ID: 1144874091

View in Genome Browser
Species Human (GRCh38)
Location 17:18388107-18388129
Sequence GGTTGGCTGTGATTAATTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 3, 1: 0, 2: 3, 3: 14, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144874091_1144874095 1 Left 1144874091 17:18388107-18388129 CCTTTAATTAATCACAGCCAACC 0: 3
1: 0
2: 3
3: 14
4: 112
Right 1144874095 17:18388131-18388153 TCAAATAATACCCATAGTGTAGG 0: 1
1: 1
2: 1
3: 11
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144874091 Original CRISPR GGTTGGCTGTGATTAATTAA AGG (reversed) Intronic
903470895 1:23586617-23586639 GCTTGGCAGTTATTTATTAAGGG - Intronic
906743866 1:48207982-48208004 GAGTGGCTGAGATTAATCAATGG + Intergenic
906792107 1:48668221-48668243 GGTTGGCTGGTATTAATCAGAGG + Intronic
908064899 1:60392191-60392213 GGTTGGATGTGATTATTTGTAGG - Intergenic
909873084 1:80768299-80768321 ATTTGGCAGTGATTTATTAATGG - Intergenic
910020300 1:82580451-82580473 GGTAGGCTGTGATAACTTAAAGG + Intergenic
915392999 1:155561817-155561839 GTTTGTGTGTGTTTAATTAAGGG - Intronic
915409155 1:155687735-155687757 GTTTGTGTGTGTTTAATTAAGGG - Intronic
915846821 1:159275170-159275192 GATTGGGTGAGATCAATTAAAGG + Intergenic
917601187 1:176575660-176575682 TGTTAGCTGTTATTAATTATGGG - Intronic
924079292 1:240376873-240376895 GATAGACTGTGATAAATTAAAGG - Intronic
1063820384 10:9828095-9828117 GGCAAACTGTGATTAATTAAAGG + Intergenic
1067942023 10:50665060-50665082 GGTTGGCTTTGATCAGTTACTGG - Intergenic
1069496807 10:68912088-68912110 GGTTGGCTGTGTTGACTTACAGG + Intronic
1070863263 10:79690007-79690029 GGTTGGCTTTGATCAGTTACTGG - Intergenic
1075176701 10:120170618-120170640 TGTTGGTTGTTATTAATTTAAGG - Intergenic
1076062425 10:127423860-127423882 GGCTCGCTTTGATTAATTAGAGG + Intronic
1079071965 11:17354879-17354901 TGTTGGATGTGACTAATGAAAGG + Intronic
1082243723 11:49895838-49895860 GGTAGGCTGTGATAGATAAAAGG - Intergenic
1086385327 11:86301560-86301582 GCTTGGCTGTGCTTAATTAGTGG - Intergenic
1094018786 12:25892230-25892252 GGTAGGCAGTGATTAAGTACTGG - Intergenic
1099337733 12:81385710-81385732 GGATAGCTGTGATGAGTTAATGG + Intronic
1100172070 12:91986471-91986493 GTTTGGCTGTGGTTAAGTATTGG - Exonic
1101295652 12:103421035-103421057 GGTGCACTGTGATTACTTAAAGG - Intronic
1101300070 12:103470428-103470450 AGTTGTCTGTGATTCATTCATGG + Intronic
1104953507 12:132453054-132453076 GTTTGGATGGGATTAATGAAGGG - Intergenic
1105444675 13:20442720-20442742 GCTTGACTTTGCTTAATTAAAGG + Intronic
1111849821 13:93558787-93558809 GGTTTGTTGTGTTTAATTGATGG + Intronic
1120797231 14:88647719-88647741 GATTCCCTGTTATTAATTAATGG - Intronic
1122162761 14:99797670-99797692 GGTGAGCTGTGATTGATCAAAGG - Intronic
1122330304 14:100907529-100907551 GGGTGGCTGTGATGATTTAGAGG - Intergenic
1122335039 14:100968537-100968559 CTTTGGCTTTTATTAATTAATGG - Intergenic
1122621963 14:103063504-103063526 GGTTGGTTTTGATTAATTGACGG - Intergenic
1126526646 15:49663485-49663507 TGCTGGCTCTGATTAAATAATGG - Intergenic
1127040617 15:54972243-54972265 GTTTGGCTGTTATAAATAAATGG + Intergenic
1130234413 15:82120968-82120990 GGATGGCTGTGATAAATGAGAGG + Intergenic
1130815458 15:87427329-87427351 GGTTGGCGGTGATTGAATCATGG - Intergenic
1131597368 15:93812179-93812201 TGCTTGCTGTGATTAATTTAAGG + Intergenic
1132624524 16:885174-885196 GGTGAGCTGTGATGGATTAAAGG + Intronic
1144640991 17:16936410-16936432 GGTTGGCTGTGATTAATTAAAGG + Intronic
1144874091 17:18388107-18388129 GGTTGGCTGTGATTAATTAAAGG - Intronic
1145158129 17:20556309-20556331 GGTTGGCTGTGATTAATTAAAGG + Intergenic
1147939246 17:44034176-44034198 GAGTGGAGGTGATTAATTAATGG - Intergenic
1153939678 18:9967467-9967489 CTTTGGCTGTGATTAAGTGAAGG - Intergenic
1154071274 18:11154003-11154025 TGTTGGCTGTAAATAATGAATGG - Intergenic
1154486324 18:14874362-14874384 GGTTGGCTGTGACTAACTCATGG + Intergenic
1155109942 18:22704536-22704558 GGTTGGTTGTGTTTATTTACTGG - Intergenic
1156020700 18:32596516-32596538 GGTTGGCATGGATTAATTAATGG + Intergenic
1156163502 18:34388926-34388948 TGATGGCTATGAATAATTAATGG + Intergenic
1157627849 18:49066436-49066458 GTTTGGCTGTGATTCATTCACGG + Intronic
1158060465 18:53334563-53334585 GGTTGGCAGTTATTATTTAATGG - Intronic
1165608888 19:37133475-37133497 AGTTGGCTGTGATTTATCATGGG - Intronic
925318837 2:2946256-2946278 GGTAGACCATGATTAATTAAAGG + Intergenic
926747161 2:16168291-16168313 GTGTGTGTGTGATTAATTAATGG - Intergenic
927745490 2:25616007-25616029 TGTTGGCAGTGATAAATCAAAGG + Intronic
927778571 2:25921207-25921229 GGATGGCTGTGAATAACAAAGGG + Intergenic
928080430 2:28307546-28307568 GGTAGGCTGTGATAAGTTAACGG - Intronic
932187621 2:69712463-69712485 GGTTTGTTGTGAATGATTAAAGG + Intronic
933619594 2:84522596-84522618 TGTTGGCTGTGAGTAATATATGG + Intronic
934574660 2:95392344-95392366 GGTTGGCTGTCAGGAAATAACGG - Intergenic
935016718 2:99189907-99189929 GGTTGGCAGTTATTATTTAGTGG - Intronic
938982540 2:136540177-136540199 GGTGGGGTGTGATTAAATCATGG + Intergenic
940175779 2:150876564-150876586 GGTTTGCTGTTGTTAATTAATGG - Intergenic
942083692 2:172425609-172425631 GGTTGCCTGTGAGGAACTAAGGG + Intergenic
944663168 2:201938000-201938022 ATTGGGCTGTGATTAATCAAGGG - Intergenic
946517871 2:220432906-220432928 GGAAGGCTGTGGTTAGTTAAAGG + Intergenic
948270468 2:236669784-236669806 GCTTGGCTTTGAGTCATTAATGG - Intergenic
1170166961 20:13369657-13369679 GATTGGCTGAGAATAAATAATGG + Intergenic
1173485726 20:43439597-43439619 TGTTGGCTGTAAAGAATTAATGG - Intergenic
1175651333 20:60726731-60726753 GGTAGACTGTAATTAATTAAAGG - Intergenic
1176794977 21:13365017-13365039 GGTTGGCTGTGACTAATTCATGG - Intergenic
1185331443 22:50253809-50253831 GTTTGGCTTTGTTTGATTAAAGG - Intronic
949106008 3:200157-200179 TGTTGGCTGTCATAAATTAAAGG - Intronic
949353774 3:3155376-3155398 TGTGGGCAGTGATTCATTAAGGG + Intronic
951616272 3:24548836-24548858 GGGTTGCTGTGAGTAATAAAAGG - Intergenic
951655202 3:24999482-24999504 GGTAGGCTTTGATTTCTTAATGG - Intergenic
952767266 3:36965084-36965106 GATTGGCAGTTATTATTTAATGG + Intergenic
956632809 3:71332608-71332630 GAGTAGCTGTGATTAATTACAGG - Intronic
962690159 3:137887750-137887772 GGTTGGGTGTGATAAATTAATGG - Intergenic
962945454 3:140165198-140165220 GGTTGTCTCTGATTAAGTGATGG + Intronic
966925595 3:184642763-184642785 GAATGGCTGTGATTTATGAATGG - Intronic
968464121 4:741972-741994 GCTGGGATGTGATTATTTAAGGG + Intronic
976857251 4:89619307-89619329 GATTGGCTTTCATTACTTAAAGG + Intergenic
977978311 4:103293390-103293412 GGTTCGGGGTGAGTAATTAAGGG + Intergenic
979593890 4:122511502-122511524 GTTTGTCTGTGATTTACTAATGG + Intergenic
980458503 4:133075557-133075579 GGTTGGAGGTGATTAAATCATGG - Intergenic
986488150 5:8261396-8261418 AGTTGACAGTGATTATTTAAAGG - Intergenic
990015722 5:51059794-51059816 GGTTGGTTGTCATTATTTATTGG - Intergenic
991946628 5:71904037-71904059 GGGTGGGGGTGATTAATAAAGGG + Intergenic
992168905 5:74082991-74083013 GATATGCTGTGATTTATTAATGG - Intergenic
997218459 5:132135270-132135292 GGCTGACTGTGATTAATTAAAGG + Intergenic
1001194417 5:169658924-169658946 TGTTGGCAATGATTAATTATAGG - Intronic
1001227083 5:169954200-169954222 GTTTGGCTGTGACTAACTCATGG + Intronic
1001377333 5:171273745-171273767 GGTTGGCTGTGAGAAATACAAGG - Intronic
1001836616 5:174837874-174837896 GGGTGGTTGTGAGGAATTAATGG + Intergenic
1003992880 6:11504264-11504286 GGTAGATTGTGACTAATTAAAGG - Intergenic
1004146873 6:13076046-13076068 GGTTGGCTGATGTTACTTAATGG + Intronic
1004339187 6:14793291-14793313 GGTTGGCTTTAATTAATTTCAGG - Intergenic
1005774717 6:29118414-29118436 GATTGGCTGAGATTAATTGGGGG + Intergenic
1006847377 6:37071978-37072000 AATTTGCTGTGTTTAATTAAGGG - Intergenic
1013374521 6:109501517-109501539 GGAGGGCTGTGATTGCTTAAAGG - Intronic
1014275672 6:119385619-119385641 GGTAGACTGTGATAATTTAAAGG + Intergenic
1016928931 6:149382798-149382820 GGTTGCCTTTTTTTAATTAATGG - Intronic
1017138425 6:151168341-151168363 GGTTGGTTGTTTTTAATTATGGG + Intergenic
1017618934 6:156274970-156274992 GGAAGGCTGTGAATAGTTAAAGG - Intergenic
1020411017 7:7891658-7891680 GGATGGCAGTTATTACTTAATGG + Intronic
1020999032 7:15304329-15304351 GGTACGCTGTTATTAAATAATGG - Intronic
1021181478 7:17510958-17510980 GGATGGCTGTGATGGATCAAGGG + Intergenic
1023759772 7:43454128-43454150 GGTTGGCTTTTATAAATTAAGGG - Intronic
1024385817 7:48750177-48750199 ATTTGGCTGTGATTATTTACAGG - Intergenic
1028311024 7:89336142-89336164 GGTTGGATTTCACTAATTAAAGG - Exonic
1029600077 7:101558250-101558272 GGCTGGCAGTGATTTATTCAGGG - Exonic
1030755070 7:113277542-113277564 GGTGGTCTGTGATCATTTAAAGG - Intergenic
1030783517 7:113631033-113631055 GATGTGATGTGATTAATTAAGGG - Intergenic
1031889908 7:127281859-127281881 GGTTTTCTGTGATCAATCAAGGG + Intergenic
1032356053 7:131211574-131211596 GGTTGGTTGTAATAAATTACAGG - Intronic
1036814383 8:11890360-11890382 GGTGGGCAGTGATTGAATAATGG + Intergenic
1041641343 8:60206170-60206192 TGGTGGCTGAGATTACTTAAAGG - Intronic
1045297659 8:100886244-100886266 GGGTGGATGTGATGAATCAATGG - Intergenic
1048970873 8:139644424-139644446 CGTGGGCTGTGATCCATTAATGG - Intronic
1051969574 9:22871885-22871907 GGTAGGTTGTGATTAGATAACGG - Intergenic
1053887245 9:42653174-42653196 GGTTGGCTGTGACTAACTCATGG + Intergenic
1053895502 9:42737892-42737914 GGTCGGCTGTGATCCGTTAAAGG + Intergenic
1054226266 9:62460625-62460647 GGTTGGCTGTGACTAACTCATGG + Intergenic
1056884146 9:90423924-90423946 ACTTTGCTGTGAGTAATTAACGG + Intergenic
1058773959 9:108265937-108265959 GGTTGGTTGAGATTACTTAGGGG + Intergenic
1059070234 9:111127797-111127819 GGTTGGTTGTGTTTAGTTAGTGG + Intergenic
1186682642 X:11891738-11891760 GGGTTGCTGTGAGTAATAAATGG + Intergenic
1187654410 X:21453938-21453960 GGTGGGATGTGATTAAATCATGG - Intronic
1188746576 X:33851966-33851988 GGTAGGTTGTGATTTTTTAAGGG - Intergenic
1189578404 X:42380182-42380204 GATTGGGGGTGATGAATTAATGG + Intergenic
1194844923 X:98793567-98793589 TCTTGTCTGTGATCAATTAATGG + Intergenic