ID: 1144867662

View in Genome Browser
Species Human (GRCh38)
Location 17:18347271-18347293
Sequence GGCCACAGGGAAACCAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 1, 2: 1, 3: 35, 4: 286}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144867662_1144867669 19 Left 1144867662 17:18347271-18347293 CCCTCACTGGTTTCCCTGTGGCC 0: 1
1: 1
2: 1
3: 35
4: 286
Right 1144867669 17:18347313-18347335 CTCCATCCCAGCTGCCCCAGCGG 0: 1
1: 0
2: 8
3: 42
4: 410
1144867662_1144867670 20 Left 1144867662 17:18347271-18347293 CCCTCACTGGTTTCCCTGTGGCC 0: 1
1: 1
2: 1
3: 35
4: 286
Right 1144867670 17:18347314-18347336 TCCATCCCAGCTGCCCCAGCGGG 0: 1
1: 0
2: 1
3: 30
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144867662 Original CRISPR GGCCACAGGGAAACCAGTGA GGG (reversed) Intronic
900522652 1:3113150-3113172 GGCCACAGGGACTCCACGGAGGG + Intronic
900639404 1:3681600-3681622 GGCCACAGGGAAGCCTGGCAAGG - Intronic
900653787 1:3745070-3745092 GGACGCAGGGACACCAGTGAGGG - Intergenic
900716615 1:4149056-4149078 GGCAACAGGGAAACAGGGGAAGG - Intergenic
901805971 1:11738797-11738819 GGGCCCAGGGACACCAGTCAGGG - Intronic
902370911 1:16006238-16006260 GGCTAAGGGGAAACCCGTGAAGG + Exonic
903442886 1:23401634-23401656 GGACACAGGGAAACCAGTTTTGG - Intronic
903773195 1:25777118-25777140 GGGCACTTGGAAACCACTGAAGG + Intronic
904553863 1:31344535-31344557 GGAGGCAGGGAGACCAGTGAGGG + Intronic
905321754 1:37122492-37122514 GGGCAAAGGGAAGCCAATGAGGG + Intergenic
905570209 1:38997874-38997896 TGCCACAGGAAAACAAGTAAAGG + Intronic
905933101 1:41803520-41803542 GGCCACAGGAAAAGCAATGCTGG - Intronic
906247973 1:44290378-44290400 TGCCACAGGGACACCTGTGAGGG + Intronic
906992391 1:50753136-50753158 GGGCACATGGAAACCATTGAGGG - Intronic
910789020 1:91031331-91031353 GGGCAATGGGAAACCATTGAGGG + Intergenic
914193243 1:145428942-145428964 GGCCACATGGAAAGCAGTGGAGG + Intergenic
914454436 1:147822760-147822782 GGGAAGAGGGAAGCCAGTGATGG - Intergenic
915450807 1:156003642-156003664 TGCCCCAGGGAAAGCAGTGAAGG - Intronic
917751360 1:178056493-178056515 GGTCACTGGGGAACCACTGAAGG + Intergenic
918464013 1:184803578-184803600 GTCCACATGCAAACCAGTAAGGG - Exonic
918656631 1:187034819-187034841 TGTCACAGGGAAAACAGTAATGG + Intergenic
919486174 1:198150009-198150031 GTACCCAGGGCAACCAGTGAAGG + Intergenic
920246801 1:204593830-204593852 TGTGACAGGGAAGCCAGTGAGGG + Intergenic
920365641 1:205446952-205446974 GGGAAAAGGAAAACCAGTGATGG + Intronic
920380241 1:205530795-205530817 GTCCAAAGGGAAGCCAGTGGTGG - Intronic
921320208 1:213931288-213931310 GGACACAGGGAGACTAGGGAGGG - Intergenic
924631360 1:245743796-245743818 GGCCCCAGGGTATCCACTGATGG + Intergenic
924742418 1:246802815-246802837 GGCCACAAAGAAAGCAGTGTTGG + Intergenic
1063096510 10:2913355-2913377 GGCCACAGGGAAGGCAGAAAGGG + Intergenic
1063160038 10:3412456-3412478 GGCAGCAGGGAAGCCAGTTAGGG - Intergenic
1064438152 10:15329272-15329294 GGCTGCAGGGAAACCACTGTTGG + Intronic
1064920084 10:20506386-20506408 GGCAACTGCTAAACCAGTGATGG + Intergenic
1068758444 10:60681279-60681301 GGGCAGTGGGAAACCACTGAAGG - Intronic
1068800860 10:61138287-61138309 GGAGACAGGGAGACCAGAGAAGG + Intergenic
1068867753 10:61913130-61913152 GGCAAAAGGCAGACCAGTGAAGG + Intronic
1069784067 10:70976937-70976959 GGGCCCTGGGAAACCACTGAAGG + Intergenic
1070921769 10:80191719-80191741 GGCCACACGGAAGCCACTGAGGG - Intronic
1072219428 10:93315266-93315288 GGAAACAGGGAGACCAGTCAGGG + Intronic
1072568055 10:96634418-96634440 GGCCACTGAGCAACCAGTGCAGG + Intronic
1072716297 10:97755005-97755027 GGGCAAAGGGAAAACAGAGAGGG - Intronic
1072730689 10:97844266-97844288 GGACACAGGGCAAACAGAGAGGG - Intergenic
1073303012 10:102482339-102482361 GGCCTCCTGGAAACTAGTGAGGG + Intronic
1075264355 10:120988179-120988201 GGCCACAGGGAATGGAGTGTGGG - Intergenic
1075641992 10:124071310-124071332 GGCCACAAGGCCACCTGTGATGG - Intronic
1075738635 10:124679647-124679669 GGGCACAGGGAAAGTAGAGAGGG - Intronic
1075780784 10:125015944-125015966 GGCCACAGGCAACCCAGAGATGG + Intronic
1076228954 10:128803999-128804021 TGCCTCTGGGAAACCCGTGATGG - Intergenic
1076795063 10:132794313-132794335 GGCCACTGGGCACCCAGTGCCGG - Intergenic
1077095083 11:795790-795812 GGACACACAGAAGCCAGTGATGG + Intronic
1077363076 11:2149482-2149504 GGGCTCAGGGAAACGAGTGGAGG - Intronic
1078543309 11:12228733-12228755 GGCGACAGGGAAGCCAGCCAGGG + Intronic
1079087111 11:17454424-17454446 AGCCACAGGGAGACCACTGAGGG + Intronic
1079095780 11:17509433-17509455 GGACACAGGCAATCCAGTGGAGG - Exonic
1082001798 11:47397217-47397239 GGCCAGAGGGAGGCCAGGGAGGG - Intergenic
1082997088 11:59263162-59263184 TGCCACATGGCATCCAGTGATGG - Intergenic
1083657891 11:64238533-64238555 GGCCTCAGGGAGACAAGGGATGG - Exonic
1084901738 11:72315013-72315035 GGAGGCAGGGACACCAGTGAAGG + Intronic
1085119194 11:73956457-73956479 GACAATGGGGAAACCAGTGAAGG + Intronic
1086342786 11:85864053-85864075 GGTCACAGAGATAACAGTGATGG + Intronic
1087614491 11:100472211-100472233 GGCCACAGGGTCTCCAGTTAGGG + Intergenic
1088360153 11:108981035-108981057 AGCCACAGGGACACGAGTGAGGG - Intergenic
1088400292 11:109416182-109416204 GGCCACAAGCAAACCAGTGTGGG - Intergenic
1088803068 11:113324820-113324842 GGCCAGAAGGAAATCATTGATGG + Intronic
1089003277 11:115069556-115069578 GGCCTCAGGGAACCGCGTGAGGG - Intergenic
1093881836 12:24413449-24413471 GGCCACAGGTGAATCAGTGACGG + Intergenic
1094689734 12:32756830-32756852 GGCCTCAGGCAATCCAGTAAGGG + Intergenic
1095412180 12:41936386-41936408 GGCCCCAGGGAACACAGTGCTGG - Intergenic
1096262121 12:50099504-50099526 TGCTACAGGGCAACAAGTGAAGG - Exonic
1096652299 12:53067847-53067869 GGCTTCAGGGGAACCAGGGAGGG + Intronic
1098012671 12:66071339-66071361 GGCCGCAGGGAAAGTAGTGAGGG - Intergenic
1098531968 12:71551974-71551996 TGCCTCAGGGAAAACAGAGAAGG - Intronic
1102111822 12:110370969-110370991 TGCCACAGGTAAGCCAGTGTAGG + Intergenic
1103274072 12:119697136-119697158 GGGGGCAGGGAGACCAGTGAGGG - Intronic
1103513947 12:121494603-121494625 CACCACAGGGACCCCAGTGATGG + Exonic
1103891269 12:124240769-124240791 GGACACAGAGGATCCAGTGAAGG + Intronic
1103897174 12:124280273-124280295 GGCTGCTGGGAAACCACTGAGGG - Intronic
1104098420 12:125583087-125583109 GAACACAGGGAAACCAGTTGGGG + Intronic
1104348837 12:128027286-128027308 AGGCACAGGGAGTCCAGTGATGG + Intergenic
1104448660 12:128852964-128852986 GCTCCCATGGAAACCAGTGATGG - Intergenic
1104655573 12:130571828-130571850 GGCCACAGGGAGGCCAGTGTGGG - Intronic
1105045095 12:132996258-132996280 GGGGAAAGAGAAACCAGTGAAGG - Intronic
1107431532 13:40344955-40344977 GGCCACAGGGAGTGCAGTGGGGG + Intergenic
1109044515 13:57392156-57392178 AGCCACAGGGAGAGAAGTGAAGG - Intergenic
1109960246 13:69619886-69619908 GGCCAAAGGGAAATTAGAGAGGG - Intergenic
1110428805 13:75399674-75399696 GGCCAGAGGGCAGACAGTGATGG + Intronic
1111460728 13:88538436-88538458 AGCCACAGGGAAAAAAGAGAAGG + Intergenic
1111544582 13:89715067-89715089 AGCTACAGGGAAACAAATGATGG - Intergenic
1111611835 13:90615709-90615731 GGCCAGAGGGCAACCATAGAGGG + Intergenic
1112110891 13:96297454-96297476 CGCTACAGGGAAACCACTGCAGG - Intronic
1115765600 14:36619991-36620013 GGGCACAGAGAAACAAGTAAGGG - Intergenic
1116044071 14:39721494-39721516 GGGCACAGGGAAAGCAGTTCAGG + Intergenic
1116430082 14:44836114-44836136 GGGCAGAGGGAAGCTAGTGATGG - Intergenic
1116446818 14:45020965-45020987 GGCCTCATGGAGCCCAGTGAGGG + Intronic
1117257866 14:53998786-53998808 GGCCCCAGGGACACCAGCAATGG - Intergenic
1118470395 14:66069824-66069846 GGGAAAAGGGAAGCCAGTGAGGG + Intergenic
1118721243 14:68595346-68595368 GGCCAAAGGGAAATCAGTCAAGG + Exonic
1118818193 14:69327399-69327421 GGCCACAAGAATACCAGTGAGGG + Intronic
1119348173 14:73943409-73943431 GGGCACAGGGAAGCCACTGAGGG - Intronic
1120207170 14:81599383-81599405 GGCCACATGGAGAACAGTGAGGG + Intergenic
1120324011 14:83002799-83002821 GGCCACAGGGCAAGCAGGAAGGG - Intergenic
1122088005 14:99320454-99320476 GGACACAGGGATGCCAGTGTCGG + Intergenic
1126174938 15:45727526-45727548 GGCCACAGGTTTACCTGTGATGG - Intergenic
1126666006 15:51077123-51077145 GGCCCCAGGGAAACAGGGGAGGG - Intronic
1128314762 15:66653618-66653640 GGCCACAGGGAGGCCACTGATGG + Intronic
1128330436 15:66752090-66752112 CTCCTCAGGGAAACCATTGAGGG + Intronic
1128421183 15:67492767-67492789 GGCCACAGGAAGAGCAGTGCAGG + Intronic
1128616702 15:69115893-69115915 GGCCAGAAAGAAACGAGTGATGG - Intergenic
1132679341 16:1133349-1133371 GGCCACAGGGACAGCAGAGGTGG - Intergenic
1132714154 16:1282494-1282516 GACCACACCCAAACCAGTGACGG + Intergenic
1133591233 16:7246308-7246330 GGAGACAGGGAATCCAGGGAGGG - Intronic
1137360037 16:47805951-47805973 GGCCCAAGGCAAACCAGTGTCGG + Intergenic
1137952445 16:52796579-52796601 TGCCAAAGGGCAGCCAGTGAGGG - Intergenic
1138169379 16:54834542-54834564 AGCCACATGGAAAACAGTGTGGG + Intergenic
1138633634 16:58319399-58319421 GGAGGCAGGGAGACCAGTGAGGG - Intronic
1142146559 16:88495261-88495283 GGCCACAAGGAAACAGGTGCAGG + Intronic
1143462410 17:7112396-7112418 GGGCTGAGGGACACCAGTGAGGG - Intronic
1144097801 17:11917492-11917514 GGCAAGAAGGAAAACAGTGAGGG - Intronic
1144867662 17:18347271-18347293 GGCCACAGGGAAACCAGTGAGGG - Intronic
1146505336 17:33399830-33399852 GGCCACACTGAACCCAGAGACGG - Intronic
1147343145 17:39767381-39767403 GGTCACAGGGAAGGCAGGGATGG + Intronic
1147635458 17:41961257-41961279 GGCCAGAGGGAAACCAAGGGTGG + Intronic
1150331354 17:64296977-64296999 GGGCAATGGGAAGCCAGTGAAGG - Intergenic
1150364886 17:64573421-64573443 AGTCACAGTGAAACCAATGATGG + Intronic
1151398106 17:73838466-73838488 GGTCCCAGGGGAGCCAGTGAGGG - Intergenic
1151530700 17:74703007-74703029 GGCCACAGTGGAACCAGAGCTGG + Intronic
1151559828 17:74864279-74864301 GGCCACAGAGAAGCCAGGGCCGG - Exonic
1153091484 18:1350492-1350514 GGCCAGAGGCTTACCAGTGATGG - Intergenic
1153356036 18:4136359-4136381 GGGAAAAGGGAAACCAGTGCTGG - Intronic
1154165625 18:12012244-12012266 GGCCAGAGGGAGCCCAGGGAGGG - Intronic
1156404898 18:36774295-36774317 AGCCACAGCCAGACCAGTGATGG + Intronic
1157173469 18:45429520-45429542 GACAACAGGGAATCAAGTGATGG - Intronic
1157472780 18:48002909-48002931 GGCCCTAGGGAAACAAGAGAGGG - Intergenic
1158412655 18:57221684-57221706 GGGCAAAGGGAAACCAGAAAAGG + Intergenic
1159193005 18:65072735-65072757 AGCCACAGGGAAGTCAATGAAGG - Intergenic
1160782794 19:885240-885262 GGACACAGGGAACCAAGTCAGGG + Intronic
1161581963 19:5086014-5086036 GGCCAGAGGGACACCAGAAAAGG - Intronic
1161934147 19:7360905-7360927 GGCAACCTGGAAAGCAGTGATGG + Intronic
1163151687 19:15418794-15418816 GACCGCAGGGAAGGCAGTGACGG + Intronic
1163359577 19:16837302-16837324 GGCCCCTGGGAGACCAGGGAGGG + Intronic
1165101594 19:33441637-33441659 TGCCACAGAGAAAACAGTGTTGG + Intronic
1165367955 19:35381173-35381195 GGCCACAGGCAAGGCAGGGAGGG + Intergenic
1168146265 19:54421302-54421324 GGCAACAGTGAGACCAGTGATGG + Exonic
1168536840 19:57177893-57177915 AGCGACAGTGACACCAGTGAAGG + Intergenic
1168698218 19:58418124-58418146 GTCCACAGCTAAACCAGTCAAGG - Exonic
925027336 2:620335-620357 GGCCATAGCGAGACCAGCGAGGG + Intergenic
925246737 2:2390212-2390234 GGCCTCAGGAAACACAGTGATGG + Intergenic
926155762 2:10453182-10453204 GGACCCAGGGCCACCAGTGAAGG - Intergenic
926786222 2:16521079-16521101 GGCCACAGGGAATGGGGTGATGG + Intergenic
927641773 2:24849980-24850002 GGCCACAAGGAGAGCAGTGGGGG - Intronic
928754047 2:34502768-34502790 GGAGACAGGGAAACTAATGAAGG - Intergenic
929822505 2:45284578-45284600 GGCCACTGGGAAGTCATTGAAGG - Intergenic
930747093 2:54896073-54896095 GGCCAGAGGGTGGCCAGTGACGG - Intronic
932343244 2:70979555-70979577 GGACACAGGGAAGAAAGTGAAGG + Intronic
932555205 2:72817895-72817917 GGAAACAGGGAAACCAGTTAGGG - Intronic
933229528 2:79790278-79790300 GGTGTCAGAGAAACCAGTGAAGG + Intronic
933255212 2:80072798-80072820 GGCCACTGAGAAACCTGTGATGG + Intronic
933823532 2:86137530-86137552 AGCGACAGTGACACCAGTGAAGG + Exonic
934087375 2:88521290-88521312 GGCCACAGGGATAAGAGTGGAGG - Intergenic
937029440 2:118725909-118725931 GGCCACAGGGAAACCATTGTGGG - Intergenic
937204247 2:120225444-120225466 CGCATCAGGGAAAACAGTGAAGG - Intergenic
939986584 2:148834867-148834889 AGGCTCAGGGAAACCAGTGCAGG - Intergenic
939991741 2:148882426-148882448 GGGCACAGGGGAACCTCTGAAGG - Intronic
940237484 2:151526835-151526857 GTCCCCAGGGACACCAGGGAAGG - Intronic
940833688 2:158496635-158496657 GGACACAGGTAAACATGTGAAGG - Intronic
941871442 2:170389931-170389953 GGCTACAGGGAAACCAGTGAGGG - Intronic
942077248 2:172367218-172367240 GGCCACAGAGTGATCAGTGAGGG - Intergenic
943559712 2:189446227-189446249 AGTCAGAGGGAAAACAGTGAAGG + Intronic
944434642 2:199674135-199674157 GGTCACAGGGCAGCCACTGAAGG + Intergenic
944851243 2:203721682-203721704 GGCAACAGGGAAACCAGCTAAGG - Intronic
945187431 2:207153827-207153849 AGCTACAGAGAAACCAGGGAAGG - Intronic
946102380 2:217337128-217337150 GGTCACAGAGTAACAAGTGATGG + Intronic
946153915 2:217794498-217794520 GGCCACAGGGAGGCCAGAGCGGG - Intergenic
946740909 2:222800316-222800338 GGGGATAGGGAGACCAGTGAGGG - Intergenic
947245180 2:228038714-228038736 GAGCACTGGGAATCCAGTGATGG - Intronic
947550481 2:231041890-231041912 GTGCAGAAGGAAACCAGTGAGGG + Intronic
947863598 2:233380408-233380430 GGCCACAAGGTAGCCAGTGTGGG - Intronic
1168917915 20:1506419-1506441 GGCTATAGGGAGACCAGTGAGGG + Intergenic
1170080274 20:12467443-12467465 GGCCAAAGGGAGACTGGTGAAGG - Intergenic
1170762040 20:19259546-19259568 GGCCACATGGCAGCCAGTCATGG + Intronic
1170882082 20:20305578-20305600 GGCCGCAGGGAAGCGTGTGAGGG - Intronic
1171147251 20:22795680-22795702 TGCTACAGAGACACCAGTGAAGG + Intergenic
1173938098 20:46885871-46885893 AGGCACAGAGAAACCAGTGGGGG - Intergenic
1174476929 20:50802267-50802289 GGCAGCAGGGAGACCAGAGACGG + Intronic
1175646777 20:60680979-60681001 GGCCACACTGAACCCAGTGTTGG - Intergenic
1178086076 21:29113401-29113423 GGCCTCTGGGAGAACAGTGAAGG - Intronic
1178377519 21:32079828-32079850 CGGCACCGGGAAACGAGTGAAGG - Intergenic
1179036062 21:37759564-37759586 GGACAATGGGAAGCCAGTGATGG - Intronic
1179058790 21:37960331-37960353 GGGCACAGGGAAACTACTGGGGG + Intronic
1179982976 21:44906010-44906032 GGCCACAGTGAGGCCAGGGAAGG - Intronic
1180906294 22:19414397-19414419 GGCCAGAGGCAAAGCAGAGAGGG + Intronic
1181236638 22:21451049-21451071 GGGCAGAGGGAAGCTAGTGATGG - Exonic
1181439069 22:22926590-22926612 GGCCACAGGGAAATGGGTGCGGG - Intergenic
1181465157 22:23106937-23106959 ACACACAGGGAAACCAGGGAGGG + Intronic
1182359828 22:29739936-29739958 GGCCTCAGGGTAGCCAGTGAAGG - Intronic
1182482295 22:30617060-30617082 GGAAGCAGAGAAACCAGTGAGGG + Intronic
1182666531 22:31964325-31964347 GGCAAGTGGGAAACCAGTGTGGG + Intergenic
1182832151 22:33313065-33313087 GGCCTCAGGGAAACCAGGGGAGG - Intronic
1183215453 22:36476691-36476713 TGCCACAGGGAAGCCAGTATAGG - Intronic
1183262437 22:36804261-36804283 GGACCCAGGGACACCAATGAGGG + Intronic
1184286730 22:43476238-43476260 GGCCACAGGGTGCCCAGTGCTGG + Intronic
1184648332 22:45908092-45908114 GGCCACAGAGAAGGCAGTGCTGG - Intergenic
1185039146 22:48495571-48495593 GGGCACAGGGAGCCCAGGGAAGG - Intronic
1185273072 22:49937509-49937531 TGCCACAGGAGACCCAGTGAGGG - Intergenic
1185334472 22:50265493-50265515 GGCTGCAGGGAAGCCAGTGGTGG + Exonic
949266228 3:2159622-2159644 GTCCTCAGGGAAAGCAGTGAAGG - Intronic
949927840 3:9056353-9056375 GGGCACAGGGCAACCACAGATGG - Intronic
950111027 3:10418846-10418868 GGCCACCGGGGTAGCAGTGAGGG + Intronic
950467938 3:13166505-13166527 GGCCACCTGGAAGCCAGTAAGGG - Intergenic
951727482 3:25776191-25776213 GGTCTCAGGCAAACCAGTGTTGG - Intronic
951838292 3:27005567-27005589 GACCACATGGAGCCCAGTGAGGG - Intergenic
952847843 3:37703030-37703052 GTCCCCAGGGAGACCAGTAAGGG - Intronic
953883426 3:46702888-46702910 GGCCTCAGGGCAGCCTGTGAGGG - Intronic
953919244 3:46940602-46940624 GGCTAGAGGGAAACCAGAGGAGG + Intronic
954419819 3:50412912-50412934 GGGCACCGGGAGACCAGGGAGGG - Intronic
955640483 3:61077776-61077798 GCTCACATGGAAGCCAGTGATGG - Intronic
957022255 3:75139364-75139386 GTCCCCAGAGAAACCATTGAGGG + Intergenic
957253053 3:77799185-77799207 GGACAGAGGGAAACCATTAATGG - Intergenic
960695063 3:120388041-120388063 GGCCACGGGCAAACCACGGAGGG - Intergenic
962493627 3:135918112-135918134 GGAAACAGGGAGACCAGTTAGGG - Intergenic
963766675 3:149343363-149343385 GGCCACAGGGAAACCAGCTGGGG + Intergenic
964260607 3:154831483-154831505 GGTCATAGAGAAATCAGTGAAGG + Intergenic
965765254 3:172123919-172123941 GGACACAGGGAATCAATTGATGG + Intronic
966913044 3:184569764-184569786 AGCCTCCGGGAAACCACTGAAGG + Intronic
967136083 3:186513827-186513849 GGGCATAGGGAAACAAGTTAAGG + Intergenic
967169792 3:186814064-186814086 GACCTCAGGGACAGCAGTGAAGG + Intergenic
969046821 4:4342416-4342438 GGCTGCAAGGAAACCACTGAAGG - Intergenic
969857610 4:10013010-10013032 GGAAACAGAGAAACCAGTTAGGG + Intronic
971027854 4:22606334-22606356 GGCCAGTGGGCAACCAATGAGGG + Intergenic
972453923 4:39233203-39233225 CACCTCTGGGAAACCAGTGATGG - Intronic
976089616 4:81442869-81442891 GGTCATAAAGAAACCAGTGACGG + Intronic
977942573 4:102874899-102874921 GGCCACAGGAATAGCAGAGAGGG - Intronic
978784402 4:112593478-112593500 TGCCACTGGGAAATCACTGAAGG - Intronic
980416445 4:132495477-132495499 GGTCACAAGGTAACCAGTGGGGG - Intergenic
980872165 4:138623685-138623707 GGCCTCATGGAGCCCAGTGAGGG + Intergenic
981409672 4:144414372-144414394 AGCCACATGGAATCCAGTAATGG - Intergenic
981730102 4:147887963-147887985 AGCAACAGGGAGACCACTGATGG - Intronic
982065679 4:151652651-151652673 GACCAGTGGGAACCCAGTGAGGG + Intronic
983043433 4:162957078-162957100 GGCCACAGTGAAAACAATGAAGG + Intergenic
983078257 4:163352849-163352871 TGCCACAGGGAAAATAGTGCTGG + Intergenic
983181778 4:164656680-164656702 GGCCTCAGGGATCCCAGTGAGGG - Intergenic
984033105 4:174629797-174629819 AGCCAGAGGGACACCTGTGAGGG - Intergenic
987027118 5:13938734-13938756 AGCCAAAGGGAAATCAGTCATGG - Intronic
987977493 5:25033304-25033326 GGCTACAGGCAAACGAGTGGTGG + Intergenic
991044089 5:62204935-62204957 GGCCACCGGGAACCCACTGGTGG - Intergenic
991146607 5:63313492-63313514 GGTCAGAGGGAAACAAGTCAGGG + Intergenic
992873226 5:81026338-81026360 GGCCCTAGGGAGACCACTGAGGG - Intronic
993625557 5:90220472-90220494 GCCCACTGGGAAATCAGTAATGG + Intergenic
996836342 5:127797178-127797200 GACCACAAGGAAGCCAGTGGGGG + Intergenic
999171820 5:149601872-149601894 GGCTCCAGGGAAATTAGTGAGGG + Intronic
1001482483 5:172097984-172098006 GGCCACTGGGAAAGGAATGATGG + Intronic
1002536087 5:179876354-179876376 AGGCACTGGGAAACCAGAGAAGG + Intronic
1002785037 6:393591-393613 GGCTGCAGGGAAACCGCTGAAGG + Intronic
1003110783 6:3250564-3250586 GGCTCCAGAGAAACCAGTGTGGG + Intronic
1003647266 6:7923995-7924017 TGCTACAGAGAAATCAGTGAGGG - Intronic
1003991166 6:11487928-11487950 GACCAGAGGTAAACCACTGAGGG - Intergenic
1005849541 6:29811400-29811422 GTTCACAGGGCAACCAGTAAGGG - Intergenic
1005861379 6:29905331-29905353 GTTCACAGGGTAACCAGTAAGGG - Intergenic
1007097951 6:39225836-39225858 GGCCACAGGGACACCACAGGAGG - Intronic
1007825990 6:44600942-44600964 GGGCTCAGGGCAAGCAGTGAAGG + Intergenic
1011626586 6:89288209-89288231 GATCACAGAGAAACCAGAGAGGG + Intronic
1012121767 6:95377766-95377788 GGCCACAGTGGAAGCAGAGAGGG - Intergenic
1013163084 6:107564995-107565017 GGCAAGAGGGAAACAAGAGATGG + Intronic
1013481473 6:110556604-110556626 GTACACAGGGAAACCAGAGCAGG + Intergenic
1014004912 6:116406977-116406999 GACCACAGTTAAAACAGTGAGGG + Intronic
1016346333 6:143117846-143117868 GGCCACAGTGAACAGAGTGAAGG - Intronic
1017398673 6:154033487-154033509 GGTCACAGAGAAAGCAGTGGGGG - Intronic
1017670513 6:156765505-156765527 GGTCTCAGGGAAATCAGGGAAGG + Intergenic
1019124530 6:169829616-169829638 GGGCAAAGTGAAGCCAGTGAAGG + Intergenic
1019735248 7:2647167-2647189 GGCAACGGGGAGACCAGTGATGG + Exonic
1020203061 7:6095198-6095220 GGGCTCAGTGAACCCAGTGAGGG + Intergenic
1028380263 7:90192159-90192181 TGTCAAAGGGAAACCTGTGAGGG - Intronic
1031933722 7:127713938-127713960 CGCCACAGGGAAGGCAGGGAGGG - Intronic
1032076946 7:128840549-128840571 GGGCACAGAGGAGCCAGTGAAGG + Exonic
1034308047 7:150062179-150062201 GGCTACTGAGATACCAGTGACGG + Intergenic
1034374828 7:150632933-150632955 GGCTAAAGGGAAGCCATTGAAGG + Intergenic
1034798806 7:154038492-154038514 GGCTACTGAGATACCAGTGACGG - Intronic
1035304018 7:157918383-157918405 GGCAACAGGTAAACCATCGAAGG + Intronic
1035459404 7:159029903-159029925 GGACAGAGGGAAGCCAGTCAGGG - Exonic
1035750330 8:1991716-1991738 GCCCTGAGGGAACCCAGTGATGG + Intronic
1035770576 8:2143530-2143552 GAGCAGAGGGAACCCAGTGAGGG + Intronic
1035822770 8:2612242-2612264 GGCCACAGGGACACAGATGAGGG - Intergenic
1035904012 8:3489455-3489477 GGCCAGAGGGAATCCAGGGAAGG + Intronic
1037787586 8:21911944-21911966 GGCCAGAGGGAAAGCAGAGCCGG - Exonic
1037834212 8:22206833-22206855 GGCTGCAGGGAAGCGAGTGACGG - Exonic
1037876542 8:22551590-22551612 GGCAGCTGGGAAACCAGAGAGGG + Intronic
1037892062 8:22628734-22628756 GGCCACAGGGGTCCCAGAGACGG - Intronic
1037959203 8:23083862-23083884 GGGGACAGGGACACCAGTGCTGG + Intergenic
1039128114 8:34227898-34227920 GGGCACAGGGAAGCCATTGGAGG + Intergenic
1039539929 8:38357303-38357325 GGGCAATGGGAAACCATTGAAGG - Intronic
1040283772 8:46089186-46089208 GGCCACAGGCAGGCCTGTGAAGG + Intergenic
1040325809 8:46340940-46340962 GGCCACAGGGTGACCTGGGAGGG + Intergenic
1042388394 8:68203824-68203846 GGCCAAAGAGAAAACAATGATGG + Intronic
1046705086 8:117440762-117440784 GACAACAGGGACAACAGTGAAGG - Intergenic
1049404884 8:142447891-142447913 GGCCACAGGGCAGCCAGGAAAGG - Intergenic
1051161496 9:14213655-14213677 GGCTATGGGGAAACCACTGAAGG - Intronic
1053350419 9:37410364-37410386 GCCATCAGGGAAGCCAGTGAAGG + Intergenic
1053710169 9:40799207-40799229 GGCCACAGGGACACAAATGCAGG - Intergenic
1054420073 9:64920002-64920024 GGCCACAGGGACACAAATGCAGG - Intergenic
1054769367 9:69069576-69069598 GGGAACAGGGAAACCAGACATGG + Intronic
1056430757 9:86525907-86525929 CTCCACAGGGAAACAAATGAGGG - Intergenic
1056543562 9:87594781-87594803 GGCCACAGGCAAATCTATGATGG - Intronic
1056577465 9:87867462-87867484 GGACACAGGGGAACCACTGAGGG + Intergenic
1056716906 9:89038872-89038894 TTCCACAGGGAAACAAGTGAAGG - Intronic
1057218649 9:93243781-93243803 GACCCCAGGGAGGCCAGTGACGG - Intronic
1058776641 9:108290669-108290691 GGGCAATGGGAAACCAATGAAGG + Intergenic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1061681714 9:132245713-132245735 TGCCACATGGAAGCCAGTGATGG - Intergenic
1062031061 9:134362228-134362250 GGGCACAGGGGAGCCACTGAGGG - Intronic
1187046739 X:15654892-15654914 GGCCTCATGGACAGCAGTGAAGG + Intronic
1187052968 X:15713087-15713109 GGCCTCATGGACAGCAGTGAAGG + Intronic
1188341151 X:29003478-29003500 GGGCACAGGGAAGCCACCGAAGG + Intronic
1190367597 X:49711533-49711555 GGCAACAGGGAGACAAGAGAAGG - Intergenic
1192194586 X:69019672-69019694 GCCCACAGGGACATCAGGGAGGG + Intergenic
1197703805 X:129619281-129619303 GTCAACAGGGAACACAGTGAAGG + Intergenic
1197767113 X:130066568-130066590 GGCCACAGTGACACCAGGCAGGG + Exonic
1198027349 X:132720084-132720106 GGCTACAGGGAAACCATGGTGGG - Intronic
1198672476 X:139095846-139095868 GGTAACAGGGAAAACTGTGAGGG + Intronic
1199361543 X:146925535-146925557 GGCCACACAAAAAACAGTGAGGG - Intergenic
1200153359 X:153962414-153962436 GGCTATAGGGAAGCCAGGGATGG - Intronic
1200179806 X:154143481-154143503 GGACACAGGGACAGCAGAGATGG + Intergenic
1202174328 Y:22083743-22083765 AGCCACAGGGAAAACGGTAAAGG - Intronic
1202217032 Y:22502639-22502661 AGCCACAGGGAAAACGGTAAAGG + Intronic
1202326153 Y:23693431-23693453 AGCCACAGGGAAAACGGTAAAGG - Intergenic
1202544618 Y:25976623-25976645 AGCCACAGGGAAAACGGTAAAGG + Intergenic