ID: 1144862682

View in Genome Browser
Species Human (GRCh38)
Location 17:18315362-18315384
Sequence TTCTGCCCTCGGGCAGTGAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 301}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144862676_1144862682 -5 Left 1144862676 17:18315344-18315366 CCTAGGAGCCGCGACGGTTTCTG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1144862682 17:18315362-18315384 TTCTGCCCTCGGGCAGTGAGGGG 0: 1
1: 0
2: 3
3: 26
4: 301
1144862671_1144862682 24 Left 1144862671 17:18315315-18315337 CCGCGGTAGCAGGATCCGGGTTG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1144862682 17:18315362-18315384 TTCTGCCCTCGGGCAGTGAGGGG 0: 1
1: 0
2: 3
3: 26
4: 301
1144862674_1144862682 9 Left 1144862674 17:18315330-18315352 CCGGGTTGTGGCGTCCTAGGAGC 0: 1
1: 0
2: 1
3: 2
4: 59
Right 1144862682 17:18315362-18315384 TTCTGCCCTCGGGCAGTGAGGGG 0: 1
1: 0
2: 3
3: 26
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144862682 Original CRISPR TTCTGCCCTCGGGCAGTGAG GGG Exonic
900749318 1:4384525-4384547 TTCTGCTCTAGGGTATTGAGGGG - Intergenic
901181341 1:7343940-7343962 TTCTGCCTTTGGGCATTCAGTGG + Intronic
902148096 1:14420508-14420530 CTCAGCCCTTGGGCAGTCAGTGG + Intergenic
903552603 1:24168423-24168445 TTCTGACCTCGGGCAGGGCCGGG - Intronic
907924585 1:58943889-58943911 TTCTGCCCTTGGGCAGAGTGGGG - Intergenic
908299918 1:62753540-62753562 TGCTGGCCCCGGGCAGTGAAGGG + Intergenic
909724791 1:78821478-78821500 TTCTTGCCTCAGGGAGTGAGAGG + Intergenic
909782292 1:79561777-79561799 TGCTGGCCCTGGGCAGTGAGGGG - Intergenic
911807965 1:102235062-102235084 CGCTGGCCCCGGGCAGTGAGGGG - Intergenic
912538761 1:110396585-110396607 TGCCGGCCCCGGGCAGTGAGGGG - Intergenic
913254322 1:116940189-116940211 TTCTGGCCTCTGGCATTGTGAGG - Intronic
913564586 1:120059521-120059543 CACTGCACTAGGGCAGTGAGAGG + Intronic
913633544 1:120734044-120734066 CACTGCACTAGGGCAGTGAGAGG - Intergenic
914285172 1:146218868-146218890 CACTGCACTAGGGCAGTGAGAGG + Intronic
914546203 1:148669607-148669629 CACTGCACTAGGGCAGTGAGAGG + Intronic
914620361 1:149401056-149401078 CACTGCACTAGGGCAGTGAGAGG - Intergenic
917093997 1:171381936-171381958 CGCTGGCCCCGGGCAGTGAGGGG - Intergenic
917445413 1:175102552-175102574 TGCTGGCCCCGGGCAGTGAGGGG - Intronic
917446368 1:175108709-175108731 TGCTGGCCCCGGGCAGTGAGGGG - Intronic
918002232 1:180508710-180508732 CACTGGCCCCGGGCAGTGAGCGG + Intergenic
918853219 1:189718550-189718572 TGCCGGCCCCGGGCAGTGAGGGG - Intergenic
919167957 1:193919164-193919186 TGCTGGCCCCGGGCAATGAGGGG - Intergenic
920756671 1:208739786-208739808 TGCTGGCCCCGGGCAATGAGGGG + Intergenic
921903845 1:220475921-220475943 TGCCGGCCCCGGGCAGTGAGGGG - Intergenic
922001604 1:221484193-221484215 TGCTGACCTGGGGTAGTGAGGGG - Intergenic
923573809 1:235140402-235140424 TGCCGGCCCCGGGCAGTGAGGGG + Intronic
923810528 1:237309878-237309900 TGCCGGCCCCGGGCAGTGAGGGG - Intronic
924034802 1:239925021-239925043 TGCTGGCCTTGGACAGTGAGGGG - Intergenic
1063245891 10:4218023-4218045 TTGTGCTCTCTGGCAATGAGCGG + Intergenic
1066694970 10:38069244-38069266 CTCTGTCATTGGGCAGTGAGTGG - Intergenic
1069716322 10:70523519-70523541 CTCTGCCCTTGGCCAGTGAGGGG + Intronic
1071055294 10:81502965-81502987 TGCTGGCCCCAGGCAGTGAGGGG + Intergenic
1071387999 10:85141508-85141530 TGCTGGCCCCGGGCAGTGAGGGG + Intergenic
1071797067 10:89018826-89018848 GCCGGCCCTGGGGCAGTGAGGGG - Intergenic
1072341857 10:94459749-94459771 CACTGGCCCCGGGCAGTGAGGGG - Intronic
1074146069 10:110718137-110718159 TTCTGTCCTTGGGAAGTCAGGGG - Intronic
1074753937 10:116610723-116610745 TGCTGCCCTCAGGCAGTGCTTGG + Intergenic
1075527343 10:123197730-123197752 TTCTGGACTTGGGCAGTCAGTGG + Intergenic
1075688396 10:124379424-124379446 ATCTGCACTCCTGCAGTGAGGGG - Intergenic
1075690857 10:124393195-124393217 ATCTGCCCTCTGCCAGTGAAGGG + Intergenic
1075933782 10:126322568-126322590 TCCAGCCCTGGGGCAGTGATAGG + Intronic
1076425122 10:130362313-130362335 TTCTGCCCTCTGTCAGTCACTGG + Intergenic
1076722821 10:132400194-132400216 CCCTGCCCTTGGGGAGTGAGAGG + Intronic
1076866528 10:133169003-133169025 CTCTGTCCCCGGGCAGGGAGTGG + Intronic
1077445729 11:2589789-2589811 GTCTGCCCTGGAGCAGTGTGGGG - Intronic
1079555419 11:21753350-21753372 TGCCGGCCCCGGGCAGTGAGGGG - Intergenic
1081324469 11:41728335-41728357 TGCTGGCCCCAGGCAGTGAGGGG - Intergenic
1081470375 11:43364712-43364734 TTATGCTGTAGGGCAGTGAGAGG + Intronic
1081793274 11:45804040-45804062 TTCTTCCAGCTGGCAGTGAGGGG - Intergenic
1083938695 11:65883559-65883581 TTCTGCACACGGGCAGTGAGCGG - Exonic
1085274455 11:75289440-75289462 CTCTGCCATCTGGCTGTGAGAGG + Intronic
1085325531 11:75603575-75603597 TTGGTCCCTGGGGCAGTGAGTGG + Intronic
1085375879 11:76060673-76060695 TGCTGGCCCCAGGCAGTGAGGGG + Intronic
1086001094 11:81986927-81986949 CACTGGCCCCGGGCAGTGAGGGG - Intergenic
1086077773 11:82872717-82872739 TTCTGGCCTCGGGAAGTGAGAGG + Intronic
1087021952 11:93611818-93611840 TTCTGCTCTCGCCCACTGAGAGG - Intergenic
1087354534 11:97076709-97076731 TGCTGGCCCCGGGCAATGAGGGG + Intergenic
1087407323 11:97745870-97745892 TGCCGGCCCCGGGCAGTGAGGGG - Intergenic
1090930838 11:131296831-131296853 TTCTCCCCTCAGGCTGTCAGAGG - Intergenic
1091861658 12:3790825-3790847 TTATTCCCTCTGGCAGTGAATGG + Intergenic
1092472956 12:8794832-8794854 TGCCGGCCCCGGGCAGTGAGGGG + Intergenic
1093187388 12:16036356-16036378 CTCTGCTCTCGGACATTGAGAGG + Exonic
1093443781 12:19230609-19230631 TGCTGGCCCCAGGCAGTGAGGGG - Intronic
1093970207 12:25369475-25369497 TGCTGGCCCCGGGCAATGAGGGG + Intergenic
1094338616 12:29386492-29386514 TGCCGGCCCCGGGCAGTGAGGGG - Intergenic
1094405303 12:30110489-30110511 CTCAGCCCTTGGGCAGTGATGGG + Intergenic
1096272570 12:50177862-50177884 TTCTACCCCTGGGCTGTGAGGGG + Exonic
1097612013 12:61835076-61835098 TTTTCCCCTCAGGCAATGAGTGG - Intronic
1100700254 12:97139725-97139747 TTCTGCTCTTGGGCAGGCAGAGG + Intergenic
1101986981 12:109454943-109454965 CTCTGCCCTTGGGTAGTAAGAGG - Intronic
1102428220 12:112861345-112861367 TCCCAACCTCGGGCAGTGAGAGG + Intronic
1102558264 12:113743143-113743165 TTCTGCACTTGGTCACTGAGAGG + Intergenic
1102835715 12:116057473-116057495 TTCTGCCATCAGTCAGTCAGAGG - Intronic
1103568829 12:121830831-121830853 CTGTGCCCACGGGCAGTGAGGGG - Exonic
1103668538 12:122592133-122592155 TGCCGGCCCCGGGCAGTGAGGGG + Intronic
1104373869 12:128247351-128247373 CGCTGCCCTGGGGCAGTGAGGGG + Intergenic
1108469465 13:50753559-50753581 TGCTGGCCCCGGGCAATGAGGGG - Intronic
1108520836 13:51245634-51245656 TTGTGCCCTTGAGTAGTGAGAGG + Intronic
1108856529 13:54799930-54799952 CACTGGCCTCAGGCAGTGAGGGG - Intergenic
1109007749 13:56900829-56900851 TGCTGGCCCCAGGCAGTGAGGGG + Intergenic
1110440264 13:75518905-75518927 TTCAGCCCTTGGGTAGTCAGTGG - Intergenic
1111220899 13:85205021-85205043 CGCTGGCCCCGGGCAGTGAGGGG + Intergenic
1113569674 13:111344970-111344992 TTCTGCTCACGGGCACTGACTGG + Intergenic
1113826800 13:113261686-113261708 CTCTGCTCTCGGGTAGAGAGTGG + Intronic
1113851116 13:113418804-113418826 GTCTGCCATCTGGGAGTGAGAGG + Intergenic
1114646278 14:24258325-24258347 ATCTGCCCTCGGGCTTTGATGGG - Exonic
1115284245 14:31700654-31700676 CACTGGCCCCGGGCAGTGAGGGG + Intronic
1115310498 14:31974150-31974172 TCCTGCCCTCGGCCAGTGCTGGG - Intergenic
1117627393 14:57653851-57653873 TTCTGGCCTCTGGAAGTGTGAGG - Intronic
1120214684 14:81668963-81668985 TGCCGGCCCCGGGCAGTGAGGGG - Intergenic
1120429757 14:84399616-84399638 TGCTGGCCCCGGGCAATGAGGGG - Intergenic
1122514527 14:102297794-102297816 TGCTGGCCCCGGGCAGTGACGGG + Intronic
1123424992 15:20163825-20163847 TTCAGCTCTCGTGCAGTGGGGGG + Intergenic
1123534216 15:21170358-21170380 TTCAGCTCTCGTGCAGTGGGGGG + Intergenic
1124108070 15:26759635-26759657 TGCTGCACTCGGCCAGTGTGGGG - Intronic
1127533464 15:59867524-59867546 TTCTGCCCCAGTCCAGTGAGAGG + Intergenic
1128004440 15:64225539-64225561 TTCTGCCCTAGGCCAATCAGAGG - Intronic
1128559988 15:68658394-68658416 TCCTGCCTTCGGCCAGTGAGGGG + Intronic
1129072416 15:72962271-72962293 TTCTTCCTTTGGGCAGGGAGGGG + Intergenic
1130548423 15:84873211-84873233 TCCTGCCAGAGGGCAGTGAGGGG + Exonic
1130863991 15:87916445-87916467 TTCTGTCCTCGGGAAAGGAGAGG - Intronic
1131846129 15:96492089-96492111 TGCCGGCCTCGGGCAATGAGGGG - Intergenic
1132150657 15:99455843-99455865 TTCTCCCCCAGGGCAGAGAGAGG + Intergenic
1132949112 16:2550699-2550721 GTCTGCCCTGGGTAAGTGAGAGG + Intronic
1132958775 16:2610892-2610914 TTCTTCCCACGGGCGGGGAGTGG - Intergenic
1132965476 16:2651429-2651451 GTCTGCCCTGGGTAAGTGAGAGG - Intergenic
1134420917 16:14088443-14088465 TTCTTCCCTCGGACAGGGAAAGG + Intronic
1134819125 16:17231351-17231373 TTCTCCCCACAGGCAGTGGGGGG + Intronic
1135503288 16:23015424-23015446 TTCTGCCCTCAGGCAGGTAGGGG - Intergenic
1135749311 16:25044269-25044291 TTCTGCCCTCCCACAGAGAGTGG + Intergenic
1135894141 16:26383220-26383242 TTCTGACCTGCGGCAGTGTGGGG - Intergenic
1136396110 16:29993425-29993447 ATCTGCTCCTGGGCAGTGAGAGG + Intronic
1136859865 16:33691920-33691942 TTCAGCTCTCGTGCAGTGGGGGG - Intergenic
1139603043 16:67998323-67998345 TGCTGGCCCCGGGCAATGAGGGG + Intronic
1140634338 16:76893593-76893615 TTCCACCCTCTGGGAGTGAGGGG - Intergenic
1142067885 16:88073111-88073133 CTCAGCCCTCGGGAAGAGAGGGG + Intronic
1203121370 16_KI270728v1_random:1540099-1540121 TTCAGCTCTCGTGCAGTGGGGGG - Intergenic
1143552738 17:7640989-7641011 TGCCGGCCCCGGGCAGTGAGGGG + Intergenic
1144862682 17:18315362-18315384 TTCTGCCCTCGGGCAGTGAGGGG + Exonic
1145241080 17:21241407-21241429 TGCTGCCCTGGGACAGTAAGGGG + Exonic
1147431812 17:40375943-40375965 TGCTGGCCCCGGGCAATGAGGGG + Intergenic
1147952028 17:44112690-44112712 TCCTGCCCTCAGGCTGGGAGTGG + Intronic
1149916378 17:60613723-60613745 TGCTGGCCGCAGGCAGTGAGGGG + Intronic
1150788260 17:68179957-68179979 TGCCGGCCCCGGGCAGTGAGGGG + Intergenic
1151969273 17:77449557-77449579 TTCTGCCCACGGGGAGGGAGAGG + Intronic
1152899186 17:82930177-82930199 TTCTGCACTCGGGAATTGCGGGG + Intronic
1154294121 18:13134934-13134956 GGCCGGCCTCGGGCAGTGAGGGG - Intergenic
1155038674 18:22046659-22046681 TTCTGTCTTCAGGGAGTGAGTGG - Intergenic
1155611715 18:27674114-27674136 TGCTGGCCCCGGGCAGTGAAGGG - Intergenic
1155864308 18:30945363-30945385 TTCTGCACTCTGGCTGTGAGAGG + Intergenic
1157856902 18:51112057-51112079 TGCTGGCCCTGGGCAGTGAGGGG - Intergenic
1157979808 18:52367155-52367177 TGCTGGCCCCGGGCAATGAGGGG - Intronic
1158597342 18:58827944-58827966 TGCCGGCCTCAGGCAGTGAGGGG - Intergenic
1162106989 19:8375869-8375891 TGCTGGCCCCGGGCAATGAGGGG + Intronic
1163398696 19:17078808-17078830 TTCTGCCAACCGGCAGTGCGAGG + Intronic
1163738095 19:18994137-18994159 ATCTGCCCTTGGCCAGTGTGAGG + Exonic
1165036384 19:33036747-33036769 CGCTGGCCCCGGGCAGTGAGGGG + Intronic
1166743504 19:45128860-45128882 TGCTGTCCTGGAGCAGTGAGGGG - Intronic
1168642439 19:58039110-58039132 GGCTGCCCTGGGGCAGTAAGGGG - Intronic
1168696610 19:58407479-58407501 TTCTACCCAAGGGCCGTGAGTGG - Intronic
928106359 2:28472780-28472802 CGCTGGCCCCGGGCAGTGAGGGG + Intronic
928617950 2:33057679-33057701 TGCCGGCCCCGGGCAGTGAGGGG - Intronic
930038006 2:47099841-47099863 TGCTGGCCCCGGGCAATGAGGGG + Intronic
932979061 2:76641124-76641146 TTCTACCCACTGGCAGTGAGGGG - Intergenic
933511466 2:83246177-83246199 CACTGGCCTTGGGCAGTGAGGGG - Intergenic
934712413 2:96524798-96524820 TGCTGCCCTCGGGCAGTTAGGGG - Intergenic
935454690 2:103253422-103253444 TTCTGCACATGGGAAGTGAGGGG - Intergenic
935488774 2:103691721-103691743 TTCTGGGCTCTGGCAGGGAGAGG + Intergenic
935654060 2:105406797-105406819 TTCTACCTGCGGCCAGTGAGGGG + Intronic
936142115 2:109949274-109949296 TTCTGACCTCGGGCACTCAATGG + Intergenic
936178805 2:110247234-110247256 TTCTGACCTCGGGCACTCAATGG + Intergenic
936202573 2:110422199-110422221 TTCTGACCTCGGGCACTCAATGG - Intronic
936865418 2:117071833-117071855 CGCTGGCCCCGGGCAGTGAGGGG - Intergenic
939733175 2:145810572-145810594 TACTGCACTTGGGCAGTGAGGGG + Intergenic
941290142 2:163664019-163664041 TTCTGTCTTTGGGCAGTTAGTGG + Intronic
941309241 2:163909631-163909653 TACCGGCCCCGGGCAGTGAGGGG + Intergenic
941878613 2:170459876-170459898 CGCTGGCCACGGGCAGTGAGGGG - Intronic
942170266 2:173282840-173282862 TGCCGGCCCCGGGCAGTGAGGGG - Intergenic
943222831 2:185132708-185132730 CGCTGGCCTCGGGCAGTGAGGGG + Intergenic
943835153 2:192508077-192508099 TGCTGGCCCCGGGCATTGAGGGG + Intergenic
944418762 2:199505930-199505952 ACCAGCCCTCGGGCAGTGAGAGG + Intergenic
945451491 2:210000825-210000847 TGCTGGCCCCGGGCAGTGAGGGG - Intergenic
946873811 2:224108441-224108463 TTCAGCCTTCAGGCAGTGGGGGG + Intergenic
947463986 2:230325456-230325478 TGCTGCCCAAGAGCAGTGAGAGG + Intergenic
947624546 2:231611616-231611638 AGCTGCCCTGGGGCAGAGAGAGG + Intergenic
948344857 2:237287162-237287184 TTATGCCCTGGGGGAGTGACAGG - Intergenic
948915655 2:241034029-241034051 TTCTGTTTTTGGGCAGTGAGAGG - Intronic
1170277576 20:14608948-14608970 TTCTGTCCAATGGCAGTGAGGGG + Intronic
1170434268 20:16309007-16309029 CTCTGCCCTCAGTCAGTCAGAGG - Intronic
1170815217 20:19708281-19708303 TTCTGCCCTCAGGGAGTTAAGGG - Intronic
1171013429 20:21521124-21521146 TTGGGCCCTCGGGCACAGAGAGG + Intergenic
1172113760 20:32562156-32562178 TTCTGCCTATGGCCAGTGAGTGG - Intronic
1172125704 20:32624025-32624047 TTCTGCCCTTGGCCTGTTAGGGG + Intergenic
1177565835 21:22819091-22819113 TGCTGGCCCCGGGCAATGAGGGG - Intergenic
1178277191 21:31249676-31249698 CTCTGCTCTGGGGGAGTGAGAGG - Intronic
1181442687 22:22944860-22944882 TTCTGCTCTGGGGCACAGAGGGG - Intergenic
1182479379 22:30596973-30596995 CGCTGGCCACGGGCAGTGAGGGG + Intronic
1184069340 22:42138391-42138413 CTCTGGCCCCAGGCAGTGAGGGG + Intergenic
1184413810 22:44340576-44340598 TTCTGTCCAGGGGAAGTGAGAGG + Intergenic
1185195467 22:49466651-49466673 GTCTTCCCTGGCGCAGTGAGGGG + Intronic
949292744 3:2485017-2485039 CACTGGCCCCGGGCAGTGAGTGG + Intronic
949504825 3:4717519-4717541 GTGTGCCCTCTGGGAGTGAGTGG + Intronic
950203591 3:11061482-11061504 GGCCGGCCTCGGGCAGTGAGGGG + Intergenic
950539783 3:13604747-13604769 TTCTGCTCTGAGGCACTGAGAGG - Intronic
951323211 3:21271873-21271895 CACTGGCCCCGGGCAGTGAGGGG - Intergenic
952005295 3:28836293-28836315 TTGTGCACTCTGGTAGTGAGTGG + Intergenic
952453688 3:33453558-33453580 TGCTGGCCCCAGGCAGTGAGGGG + Intergenic
952820122 3:37479437-37479459 TTTTGCCATTGGGCAGAGAGTGG + Intronic
955219656 3:57012974-57012996 TGCTGGCCCTGGGCAGTGAGGGG + Intronic
956563629 3:70611964-70611986 TGCCGGCCCCGGGCAGTGAGGGG + Intergenic
957009191 3:74985377-74985399 TGCTGGCCCCGGGCAATGAGGGG - Intergenic
957074081 3:75587907-75587929 TGCCGGCCCCGGGCAGTGAGGGG + Intergenic
957946035 3:87064097-87064119 TTGTGCCCTCTGGCATTCAGTGG - Intergenic
958022626 3:88015798-88015820 TGCTGGCCCCGGGCAATGAGGGG + Intergenic
959462447 3:106643879-106643901 TGCTGGCCCTGGGCAGTGAGGGG + Intergenic
961069165 3:123905365-123905387 TTCTGCCCCCCAGAAGTGAGAGG - Intronic
961630955 3:128297997-128298019 ATGTGCCCTCAGGCAGGGAGTGG + Intronic
962177251 3:133167643-133167665 CACTGGCCCCGGGCAGTGAGGGG - Intronic
962804285 3:138915866-138915888 TTCTCCCCGCGGGAGGTGAGGGG + Intergenic
963064489 3:141252788-141252810 TTCTACCCTAGGGTGGTGAGGGG - Intronic
965943494 3:174212223-174212245 TGCTGGCCCCGGACAGTGAGGGG - Intronic
966246078 3:177809149-177809171 CGCTGGCCCCGGGCAGTGAGGGG - Intergenic
966914052 3:184575297-184575319 GTCTGCCCTTGGGCAGGGATGGG - Intronic
968181605 3:196599288-196599310 TGCTGGCCCCGGGCAATGAGGGG - Intergenic
968469678 4:773675-773697 TGCTGGCCCCGGGCAGTGAGGGG + Intergenic
968487773 4:872212-872234 CTCTCCCCTCGTGCAGGGAGAGG - Intronic
968736121 4:2297373-2297395 CTCTGCCCTCTGCCAGTGTGAGG - Intronic
969125737 4:4946480-4946502 TTCTTCCCGAGGGCTGTGAGGGG - Intergenic
969515529 4:7646118-7646140 GTGTGCCCCCGGGCTGTGAGCGG + Intronic
970272118 4:14358772-14358794 TGCCGGCCCCGGGCAGTGAGGGG + Intergenic
970574585 4:17414538-17414560 CGCTGGCCCCGGGCAGTGAGGGG - Intergenic
970615765 4:17767058-17767080 TGCTGGCCCCAGGCAGTGAGGGG - Intronic
971209138 4:24599367-24599389 CGCTGGCCCCGGGCAGTGAGGGG - Intergenic
971367953 4:25992748-25992770 TTCTGGCCTCTGGAAGTGTGAGG - Intergenic
971709456 4:30092816-30092838 TGCCGGCCCCGGGCAGTGAGGGG + Intergenic
971853450 4:32013218-32013240 TTCTTTCCTTGAGCAGTGAGTGG - Intergenic
972505789 4:39718753-39718775 TGCTGGCCCTGGGCAGTGAGGGG - Intronic
974839349 4:67283071-67283093 CACTGGCCCCGGGCAGTGAGGGG - Intergenic
977416657 4:96742628-96742650 TGCTGGCCCTGGGCAGTGAGGGG + Intergenic
977606941 4:98993737-98993759 CGCCGGCCTCGGGCAGTGAGGGG - Intergenic
980115214 4:128672772-128672794 CGCTGCCCCCGGGCAGTGAGGGG + Intergenic
980680526 4:136154308-136154330 TTCTGTCCTTAGGCAGTGTGAGG + Intergenic
980961698 4:139481992-139482014 TGATGCGCTAGGGCAGTGAGTGG - Intergenic
980970134 4:139559858-139559880 TCCTGCCCGCTGGCAGGGAGTGG + Intronic
982728184 4:158927811-158927833 TGCTGGCCCCGGGCAATGAGGGG + Intronic
983425694 4:167581669-167581691 TGCCGGCCCCGGGCAGTGAGGGG + Intergenic
983553064 4:169036086-169036108 TGCCGGCCCCGGGCAGTGAGGGG - Intergenic
983734703 4:171043268-171043290 GGCTGGCCCCGGGCAGTGAGGGG + Intergenic
984805353 4:183746692-183746714 TGCCGGCCCCGGGCAGTGAGGGG - Intergenic
985066414 4:186126563-186126585 TTCTGCCCTCAGACATTGAAGGG + Intronic
985590880 5:764471-764493 TGCCGGCCCCGGGCAGTGAGGGG + Intronic
986912393 5:12574195-12574217 TGCTGGCCCCGGGCAATGAGGGG - Intergenic
988500125 5:31777212-31777234 CACTGGCCCCGGGCAGTGAGGGG + Intronic
991330231 5:65485682-65485704 CACTGGCCCCGGGCAGTGAGGGG - Intergenic
992048856 5:72925601-72925623 TGCTGGCCCTGGGCAGTGAGGGG + Intergenic
992050354 5:72935348-72935370 TGCCGGCCCCGGGCAGTGAGGGG + Intergenic
993031863 5:82714799-82714821 TGCCGGCCCCGGGCAGTGAGGGG + Intergenic
995588344 5:113672443-113672465 TTCTCCCCTACGGTAGTGAGCGG + Intergenic
996107040 5:119517214-119517236 TGCTGGCCCCGGGCAATGAGGGG + Intronic
996478703 5:123949438-123949460 TGCTGGTCCCGGGCAGTGAGGGG - Intergenic
996590633 5:125143242-125143264 TTCTGGCCTCCAGCAGTGTGAGG + Intergenic
997646510 5:135485736-135485758 TTCTGCTCTCAGGCAATGAGAGG + Intergenic
999348600 5:150845782-150845804 TTCAGCCCTTGGGCAGTGGATGG - Intergenic
1002308143 5:178296439-178296461 TTCTGACCTGGGGCAGAGAGAGG + Intronic
1003070217 6:2939740-2939762 TGCCGGCCTCGGGCAATGAGGGG + Intergenic
1004053157 6:12108640-12108662 TGCTGGCCCCGGGCAATGAGGGG - Intronic
1004170601 6:13292866-13292888 TTTTGCCCAAGGGCAGGGAGAGG - Intronic
1004477544 6:15987884-15987906 TTCTACCTTCTAGCAGTGAGAGG - Intergenic
1004519309 6:16346991-16347013 GCCGGCCCTAGGGCAGTGAGGGG + Intronic
1004861384 6:19807218-19807240 TGCCGGCCCCGGGCAGTGAGGGG - Intergenic
1006008297 6:31020830-31020852 TGCAGGCCCCGGGCAGTGAGGGG + Intronic
1006707880 6:36037696-36037718 TTCTGGCCAGGTGCAGTGAGTGG + Intronic
1006743623 6:36326205-36326227 TTCTGCACCCTGGCAGGGAGGGG - Intronic
1006986063 6:38176514-38176536 TTCAGCCGTGAGGCAGTGAGGGG - Intronic
1007970265 6:46045026-46045048 TGCTGACCTGGAGCAGTGAGTGG + Intronic
1008230819 6:48983642-48983664 CGCTGGCCCCGGGCAGTGAGGGG - Intergenic
1008308354 6:49933788-49933810 TGCTGGCCCCGGGCAGTGAGGGG + Intergenic
1009746674 6:67825510-67825532 TGCTAGCCCCGGGCAGTGAGGGG + Intergenic
1010199319 6:73269124-73269146 TGCTGGCCCCGGGCAATGAGGGG - Intronic
1010617378 6:78029913-78029935 TGCCGGCCCCGGGCAGTGAGGGG + Intergenic
1010652048 6:78467251-78467273 TTCTGCACTCAGGCTGGGAGTGG - Intergenic
1014240736 6:119015434-119015456 TGCGGGCCCCGGGCAGTGAGGGG + Intronic
1014329109 6:120037619-120037641 CTCTCCCCTCAGGCAGTCAGTGG + Intergenic
1014499276 6:122165332-122165354 TGCTGGCCCCAGGCAGTGAGGGG - Intergenic
1015572259 6:134633795-134633817 TGCCGGCCCCGGGCAGTGAGGGG - Intergenic
1016756512 6:147693447-147693469 TCCTGCCCTGGGGCAATAAGGGG + Intronic
1017839515 6:158210038-158210060 TGCTGGCCCCGGGCAATGAGGGG - Intergenic
1017913297 6:158813492-158813514 TTTTGCCATGTGGCAGTGAGAGG - Intronic
1018570519 6:165204956-165204978 TTCTGTCCTCAGGCTGTAAGAGG - Intergenic
1019618360 7:1977366-1977388 TGCCGGCCCCGGGCAGTGAGGGG - Intronic
1021513816 7:21461487-21461509 TGCTGGCCCCCGGCAGTGAGGGG - Intronic
1022400148 7:30028706-30028728 TTGGGGCCTGGGGCAGTGAGGGG + Exonic
1023115067 7:36854818-36854840 TTCTGGCCTGGGGCAGGGAGAGG + Exonic
1024443849 7:49453801-49453823 TGCCGGCCTCCGGCAGTGAGGGG + Intergenic
1024700643 7:51901145-51901167 TGCCGGCCCCGGGCAGTGAGGGG - Intergenic
1024794337 7:53004042-53004064 TGCCGGCCCCGGGCAGTGAGGGG + Intergenic
1026335891 7:69393937-69393959 TGCTGGCCTCGGGCAATGAGGGG + Intergenic
1027698293 7:81437339-81437361 TGCTGGCCCTGGGCAGTGAGGGG - Intergenic
1029809627 7:103034453-103034475 CACTGGCCCCGGGCAGTGAGGGG - Intronic
1030772233 7:113488395-113488417 CTCTGGCCCCAGGCAGTGAGGGG - Intergenic
1031031568 7:116741204-116741226 TTTATCCCTCGGGCAGGGAGGGG + Intronic
1031236520 7:119185476-119185498 TTCTCGCCTCGGGCAGTGCAGGG - Intergenic
1031902858 7:127429280-127429302 TGCTGGCCCTGGGCAGTGAGGGG + Intronic
1032098138 7:128949922-128949944 TTCTGCCTTCAGCCATTGAGTGG + Intronic
1034122849 7:148643200-148643222 TCCTGCCCTCAGACTGTGAGGGG - Intergenic
1034656049 7:152730526-152730548 TGCTGGCCCCGGGCAATGAGGGG - Intergenic
1035325408 7:158062681-158062703 TGCTGGCCCCAGGCAGTGAGGGG + Intronic
1035463909 7:159063390-159063412 TGCCGGCCCCGGGCAGTGAGGGG - Intronic
1036554655 8:9848006-9848028 CGCTGGCCCCGGGCAGTGAGGGG - Intergenic
1036928659 8:12931555-12931577 TGCCGGCCCCGGGCAGTGAGGGG - Intergenic
1037417582 8:18667934-18667956 CGCTGGCCTCGGGCAGTGAGGGG - Intronic
1039647435 8:39303270-39303292 ATCTGCCCTGAGGCAGTCAGGGG - Intergenic
1040014448 8:42689603-42689625 CACTGGCCCCGGGCAGTGAGGGG + Intergenic
1040954931 8:52970098-52970120 TGCCGCCCCCGGGCAATGAGGGG - Intergenic
1042184578 8:66123927-66123949 TTCTGCCCTCTATAAGTGAGTGG - Intergenic
1042512573 8:69626722-69626744 TTGCGGCCCCGGGCAGTGAGGGG - Intronic
1042948767 8:74179780-74179802 CGCTGGCCCCGGGCAGTGAGGGG - Intergenic
1043435315 8:80231918-80231940 TGCCGGCCCCGGGCAGTGAGGGG + Intergenic
1044853574 8:96452437-96452459 TGCAAGCCTCGGGCAGTGAGGGG + Intergenic
1044963910 8:97557024-97557046 TGCTGGCCGCGGGCAGTAAGGGG + Intergenic
1045009384 8:97944275-97944297 CACTGGCCTCAGGCAGTGAGGGG + Intronic
1045407395 8:101880249-101880271 TGCTGGCCCCGGGCAGTAAGGGG - Intronic
1045730914 8:105239740-105239762 TACTGCCCTCAGGCAGTCAAAGG + Intronic
1046149356 8:110202821-110202843 TGCCGGCCTCGGGCAATGAGGGG - Intergenic
1046251873 8:111642936-111642958 CGCTGGCCCCGGGCAGTGAGGGG + Intergenic
1047728798 8:127708770-127708792 TTCTGGCCATGGGCTGTGAGTGG - Intergenic
1048278554 8:133087427-133087449 TTCCTCCCTCGGGGTGTGAGGGG + Intronic
1049686862 8:143942539-143942561 TTCGGCCCACGGACAGTGCGGGG + Intronic
1053688732 9:40568833-40568855 TTCAGCTCTCGTGCAGTGGGGGG - Intergenic
1054299972 9:63369744-63369766 TTCAGCTCTCGTGCAGTGGGGGG - Intergenic
1055102572 9:72480452-72480474 CGCTGGCCCCGGGCAGTGAGGGG - Intergenic
1056195054 9:84220750-84220772 TTCTGCCCCCTGGGAGTGAAGGG - Intergenic
1057294494 9:93827421-93827443 GACTGCCCACGGGCAGTGAAGGG + Intergenic
1058287036 9:103191015-103191037 TTCTGCATTCCGGCAGGGAGTGG - Intergenic
1058727587 9:107818157-107818179 CTCAGCCCTTGGGCAGTGATGGG - Intergenic
1060011150 9:120043763-120043785 TTTTGCCCTCAGGCATTGTGAGG - Intergenic
1060208058 9:121694075-121694097 CTCTGCACTCAGGGAGTGAGCGG + Intronic
1061178522 9:129011072-129011094 TTCTGTCCTCTGGCAGAGAAAGG + Intronic
1061597391 9:131640751-131640773 TTCTTCCGTGGGGCAGGGAGTGG - Intronic
1061803718 9:133126968-133126990 TTCTGCCTGAGGGCAGTGGGGGG - Intronic
1185723700 X:2402471-2402493 GTCTGCCCTCTGCCTGTGAGTGG - Intronic
1186152606 X:6690758-6690780 TGCCGGCCCCGGGCAGTGAGGGG - Intergenic
1187005852 X:15231982-15232004 TGCTGGCCCCGGGCAATGAGGGG - Intergenic
1188112003 X:26204912-26204934 CACTGGCCCCGGGCAGTGAGGGG + Intergenic
1189021711 X:37348884-37348906 TTCAGCCCTGGTGAAGTGAGGGG - Intergenic
1192022457 X:67408770-67408792 CACTGGCCTCGGGCAGTGAGGGG + Intergenic
1193804054 X:85972609-85972631 TGCCGGCCCCGGGCAGTGAGGGG - Intronic
1194682553 X:96871511-96871533 TTCTGTCCTAGGACAGTGGGTGG + Intronic
1198503896 X:137281851-137281873 TTGTTCCCTGGAGCAGTGAGTGG + Intergenic
1199356260 X:146867134-146867156 TGCCGGCCCCGGGCAGTGAGGGG - Intergenic
1201573022 Y:15433953-15433975 TGCTGGCCCCGGGCAGTGAGGGG + Intergenic