ID: 1144862685

View in Genome Browser
Species Human (GRCh38)
Location 17:18315375-18315397
Sequence CAGTGAGGGGCAGCAGCGCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 283}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144862674_1144862685 22 Left 1144862674 17:18315330-18315352 CCGGGTTGTGGCGTCCTAGGAGC 0: 1
1: 0
2: 1
3: 2
4: 59
Right 1144862685 17:18315375-18315397 CAGTGAGGGGCAGCAGCGCTTGG 0: 1
1: 0
2: 4
3: 30
4: 283
1144862678_1144862685 0 Left 1144862678 17:18315352-18315374 CCGCGACGGTTTCTGCCCTCGGG 0: 1
1: 0
2: 1
3: 1
4: 44
Right 1144862685 17:18315375-18315397 CAGTGAGGGGCAGCAGCGCTTGG 0: 1
1: 0
2: 4
3: 30
4: 283
1144862676_1144862685 8 Left 1144862676 17:18315344-18315366 CCTAGGAGCCGCGACGGTTTCTG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1144862685 17:18315375-18315397 CAGTGAGGGGCAGCAGCGCTTGG 0: 1
1: 0
2: 4
3: 30
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144862685 Original CRISPR CAGTGAGGGGCAGCAGCGCT TGG Exonic
900590376 1:3456781-3456803 CCGTGAGTGGCAGCAGAGCCAGG + Intronic
901749681 1:11398054-11398076 CAGGAAGAGGCAGCAGCGCGGGG - Intergenic
901800631 1:11706188-11706210 GAGTGAGGGGCAGCAGAGAGAGG + Intronic
902652020 1:17843363-17843385 CAGGGAGGGGCAGCAGATGTGGG + Intergenic
902774897 1:18668351-18668373 CAGTGTGAGGCAGCAGTGCCTGG + Intronic
903020148 1:20387846-20387868 CAGTGAGTTGAAGCAGTGCTGGG - Intergenic
903314618 1:22492468-22492490 CAGAAAGGGGAAGCAGGGCTGGG - Intronic
903885815 1:26540456-26540478 CAGAGAGGGGCAGCCCAGCTGGG - Intronic
903944178 1:26951383-26951405 CTGTCAGGGGCAGCAGCGGTTGG + Exonic
905542004 1:38767257-38767279 CAAGGAGGGGCAGCAGGGATGGG + Intergenic
909033305 1:70567330-70567352 TAGTGAGGGGCAGCAGTGTTAGG - Intergenic
910065261 1:83143826-83143848 CAGTGAGGAGTAGCAGGGCCAGG + Intergenic
910757966 1:90711125-90711147 CAGCGAGGGTCCGAAGCGCTGGG - Intergenic
911054571 1:93699012-93699034 CAGGGAGGGGATGCAGCGCAGGG + Intronic
912581395 1:110724202-110724224 CAGGGAGGGGCAGCATCCTTTGG - Intergenic
913193620 1:116434057-116434079 CTGTCAGGGGCAGGAGCCCTGGG - Intergenic
913300994 1:117368192-117368214 CAGAGAGGGGCAGCAGGGCTGGG - Exonic
913384473 1:118244342-118244364 CTGTGAAGGGGAGCAGAGCTGGG - Intergenic
913506020 1:119516837-119516859 AGGTGAGGTGCAGCAGGGCTTGG - Intergenic
913513136 1:119580764-119580786 CTGTGAGGTGCATCAGGGCTTGG - Intergenic
914195636 1:145446689-145446711 CAGGAAGGGGCACCAGAGCTTGG + Intergenic
914685026 1:149970892-149970914 CAGTGAGGGACTGCAGCACCTGG + Intronic
915165558 1:153946197-153946219 CAGTGAGGGACAGCAGCTGGGGG + Intronic
915213510 1:154326157-154326179 CAGGAAGGGGCAGTAGCTCTGGG + Intronic
915302957 1:154961944-154961966 CACCGAGGGGCGGCAGCGCGCGG + Intronic
915904596 1:159868549-159868571 AAGTGAGGAGCAGAAGGGCTGGG - Intronic
919739207 1:200972329-200972351 CAGTGGGGGACTGCAGGGCTGGG + Intronic
919883857 1:201918520-201918542 CAGTGAGGAACAGCCACGCTGGG + Intronic
921355607 1:214281572-214281594 CAGCGCGGGGCCGCAGCGCGGGG - Intronic
922153374 1:223023145-223023167 TAGTGAGAGGCTGCAGGGCTGGG - Intergenic
922577961 1:226675566-226675588 CAGTGAGGGTCAGAAGACCTGGG + Intronic
1063093855 10:2891593-2891615 TTGTGAGGGGCAGCAGGCCTGGG - Intergenic
1066055236 10:31674398-31674420 GGGTGAGGGGAAGCAGGGCTAGG + Intergenic
1069069117 10:63975850-63975872 CAGTGGGGAGCAGCAGCTTTAGG + Intergenic
1069787101 10:70995889-70995911 CGGTGGGGAGCAGCAGGGCTGGG - Intergenic
1070047427 10:72852636-72852658 CAGAGAGGGGAAACAGAGCTTGG + Intronic
1070151946 10:73810966-73810988 CACTGAGGGCCAGCAGGGCTGGG + Intronic
1070628310 10:78066950-78066972 CAGTGAAGGGCAGTGGCTCTGGG + Intergenic
1070735593 10:78861725-78861747 AAGTGAGGGGCAGCAGCTGGTGG - Intergenic
1072555177 10:96509377-96509399 CAGTGAAGGGCAGCAGGCTTTGG + Intronic
1073381911 10:103084470-103084492 CAGAAAGTGGCAGCAGAGCTAGG + Exonic
1075090377 10:119441125-119441147 CAGAGAGGGGCGGCAGGCCTGGG - Intronic
1075338660 10:121627761-121627783 GAGTGAGGGGAAGGAGGGCTTGG - Intergenic
1076076392 10:127537205-127537227 CAGGAAGGGGAGGCAGCGCTGGG + Intergenic
1076456620 10:130604367-130604389 CAGTGAGGAGCAGCATCCCAGGG + Intergenic
1076586661 10:131553330-131553352 CAGTGTGGGGAAGCTGCGATGGG - Intergenic
1076795424 10:132795721-132795743 CAGGGAGGCGCAGCGTCGCTGGG - Intergenic
1077014017 11:392150-392172 CAGGGAGGCGCCGCAGCTCTGGG + Intergenic
1077017386 11:403068-403090 CGGCGAGGGGCAGCTGCGCAGGG - Exonic
1077052651 11:574746-574768 CACCGAGGGCCAGCGGCGCTGGG - Intergenic
1077111425 11:863827-863849 CATGGAGGAGCAGCAGGGCTGGG + Intronic
1077275860 11:1707511-1707533 GAGTGATGGGCAGCAGCTCCAGG - Intergenic
1077367720 11:2167845-2167867 CAGTGAGGGGCCCCTGCGCTCGG - Exonic
1077414961 11:2420599-2420621 CAGTCAGGGGCAGGGGCGGTGGG + Intronic
1077532482 11:3103714-3103736 CAGGAAGGGGCAGCAGAGCCTGG - Intronic
1077550227 11:3196938-3196960 CAGGGAGGGGCAGCTGAGCGCGG - Intergenic
1079098510 11:17526595-17526617 CGCTGTGGGGCAGCAGCCCTCGG - Intronic
1083627252 11:64078041-64078063 CAGGGAGGTACAGCAGCTCTGGG + Intronic
1084365145 11:68692898-68692920 CAGTGAGCAGCAGCAGCGGCAGG - Intergenic
1084412722 11:69013635-69013657 CAGTGGGGGGCAGCAGGGCGAGG + Intergenic
1085178252 11:74509466-74509488 AAGTGAGTGGCAGAAGCTCTTGG + Intronic
1088691809 11:112334796-112334818 CAGGGAGGGGAAGCTGAGCTGGG + Intergenic
1089256306 11:117196155-117196177 CAGTGCTGGGCAGCGGTGCTGGG - Exonic
1089262678 11:117233005-117233027 CAATGGGGGGAAGCGGCGCTGGG - Intronic
1089696225 11:120217963-120217985 CAGGGAGAGGCATCAGGGCTGGG + Intronic
1090083462 11:123630275-123630297 CAGTGAAGGTCAGCAGGGCAAGG + Exonic
1090384941 11:126352385-126352407 CAGAGAGGGGCCGCAGGGCCAGG + Intergenic
1090390820 11:126386178-126386200 GAGTGAGGGCCACCAGCCCTTGG - Intronic
1090409193 11:126495979-126496001 CAGCTAGGGGCTGGAGCGCTGGG - Intronic
1091829511 12:3539726-3539748 CAGTGATGGGCAGCAGCAGTGGG + Intronic
1095698352 12:45165380-45165402 CAGTGAGGAGAAGCAGGGTTAGG + Intergenic
1100945428 12:99777906-99777928 CAGTGAGAGGCAGCCGGGCACGG + Intronic
1101967047 12:109288657-109288679 CTGTGTGGAGCAGCAGGGCTTGG - Intronic
1103849575 12:123923459-123923481 CAGTGAGGGGCAGTACAGCAGGG - Intronic
1103904233 12:124319291-124319313 CCCTGTGGGGCAGCAGCTCTTGG + Intergenic
1103923265 12:124410497-124410519 CAGTCAGGGCCAGCTGGGCTGGG - Intronic
1104177579 12:126347916-126347938 CGGTGAGGGGCAGCACAGCTGGG + Intergenic
1104583193 12:130026065-130026087 CAGTGAGGGGAAGCAGTGAGAGG - Intergenic
1104748334 12:131223452-131223474 CGGTGAGAGGCAGCAGGGCTGGG + Intergenic
1104759202 12:131287027-131287049 CAGGGAGGGGCAGGAGAGATGGG - Intergenic
1104821409 12:131679469-131679491 CAGGGAGGGGCAGGAGAGATGGG + Intergenic
1104858020 12:131910846-131910868 CAGTCAGGGGCTCCAGCCCTGGG + Intronic
1105020780 12:132815361-132815383 GTGTCTGGGGCAGCAGCGCTGGG - Intronic
1105881034 13:24606871-24606893 CAGTGAGGAGCAGCAGGGCCAGG + Intergenic
1106849968 13:33779693-33779715 CAGTGAGGGGTAGAAGGGCCTGG + Intergenic
1107438405 13:40402596-40402618 CAGTGAGGGGCAGCTGCGGAGGG - Intergenic
1109438179 13:62334117-62334139 CAATGACTGGCCGCAGCGCTAGG + Intergenic
1110046677 13:70841354-70841376 CAGTGAAGGGCTGCTGCGCTGGG - Intergenic
1114727989 14:24959385-24959407 GAGTGAGGAGCAACAGCGATGGG + Intronic
1118235589 14:64001644-64001666 TAGTAAGAGGCAGCAGAGCTAGG - Intronic
1118614747 14:67567685-67567707 CAGAGGGGAGCAGCAGCCCTGGG - Intronic
1118785587 14:69043084-69043106 CTGGGAGGGGAAGCAGGGCTGGG + Intergenic
1119087618 14:71752186-71752208 CAGGGAGGGGCAGCGGGGCCAGG - Intergenic
1119557948 14:75567808-75567830 GAGTGAAGGGGAGCAGGGCTGGG + Intergenic
1119781378 14:77278607-77278629 CACTGTGGGGCAGCAGTGCTGGG - Intronic
1119781388 14:77278656-77278678 CACTGTTGGGCAGCAGTGCTGGG - Intronic
1121777948 14:96603129-96603151 CAGAGAGGGACAGCAGCTCCTGG - Intergenic
1121820024 14:96958725-96958747 CTTTGAGGGGCAGCAGCACGTGG - Intergenic
1122097068 14:99380070-99380092 CAGTGAGGGCCAGCATCAGTCGG + Intergenic
1122162357 14:99793542-99793564 CGGTGAGGGGCGGCCGCGCGGGG + Exonic
1122283822 14:100639303-100639325 GAGACAGGGGCAGCAGTGCTAGG + Intergenic
1122715337 14:103693613-103693635 CACTGAGAGCCAGCAGGGCTAGG + Intergenic
1122773996 14:104109166-104109188 GAGTGAGGTGCAGCGGGGCTGGG + Intronic
1124578620 15:30931259-30931281 CAGTGATGGGCAGCAGGGCTGGG - Intronic
1129186228 15:73908654-73908676 CAGTGAGTGGCTGCATAGCTGGG - Intergenic
1129189564 15:73929426-73929448 CAGTGAGGGGCTGCTGCTCATGG + Intronic
1129525798 15:76213463-76213485 CAGTGAGGGGCAGAAACACTGGG - Intronic
1130333995 15:82943266-82943288 CAGTGAGGGTGAGGAGGGCTGGG + Intronic
1131259300 15:90880301-90880323 CTGTGAGAGGCGGCGGCGCTGGG - Intronic
1131522455 15:93126777-93126799 CAGTGAGGGGCAGCAGGCTGGGG - Intergenic
1134538267 16:15044130-15044152 TAGGGAGGGGTAGCAGGGCTGGG - Intronic
1134903955 16:17963392-17963414 CATTGAGAGACAGCAGCGATGGG - Intergenic
1136537685 16:30910168-30910190 GAGTGAGGGGCAGGAGCGCCAGG - Intergenic
1139231972 16:65292081-65292103 CAGTAATGGGCACCAGCCCTGGG - Intergenic
1139471519 16:67180427-67180449 CAGGCTGGGGCTGCAGCGCTGGG + Exonic
1139959694 16:70710462-70710484 GGGTGAGGGACAGCAGTGCTGGG + Intronic
1140806283 16:78535263-78535285 CAGTGATGGGGACCAGAGCTAGG + Intronic
1140956502 16:79871217-79871239 CAGTGAGGTGCTTCAGCCCTTGG - Intergenic
1141519185 16:84566375-84566397 CACTGAGGGGCAGCTGGGCCAGG - Exonic
1142029861 16:87833127-87833149 CAGCGCTGGGCAGCGGCGCTGGG - Intronic
1143373773 17:6455674-6455696 CAGGGCAGGGCAGCAGCGCAGGG + Intronic
1143591813 17:7889525-7889547 CAGTGAAGGGAGGCAGGGCTTGG + Intronic
1143656306 17:8295659-8295681 CAGTGGGGGACTGCTGCGCTCGG - Intergenic
1143687263 17:8527802-8527824 CACCGAGGAGAAGCAGCGCTTGG - Intronic
1143732336 17:8888269-8888291 CAGGAAGGGGCGGCGGCGCTGGG + Exonic
1144627964 17:16854749-16854771 CACTGAGGGGCAGCTGGGCCAGG + Intergenic
1144862685 17:18315375-18315397 CAGTGAGGGGCAGCAGCGCTTGG + Exonic
1145159556 17:20565330-20565352 CACTGAGGGGCAGCTGGGCCAGG + Intergenic
1145718896 17:27049848-27049870 CAGTGAGGTGCAGCAGGGAGGGG - Intergenic
1145787803 17:27605390-27605412 CAGGGATGGGCAGCAGATCTGGG - Intronic
1147163258 17:38579774-38579796 GAGTGCGGGCCAGCAGGGCTGGG - Intronic
1147261782 17:39213170-39213192 CAGTGGTGGGCAGCAGGGGTGGG - Intronic
1147584033 17:41642701-41642723 CAGGGAGGGACAGCAAAGCTGGG + Intergenic
1148610413 17:48961065-48961087 CACTGAGGGGCAGCCGCGGATGG + Intronic
1152018705 17:77769182-77769204 CAGCCAGGGGCAGCAGGGCTGGG + Intergenic
1152119319 17:78408549-78408571 CAGGGACGCGCAGCAGCCCTCGG - Intronic
1152161090 17:78669206-78669228 GAGGGAGGGGCAGCAGAACTTGG - Intergenic
1153550464 18:6257189-6257211 CAGTGAGGGGAAGCAGTGGAGGG + Intronic
1153983586 18:10333303-10333325 TAGGAAGGGGCAGGAGCGCTTGG - Intergenic
1154125516 18:11689361-11689383 CAGTGAGGGGCTGTGGCCCTCGG + Exonic
1155172178 18:23275166-23275188 CAGGGAGGGGCAGCAGAGGGTGG + Intronic
1155997320 18:32343890-32343912 AGGTGTGGGGCAGCAGAGCTGGG - Intronic
1156561759 18:38133510-38133532 CAGGGAAGGACAGCAGAGCTGGG + Intergenic
1157118142 18:44881764-44881786 CAGTGAGGGGCGGGGGCACTGGG - Intronic
1160386391 18:78499582-78499604 CAGTGATGGGCAGCAGGGCCGGG - Intergenic
1161104962 19:2438740-2438762 AAGTGACAGGCACCAGCGCTTGG + Intronic
1161394455 19:4037829-4037851 CTGGAAGGGGCAGCGGCGCTTGG - Exonic
1162027229 19:7901209-7901231 CAGGGAGAGGCAGCAGTTCTAGG - Exonic
1162449719 19:10747517-10747539 CAGGGAGGGGCTGCTGGGCTGGG + Intronic
1162788066 19:13048159-13048181 CAGTGAGGGGCAGATGTGCAGGG - Intronic
1162810883 19:13163847-13163869 CAGGGAAGGGCAGCAGGGCTAGG - Intergenic
1163184515 19:15628589-15628611 CAGGGAGGGGCAGCACCTCAGGG - Exonic
1166043807 19:40217994-40218016 CAGCGAGGAGCAGCGGCGCCTGG - Exonic
1166590072 19:43989624-43989646 CAGGGAGGAGCAGCACCACTAGG - Intronic
1166976982 19:46610485-46610507 CAGTGAGGGGAAGCAGGGGGTGG - Exonic
1168510669 19:56971181-56971203 CACTCAGGGGCAGAACCGCTGGG - Intergenic
925029242 2:636634-636656 CAGTGCGGGGGAGCCGCGCCGGG + Intergenic
926061608 2:9808226-9808248 CAGTGAGGGGTGGCAGCACTAGG - Intergenic
926106558 2:10155786-10155808 CAGGGAGGGGACGCAGCTCTGGG - Intronic
926227441 2:10978490-10978512 CAGAGGTGGGCAGCAGCGATGGG - Intergenic
927148557 2:20182664-20182686 GAGCGAGGAGCAGCAGGGCTGGG + Intergenic
927937306 2:27083089-27083111 CAGTGAGGGGCAGCTGCGGCTGG + Exonic
929764199 2:44830808-44830830 CAATGAGGAACAGCAGAGCTAGG - Intergenic
929903382 2:46025205-46025227 GACTGAGGTGCAGCAGTGCTAGG + Intronic
931711164 2:64989766-64989788 CGGTGAGCAGCACCAGCGCTTGG - Exonic
931722579 2:65078115-65078137 CAGTGATGGGCAGCGACGCGTGG - Intronic
932009492 2:67960823-67960845 CAGTAAAGGGAAGCAGCACTAGG - Intergenic
932766238 2:74472278-74472300 CAGGGAGGGACCGCAGTGCTGGG + Intronic
933574786 2:84055143-84055165 CAGTGAGGAGCAGCAGGGTCAGG - Intergenic
934652018 2:96098207-96098229 CAGTGCAGGGCAGCAGAGCGGGG + Intergenic
936041626 2:109154395-109154417 CAGACAATGGCAGCAGCGCTGGG - Intronic
936260527 2:110956402-110956424 GAGTGCAGGGCAGCAGCGATAGG + Intronic
938790112 2:134669073-134669095 AAGTGAGGGGGAGCAGCCCCAGG - Intronic
938903736 2:135819829-135819851 CAGTCAGGGCCAGGAGGGCTGGG - Intronic
939267390 2:139891443-139891465 CAGGAAGTGGCAGCAGGGCTGGG + Intergenic
942414791 2:175747190-175747212 CAGAGAGAGGCAGCTGAGCTGGG + Intergenic
946184005 2:217966675-217966697 CAGTGAGCCTCAGCATCGCTTGG - Intronic
946688535 2:222294400-222294422 CAGTGCAGGGCAGCGGCTCTAGG - Intronic
947078536 2:226370040-226370062 CAGTGAGGGCCCCCAGAGCTAGG - Intergenic
947666811 2:231911098-231911120 CAGTGCAGGGCAGCATCCCTGGG + Intergenic
948621592 2:239238592-239238614 CAGTGGTGAGCAGCAGCGGTGGG + Intronic
948777356 2:240296685-240296707 CAGGGAGGGCCAGGAGGGCTGGG + Intergenic
948860434 2:240750213-240750235 CACTGCGGGGCAGCAGCCCGGGG + Intronic
1169059616 20:2652304-2652326 GAGTTACGGGCAGCAGAGCTGGG - Exonic
1169130761 20:3165418-3165440 TAGTGAGGGGCAACTGCTCTGGG + Intronic
1169701698 20:8454248-8454270 CAGTGATGGGAGGCAGTGCTGGG + Intronic
1169781325 20:9313928-9313950 GAGGAAGGGGCAGCAGGGCTGGG + Intronic
1171087490 20:22251182-22251204 CATTGAGGGGCAGAAGTGATTGG - Intergenic
1171387230 20:24778628-24778650 CAGGGCAGGGCACCAGCGCTGGG + Intergenic
1172662980 20:36580066-36580088 CAGTGGGGGCCAGCAGGGCAGGG - Intronic
1173202004 20:40961263-40961285 CAGTGAGGGGTAGCTGCCCTGGG - Intergenic
1173844475 20:46179198-46179220 AAGGGAGGGGCAGCAGCCTTCGG - Intronic
1175279831 20:57795537-57795559 CGGTGATGGGCAGCAGGGCTAGG + Intergenic
1176284377 21:5011754-5011776 CACTGAGAGGCAGCAGCAGTGGG - Intergenic
1179151051 21:38808420-38808442 CAGAGAGGGGCAGCAGTCTTGGG - Intronic
1179872804 21:44251721-44251743 CACTGAGAGGCAGCAGCAGTGGG + Intronic
1181054258 22:20252680-20252702 CAGGGAGGGGCAGCCACTCTGGG + Intronic
1181547404 22:23609913-23609935 CAGGGAGGGGAAGCAGGTCTTGG - Intronic
1181808638 22:25390463-25390485 CAGGGATGGGCAGCACAGCTTGG + Intronic
1181939057 22:26461493-26461515 GGGTGAGGGGCAGCAGGGGTTGG - Intronic
1182853989 22:33501266-33501288 CAGTGAGCGGCAGAGGGGCTGGG + Intronic
1183268953 22:36848940-36848962 CAGTGAGAGCCAGCAGCCCGGGG + Intergenic
1183639720 22:39085446-39085468 CAGGGAGGGGCTGTAGAGCTGGG - Intronic
1183658842 22:39206745-39206767 GAGTGAGCGGCAGGTGCGCTGGG + Intergenic
1184960493 22:47925064-47925086 CAGTGAAGGCCACCAGAGCTGGG - Intergenic
1185095776 22:48805173-48805195 CAGTGATGGCCGGCAGCGCCTGG + Intronic
1185112126 22:48905944-48905966 CAGGGATGGGCAGCAGCTCTGGG - Intergenic
1185389533 22:50551434-50551456 CAGGGAGGGGCTGCAGCTCTGGG + Intronic
950413624 3:12855479-12855501 AAGTGAGAGTCAGCAGCACTGGG - Intronic
950491083 3:13305469-13305491 CAGCTAGGGGCAGCACTGCTGGG + Intergenic
950632156 3:14289245-14289267 CTGTGAAGGGGAGCAGCTCTAGG + Intergenic
953554323 3:43931383-43931405 CAGAGAGGGGCAGCCAGGCTTGG - Intergenic
953622207 3:44543109-44543131 CAGTGAGGGGCAGGAGACCTGGG + Intergenic
954505212 3:51064111-51064133 CTGTGAGGGAAAGCAGCTCTGGG + Intronic
954617536 3:51977073-51977095 GAGTGAGGGGCTGCAGGGCCAGG - Intronic
954658846 3:52215581-52215603 CAGCGAGGGGCAGCAGACCCTGG - Intergenic
955216013 3:56985644-56985666 CTGAGAGGGGCAGCAGTGCACGG + Intronic
956587943 3:70884088-70884110 CAGTAAAGGTCAGCAGGGCTAGG - Intergenic
960970264 3:123134563-123134585 AAGTGAGTGGCAGGAGTGCTGGG - Intronic
961318518 3:126056792-126056814 CAGGGAGGGACAGCAGGGCCTGG - Intronic
961434367 3:126906448-126906470 CAGGGAGGGCCAGCAGGGTTGGG - Intronic
961792670 3:129387456-129387478 AAGTGAGAGTCAGCAGCACTGGG - Intergenic
962134969 3:132722813-132722835 CGGGGCGGGGCAGCAGGGCTAGG + Intergenic
962182584 3:133224246-133224268 CAGTCAGAGGCAGCAGCCTTAGG - Intronic
963141520 3:141949707-141949729 CAGTGTGTGCCAGCAGCCCTGGG + Intergenic
964987800 3:162766122-162766144 ATGTGAAGGGAAGCAGCGCTGGG - Intergenic
967092897 3:186150377-186150399 AAGTGAGGGGCGGAAGCACTGGG + Intronic
967727769 3:192878000-192878022 CACTGAGAGGCAGCAACGGTGGG + Intronic
968606043 4:1536224-1536246 TAGTGAGGGGCAGGAGAGCCCGG + Intergenic
968832713 4:2941400-2941422 CAGTGACGGTGAGCAGTGCTGGG - Intronic
969365069 4:6689603-6689625 CAGTGAGGGGCTGCAGGGTGAGG - Intergenic
969617608 4:8262674-8262696 AAGTGTGGGGCAGCAGCGGGTGG - Intergenic
974079010 4:57194144-57194166 CAGTGTGGGGCTCCAGCCCTTGG + Intergenic
975985482 4:80198004-80198026 CAGTGGCGGGCAGCAGCGACCGG + Intronic
976256989 4:83109759-83109781 CTGTGAGCGGCAGCTGCGCGCGG + Intronic
977050966 4:92128368-92128390 CTGTCAGTGGCAGCAGCCCTCGG - Intergenic
984047604 4:174820513-174820535 CAGACAGTGGCAACAGCGCTGGG + Intronic
986449356 5:7850426-7850448 CTGGGAGGGGCTGCACCGCTAGG - Intronic
987009871 5:13751700-13751722 CAGGGAGGGGCAGCTGCTCTAGG + Intronic
990599521 5:57343515-57343537 CAGTGAGGGGAGACAGAGCTGGG - Intergenic
990701674 5:58481437-58481459 CAGTGAGGGGCAGCATGTGTAGG + Intergenic
990701696 5:58481605-58481627 CAGTGAGGGGCAGCATGCATAGG + Intergenic
990701717 5:58481717-58481739 CAGTGAGGGGCAGCATGTGTAGG + Intergenic
990701822 5:58482515-58482537 CAGTGAGGGGCAGCTTAGGTAGG + Intergenic
991989506 5:72323584-72323606 CAGTGAGAGGAAGGAGAGCTGGG - Intronic
992016995 5:72585511-72585533 CAGTGAGGGGCATCTGGGTTGGG - Intergenic
996727696 5:126687076-126687098 CAGTGATGGGCTGCAGGGGTTGG - Intergenic
997356588 5:133266631-133266653 CAGTGAGAGACTGCAGAGCTAGG - Intronic
997791976 5:136769698-136769720 CATGGTGGGGCAGCAGAGCTAGG + Intergenic
999205218 5:149842767-149842789 TAGTGCGGGGCAGCAGCCCCTGG + Intronic
1000117306 5:158165851-158165873 CAGTGGGTGGCAGCAGTGATAGG + Intergenic
1000372548 5:160550822-160550844 CAGGGAGGGGAGCCAGCGCTAGG + Intergenic
1001591539 5:172868946-172868968 CAGTGATGTGCAGCAGGGCGTGG + Intronic
1001960322 5:175876473-175876495 CAGTAAGGGGAAGCAGGGATAGG + Intronic
1002193096 5:177489072-177489094 GAGGGAGGGGCAGACGCGCTGGG + Intronic
1002298919 5:178246756-178246778 CAGCGGGAGGCAGCAGAGCTGGG + Intronic
1002423727 5:179163943-179163965 CAGGGAGGGGAAGCTGCACTGGG + Intronic
1002704301 5:181149706-181149728 CAGTAACTGGCAGCAGGGCTGGG + Intergenic
1003018622 6:2490084-2490106 CAGTTAGGGGCAGTAGAGTTGGG - Intergenic
1005424323 6:25685255-25685277 CAGTGTGTCGCAGCAGCACTAGG + Intronic
1005958806 6:30682490-30682512 CAGTGTGTTGCAGCAGAGCTGGG + Intronic
1006561566 6:34917427-34917449 CACTGTGGGGCAGCGGAGCTTGG - Intronic
1006634324 6:35451560-35451582 CTGTGTGTGGCAGCAGAGCTGGG + Intergenic
1006983525 6:38163438-38163460 GTCTGAGGGGCAGCAGCGCTGGG - Intergenic
1007695917 6:43734262-43734284 CAGGGAGGGGCAGCAGGGAAGGG - Intergenic
1007762189 6:44139612-44139634 CAGTGAGGGCCAGGACGGCTAGG + Intronic
1008378957 6:50821508-50821530 CAGTGAGGGAGAACAGTGCTGGG - Intronic
1013188890 6:107785342-107785364 CAGTGGGGCGCAACAGCACTCGG - Intronic
1018740558 6:166725531-166725553 CAGTCAGGGGGAGCATCCCTGGG + Intronic
1019196037 6:170283679-170283701 CAGTGAGGTCCACCACCGCTGGG + Exonic
1019450158 7:1093480-1093502 CCACGAGGAGCAGCAGCGCTCGG + Exonic
1019450803 7:1096813-1096835 CAGTGAGAAGCGGCAGCGGTGGG + Intronic
1019712946 7:2525633-2525655 CCGTGAGGGGCAGCAGCGCCTGG + Intronic
1019928667 7:4209324-4209346 CAGCGAGGGGCACCAGGGCGAGG + Intronic
1023861940 7:44221745-44221767 CAGTGAGGACCAGCATGGCTGGG - Intronic
1025145207 7:56495819-56495841 CAGGGATGGGCAGGAGGGCTAGG + Intergenic
1025260816 7:57416315-57416337 CAGGGATGGGCAGAAGGGCTGGG + Intergenic
1026032626 7:66807545-66807567 CAGTGATGGCCTGCAGCTCTGGG + Intronic
1026924839 7:74183876-74183898 CACTAGGGGGCAGCAGGGCTGGG - Intronic
1027278846 7:76590921-76590943 CAGTGAGGAGTAGCAGGGCCAGG - Intergenic
1028150355 7:87365094-87365116 CAGTGAGGGGCAGGAGGGGCAGG + Intronic
1030227490 7:107169225-107169247 AAGGGAGGGGCAGGAGCGCGGGG + Intronic
1032844639 7:135742034-135742056 ATGTGAGGGGCAGCACTGCTGGG - Intronic
1034533309 7:151710880-151710902 CAGAGAGTGTCAGCAGTGCTGGG + Intronic
1036128303 8:6084078-6084100 CAGTGAGGGGCAGGAGCCTAAGG + Intergenic
1036487702 8:9194589-9194611 CAGTGAGGGAGAGCAGCCCCTGG - Intergenic
1037560120 8:20065976-20065998 CAGTCAGAGGCAGAAGCCCTTGG + Intergenic
1038410155 8:27352145-27352167 GAGTCAGGGACAGCAGCGCTTGG - Intronic
1038565834 8:28619487-28619509 CAGGGAGGAGCAGCAGGGGTGGG - Intronic
1039596999 8:38799133-38799155 CAGTGTGGGGGAGGAGAGCTGGG + Intronic
1040065724 8:43141946-43141968 TAGTGAGGGGAAGCCGCGTTGGG + Intronic
1040387197 8:46921568-46921590 CAGTGTGGGGCAGGAGGGCAGGG - Intergenic
1041841055 8:62271899-62271921 CGGTGAGGGGCAGGATTGCTGGG + Intronic
1045550533 8:103167722-103167744 GAGTGAGGGGAGGCAGTGCTGGG + Intronic
1046285893 8:112092484-112092506 CAGTGAGGAGCAGCAGGGGCAGG + Intergenic
1049411141 8:142474516-142474538 CAGAGAGGGGCAGCAGCACCAGG - Intronic
1049815101 8:144595570-144595592 AGGTGAGGGGCAGCTGGGCTGGG + Intronic
1057046389 9:91889499-91889521 CAGAGAGGGTCAGCAGCTCTAGG - Intronic
1057787134 9:98095765-98095787 CACTGAGGGACAGCAGTGGTGGG + Intronic
1058892545 9:109373340-109373362 CAGTGAGTGGTACCAGCTCTGGG + Intergenic
1060109450 9:120896026-120896048 TAGTGAGGAGCAGCAAAGCTTGG - Intergenic
1060154140 9:121307534-121307556 CAGTGCTGGGCGGCAGTGCTGGG - Intronic
1060542658 9:124441182-124441204 CACTGAGGGGTAGGAGCTCTGGG + Intergenic
1060915165 9:127384595-127384617 CACTGAGGGACACCAGGGCTGGG + Intronic
1061006532 9:127931215-127931237 CACTGTGGGCCAGCAGTGCTAGG + Intergenic
1061486305 9:130922227-130922249 CACTCAGTGGCAGCAGCCCTGGG + Intronic
1062227585 9:135462063-135462085 CAGTGAGGCGAGGCAGGGCTGGG - Intergenic
1062302842 9:135885146-135885168 AAGTGAGGGGCAGCTGGCCTAGG - Intronic
1062408160 9:136407696-136407718 CAGTGCTGGGGAGCAGCTCTGGG - Intronic
1062699030 9:137889661-137889683 CAGGAAGGGGCACCAGAGCTTGG - Intronic
1188980082 X:36719801-36719823 CAGTGAGGGGCTGGAGCACAGGG + Intergenic
1194407669 X:93517427-93517449 CAGTGTGAGGCAGCAACTCTGGG + Intergenic
1194675074 X:96784721-96784743 CAGTGAGGGGCATCAGGGCCTGG + Intronic
1195501737 X:105609735-105609757 GAGTGTGGGGCATCAGAGCTTGG - Intronic
1195577710 X:106468959-106468981 CAGTGAGGGGCAGCAGGGGTGGG - Intergenic
1198026775 X:132714800-132714822 CAGTGTGGGGCAGGGGCTCTGGG - Intronic
1200886571 Y:8278055-8278077 CAGGGTGGGGCAGCAGGGATGGG - Intergenic
1201903565 Y:19067089-19067111 GCGTGTGGGGCAGCAGCACTGGG - Intergenic