ID: 1144874416

View in Genome Browser
Species Human (GRCh38)
Location 17:18390037-18390059
Sequence CAGTGGCATGCAGTGAGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144874416_1144874420 -8 Left 1144874416 17:18390037-18390059 CCTCATCTCACTGCATGCCACTG No data
Right 1144874420 17:18390052-18390074 TGCCACTGTTCAGGCTCCTGGGG No data
1144874416_1144874424 7 Left 1144874416 17:18390037-18390059 CCTCATCTCACTGCATGCCACTG No data
Right 1144874424 17:18390067-18390089 TCCTGGGGCTCCACGTGGATGGG No data
1144874416_1144874423 6 Left 1144874416 17:18390037-18390059 CCTCATCTCACTGCATGCCACTG No data
Right 1144874423 17:18390066-18390088 CTCCTGGGGCTCCACGTGGATGG No data
1144874416_1144874429 17 Left 1144874416 17:18390037-18390059 CCTCATCTCACTGCATGCCACTG No data
Right 1144874429 17:18390077-18390099 CCACGTGGATGGGCGGACACGGG No data
1144874416_1144874419 -9 Left 1144874416 17:18390037-18390059 CCTCATCTCACTGCATGCCACTG No data
Right 1144874419 17:18390051-18390073 ATGCCACTGTTCAGGCTCCTGGG No data
1144874416_1144874422 2 Left 1144874416 17:18390037-18390059 CCTCATCTCACTGCATGCCACTG No data
Right 1144874422 17:18390062-18390084 CAGGCTCCTGGGGCTCCACGTGG No data
1144874416_1144874426 10 Left 1144874416 17:18390037-18390059 CCTCATCTCACTGCATGCCACTG No data
Right 1144874426 17:18390070-18390092 TGGGGCTCCACGTGGATGGGCGG No data
1144874416_1144874430 26 Left 1144874416 17:18390037-18390059 CCTCATCTCACTGCATGCCACTG No data
Right 1144874430 17:18390086-18390108 TGGGCGGACACGGGACTCCTAGG No data
1144874416_1144874418 -10 Left 1144874416 17:18390037-18390059 CCTCATCTCACTGCATGCCACTG No data
Right 1144874418 17:18390050-18390072 CATGCCACTGTTCAGGCTCCTGG No data
1144874416_1144874427 16 Left 1144874416 17:18390037-18390059 CCTCATCTCACTGCATGCCACTG No data
Right 1144874427 17:18390076-18390098 TCCACGTGGATGGGCGGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144874416 Original CRISPR CAGTGGCATGCAGTGAGATG AGG (reversed) Intergenic
No off target data available for this crispr