667 1:180502717-180502739 TTTCTCTCCTCCGGCAGGGAAGG - Exonic
918659767 1:187074069-187074091 CTGCTGGCCCCGGGCAGTGAGGG - Intergenic
919782396 1:201229296-201229318 TTTCTGGTCCCGGGGAGTGACGG - Intergenic
922222224 1:223617435-223617457 TTCCTGCCCTTTGGTAGTGATGG - Intronic
1063537661 10:6900851-6900873 TGGCTGCCCTCTGCCAGTGAGGG + Intergenic
1069716321 10:70523518-70523540 GCTCTGCCCTTGGCCAGTGAGGG + Intronic
1070286565 10:75087845-75087867 TTTCTGCCCTGGGGTGGGGAGGG - Intergenic
1071387998 10:85141507-85141529 CTGCTGGCCCCGGGCAGTGAGGG + Intergenic
1073899043 10:108197883-108197905 TTTCTTCCCTGGGGCATTGATGG + Intergenic
1075629703 10:123993731-123993753 TCTCGCCCCTCCGGCAGTGAAGG - Intergenic
1075690856 10:124393194-124393216 CATCTGCCCTCTGCCAGTGAAGG + Intergenic
1077895116 11:6448358-6448380 TATCTGCCCTGGGGCTGGGAAGG - Intergenic
1079735664 11:23994126-23994148 TTGCTGCCCTCAGGCAGGGAAGG + Intergenic
1081022760 11:37968100-37968122 TGGCTGCCCTCAGACAGTGAGGG + Intergenic
1085515110 11:77107151-77107173 TTCCTGCCCTCCTGCAGTCATGG + Intronic
1089392259 11:118110184-118110206 TCTCTGTCCTGGGGCAGTGCTGG - Intronic
1089444976 11:118544761-118544783 TCTGTGCCCTCTGGCAGAGAGGG + Exonic
1090229215 11:125089604-125089626 CTTCCGGCCCCGGGCAGTGAGGG + Intronic
1090597314 11:128334205-128334227 TCTCTCCCCACGGCCAGTGAAGG + Intergenic
1091704616 12:2685473-2685495 GTTCTGACTTGGGGCAGTGAAGG - Intronic
1091711186 12:2741810-2741832 GTTCTGACTTGGGGCAGTGAAGG - Intergenic
1093123988 12:15306742-15306764 TTTGTGGCCTGGGGCAGTGGTGG - Intronic
1093443782 12:19230610-19230632 TTGCTGGCCCCAGGCAGTGAGGG - Intronic
1093592301 12:20917492-20917514 TGGCTGCCCTCTGCCAGTGAGGG + Intergenic
1094405302 12:30110488-30110510 CCTCAGCCCTTGGGCAGTGATGG + Intergenic
1096512693 12:52140423-52140445 TCTCTGCCCTCGGGGAGAGAGGG - Intergenic
1096699181 12:53371205-53371227 TTTCTCCCTGGGGGCAGTGAAGG + Intergenic
1099790705 12:87330323-87330345 CTGCTGGCCCCGGGCAGTGAGGG + Intergenic
1100584691 12:95969242-95969264 CTGCTGGCCCCGGGCAGTGAGGG + Intergenic
1101609706 12:106279338-106279360 TGGCTGCCCTCCGCCAGTGAGGG + Intronic
1103568830 12:121830832-121830854 ACTGTGCCCACGGGCAGTGAGGG - Exonic
1104373868 12:128247350-128247372 GCGCTGCCCTGGGGCAGTGAGGG + Intergenic
1104705836 12:130946740-130946762 TTTGTGCCCTTGCACAGTGATGG + Intergenic
1108048315 13:46404347-46404369 TTTCTGCCCTGGGGTGGTGATGG - Intronic
1111097941 13:83539012-83539034 TGTCTGCCCTCTGCCAGTGGAGG + Intergenic
1112185743 13:97126301-97126323 TTTCTGGCCTCAGGCGCTGAGGG + Intergenic
1114646279 14:24258326-24258348 GATCTGCCCTCGGGCTTTGATGG - Exonic
1115310499 14:31974151-31974173 GTCCTGCCCTCGGCCAGTGCTGG - Intergenic
1116125957 14:40785250-40785272 TGACTGCCCTCTGCCAGTGAGGG + Intergenic
1117262125 14:54046496-54046518 TTTCTGCTCTCTTGCAGTGAGGG + Intergenic
1118420269 14:65594518-65594540 TGGCTGCCCTCTGCCAGTGAGGG + Intronic
1119215957 14:72869177-72869199 TTTCTGGTCTAGGGCATTGAGGG - Intronic
1120493415 14:85204751-85204773 TGGCTGCCCTCTGCCAGTGAGGG - Intergenic
1121553624 14:94820333-94820355 TTTCTGCACTGGGGCAGAGAGGG - Intergenic
1122514526 14:102297793-102297815 CTGCTGGCCCCGGGCAGTGACGG + Intronic
1122994046 14:105253097-105253119 TATCTGCCATAGGGCAGTGGAGG + Intronic
1124049750 15:26186027-26186049 TTATTACCCTTGGGCAGTGATGG + Intergenic
1124554068 15:30709264-30709286 ATTCTGCCCTAGTGCAGGGAAGG + Intronic
1124677177 15:31696407-31696429 ATTCTGCCCTAGTGCAGGGAAGG - Intronic
1125480900 15:40079624-40079646 TCCCTGGCCTCAGGCAGTGATGG + Intergenic
1128389986 15:67176222-67176244 ATTCTGCACTGAGGCAGTGAGGG + Intronic
1128559987 15:68658393-68658415 TTCCTGCCTTCGGCCAGTGAGGG + Intronic
1131357724 15:91760131-91760153 TTTCTCCCCTAGAGCAGTGATGG + Intergenic
1132219788 15:100096774-100096796 TCTCTGCCCCCAGGCAGTCAGGG - Intronic
1134819124 16:17231350-17231372 TTTCTCCCCACAGGCAGTGGGGG + Intronic
1135299400 16:21313033-21313055 CTGCTGGCCCCGGGCAGTGAGGG - Intergenic
1135503289 16:23015425-23015447 TTTCTGCCCTCAGGCAGGTAGGG - Intergenic
1137272494 16:46911415-46911437 TTTCTGCACTCGGGAATTCAAGG - Intronic
1141617729 16:85219855-85219877 TTTCTGGCCTGGGCCAGGGAAGG + Intergenic
1143203757 17:5129458-5129480 CTTCTGCCCTTGGGCAGTTGTGG + Intronic
1144640345 17:16933383-16933405 CCTCTGCCCTCGGGCAGTTGTGG - Intronic
1144862681 17:18315361-18315383 TTTCTGCCCTCGGGCAGTGAGGG + Exonic
1144874939 17:18392569-18392591 CTTCTGCCCTTGGGCAGTTGTGG + Intergenic
1145157285 17:20551852-20551874 CTTCTGCCCTTGGGCAGTTGTGG - Intergenic
1148503384 17:48108402-48108424 TTTCTGCCATCTGGCACTAAAGG + Intronic
1149857509 17:60095826-60095848 TTTCTGCCCTCAGGCACATAAGG - Intergenic
1152008585 17:77697146-77697168 GTGCTGCCCCGGGGCAGTGAGGG + Intergenic
1154384490 18:13880740-13880762 TGGCTGCCCTCTGCCAGTGAGGG - Intergenic
1155017839 18:21863291-21863313 TAGCTGCCCTCCGCCAGTGAGGG + Intronic
1155611716 18:27674115-27674137 CTGCTGGCCCCGGGCAGTGAAGG - Intergenic
1156100855 18:33593277-33593299 TTTTTGGCCTAGGGCAGTGCTGG + Intronic
1158713882 18:59861256-59861278 TTTCTGGACTCTGGCAGAGACGG + Intergenic
1160576273 18:79855728-79855750 CCTCTGCCCTCGTGCTGTGACGG + Intergenic
1163737669 19:18991362-18991384 ATTCAGCGCTGGGGCAGTGAAGG - Intronic
1167019716 19:46863983-46864005 TTTCTGCCCTCTGGTATTGCAGG + Intergenic
927143562 2:20145744-20145766 TTTCTGGCCTCGGGCTGGGTGGG + Intergenic
927454967 2:23241450-23241472 TTTCTGTTCTTGGGCTGTGAAGG - Intergenic
927587798 2:24324299-24324321 TATATACCCCCGGGCAGTGATGG + Intronic
928296899 2:30091503-30091525 TTTTTGTCCTCAGGGAGTGATGG - Intergenic
930632331 2:53767586-53767608 TTTCTGCACACGGGCACTAAAGG + Intronic
932979062 2:76641125-76641147 ATTCTACCCACTGGCAGTGAGGG - Intergenic
933074613 2:77907422-77907444 TGGCTGCCCTCTGCCAGTGAGGG - Intergenic
934541242 2:95176728-95176750 ACTCTGCCCTCGGGCAGGAATGG - Intronic
934712414 2:96524799-96524821 CTGCTGCCCTCGGGCAGTTAGGG - Intergenic
939194950 2:138960361-138960383 TTACTGCCCTGGGGTATTGAAGG - Intergenic
939733174 2:145810571-145810593 GTACTGCACTTGGGCAGTGAGGG + Intergenic
940312889 2:152297253-152297275 TTCCTGCCCTCTGGTAGTTATGG - Intergenic
943222830 2:185132707-185132729 CCGCTGGCCTCGGGCAGTGAGGG + Intergenic
945019596 2:205557570-205557592 TGTGTGGCCTTGGGCAGTGATGG + Intronic
945451492 2:210000826-210000848 CTGCTGGCCCCGGGCAGTGAGGG - Intergenic
946907448 2:224430298-224430320 TGGCTGCCCTCTGCCAGTGAGGG - Intergenic
948281674 2:236751875-236751897 TCTTTGCCCTGGGGCAGGGAGGG + Intergenic
948897168 2:240932934-240932956 TTTCTGCCCTCAGGGAGACAGGG - Intronic
1170815218 20:19708282-19708304 TTTCTGCCCTCAGGGAGTTAAGG - Intronic
1180070621 21:45434286-45434308 TTTCTGCCCTCGGGGACAGGCGG + Intronic
1185122588 22:48981245-48981267 TTTCTGCACTAAGGCAGGGAAGG + Intergenic
950239821 3:11358682-11358704 TCTCTGCCCTGGGGAAGGGAAGG - Intronic
950468875 3:13172583-13172605 CATCTGCCCTCGGGAAGTGTTGG - Intergenic
951225562 3:20117003-20117025 TTTCCTCCCTCAGGCAGTGGGGG + Intronic
956584639 3:70851702-70851724 TTTTTACCCTCTGGCATTGAAGG + Intergenic
958101206 3:89013360-89013382 TTTCTGCCCTCAGTGAGTTATGG - Intergenic
961447619 3:126988249-126988271 TTCCTGGCCTCCGCCAGTGATGG + Intergenic
964920520 3:161890596-161890618 TGGCTGCCCTCTGCCAGTGAGGG + Intergenic
965812229 3:172603029-172603051 TTTTTGCCCTGGGTCAGTGATGG - Intergenic
966914053 3:184575298-184575320 TGTCTGCCCTTGGGCAGGGATGG - Intronic
967118627 3:186363245-186363267 TTTCTGCCAGTGGGCAGTGAAGG + Intergenic
967947880 3:194818513-194818535 CTTCTTCCCTCGGGCTCTGATGG + Intergenic
968469677 4:773674-773696 CTGCTGGCCCCGGGCAGTGAGGG + Intergenic
969594669 4:8142299-8142321 TCCATGCCCTCGGGCAGTGCGGG - Intronic
970272117 4:14358771-14358793 TTGCCGGCCCCGGGCAGTGAGGG + Intergenic
970457567 4:16240092-16240114 TTCCTGCCCTAGGGAAGTGGGGG - Intergenic
971209139 4:24599368-24599390 TCGCTGGCCCCGGGCAGTGAGGG - Intergenic
976520636 4:86021859-86021881 CTGCTGGCCCCGGGCAGTGAGGG - Intronic
977416656 4:96742627-96742649 TTGCTGGCCCTGGGCAGTGAGGG + Intergenic
980115213 4:128672771-128672793 CCGCTGCCCCCGGGCAGTGAGGG + Intergenic
980628588 4:135406727-135406749 CTGCTGGCCTCGGGCAATGAGGG + Intergenic
981167443 4:141578223-141578245 TTTCTGCCCTCAGACATTGATGG + Intergenic
985066413 4:186126562-186126584 CTTCTGCCCTCAGACATTGAAGG + Intronic
986348839 5:6858585-6858607 TTCCTGTCCTGGGGCAGTGCTGG + Intergenic
994094884 5:95839510-95839532 TTTCTGCCTTCCGGCAAAGACGG - Intergenic
994346838 5:98697422-98697444 CTTCTGCCCTCGGTCAGTTTGGG + Intergenic
999082527 5:148857623-148857645 TTTCTCCTCTCAGCCAGTGATGG + Intergenic
1001843624 5:174901874-174901896 TCTCAGCCCTTGGGCGGTGATGG - Intergenic
1004302899 6:14474742-14474764 TTTCTGTGCTGGGGCAGTCAAGG - Intergenic
1004524905 6:16398207-16398229 TTTCTGCCTTTGGGCAGGAAGGG - Intronic
1004916013 6:20332732-20332754 TCTCTGACCTCAGCCAGTGAGGG + Intergenic
1005759446 6:28954271-28954293 TTTCGGCCCTGGGGCAGGGGTGG - Intergenic
1007677557 6:43609696-43609718 TTTCTGCCCTGGGGCTCTTATGG - Intronic
1007947757 6:45841208-45841230 TTGCTGTCCTGGGGCAGTAATGG + Intergenic
1008308353 6:49933787-49933809 CTGCTGGCCCCGGGCAGTGAGGG + Intergenic
1019618361 7:1977367-1977389 TTGCCGGCCCCGGGCAGTGAGGG - Intronic
1022037491 7:26548390-26548412 TTTCTGACATCAGCCAGTGAAGG - Intergenic
1022049089 7:26647705-26647727 TTTCTGCACTCAGGCAAGGAAGG + Intergenic
1025049364 7:55721460-55721482 TCACTCCCCTGGGGCAGTGATGG - Intergenic
1026335890 7:69393936-69393958 CTGCTGGCCTCGGGCAATGAGGG + Intergenic
1026575523 7:71568126-71568148 TTTCTGGCCTTTGGCAGTGGGGG + Intronic
1026734560 7:72941459-72941481 TCTCTGCCCTTGAGCAGGGAGGG - Intronic
1026784894 7:73296367-73296389 TCTCTGCCCTTGAGCAGGGAGGG - Intergenic
1027109183 7:75423563-75423585 TCTCTGCCCTTGAGCAGGGAGGG + Intronic
1031236521 7:119185477-119185499 ATTCTCGCCTCGGGCAGTGCAGG - Intergenic
1037263851 8:17037069-17037091 CTGCTGGCCCCGGGCAGTGAGGG - Intronic
1037417583 8:18667935-18667957 CCGCTGGCCTCGGGCAGTGAGGG - Intronic
1037581339 8:20247526-20247548 GTACTGCCCTCAGGCAGGGAGGG + Exonic
1037929719 8:22871332-22871354 TTTCTGCCCATGGGCACTAAAGG + Intronic
1045009383 8:97944274-97944296 TCACTGGCCTCAGGCAGTGAGGG + Intronic
1047363439 8:124190696-124190718 TTTCTGCCCCCAAGCTGTGAGGG - Intergenic
1048008442 8:130437946-130437968 TTCCTGACTTAGGGCAGTGAAGG + Intronic
1049025032 8:139982456-139982478 TTTCTACCCCGGGGCAGTGTTGG - Intronic
1050792851 9:9495807-9495829 TGGCTGCCCTCTGCCAGTGAGGG - Intronic
1052056671 9:23914666-23914688 CTGCTGGCCTCGGGCAGTGAGGG - Intergenic
1056195055 9:84220751-84220773 GTTCTGCCCCCTGGGAGTGAAGG - Intergenic
1057294493 9:93827420-93827442 GGACTGCCCACGGGCAGTGAAGG + Intergenic
1058727588 9:107818158-107818180 CCTCAGCCCTTGGGCAGTGATGG - Intergenic
1058941854 9:109820865-109820887 TTTCTGTCCTGGGGCAGCCATGG + Intronic
1059294807 9:113260859-113260881 TTTTTCCCCTGGGTCAGTGATGG + Exonic
1186602294 X:11050620-11050642 TTTTTGCCCTGAGGCAGTGTAGG - Intergenic
1187469360 X:19554884-19554906 TTTCTGCTTTCTGACAGTGAAGG + Intronic
1188212322 X:27441043-27441065 TTTCTGCCATTTGACAGTGATGG - Intergenic
1192022456 X:67408769-67408791 CCACTGGCCTCGGGCAGTGAGGG + Intergenic
1201573021 Y:15433952-15433974 CTGCTGGCCCCGGGCAGTGAGGG + Intergenic