ID: 1144875288

View in Genome Browser
Species Human (GRCh38)
Location 17:18394250-18394272
Sequence CACTGTCCCCATGGGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144875276_1144875288 2 Left 1144875276 17:18394225-18394247 CCCATTTCCCTAGAACTACAGCC No data
Right 1144875288 17:18394250-18394272 CACTGTCCCCATGGGGAAGGGGG No data
1144875270_1144875288 14 Left 1144875270 17:18394213-18394235 CCCCTGTCCTCCCCCATTTCCCT No data
Right 1144875288 17:18394250-18394272 CACTGTCCCCATGGGGAAGGGGG No data
1144875277_1144875288 1 Left 1144875277 17:18394226-18394248 CCATTTCCCTAGAACTACAGCCC No data
Right 1144875288 17:18394250-18394272 CACTGTCCCCATGGGGAAGGGGG No data
1144875269_1144875288 18 Left 1144875269 17:18394209-18394231 CCTGCCCCTGTCCTCCCCCATTT No data
Right 1144875288 17:18394250-18394272 CACTGTCCCCATGGGGAAGGGGG No data
1144875274_1144875288 4 Left 1144875274 17:18394223-18394245 CCCCCATTTCCCTAGAACTACAG No data
Right 1144875288 17:18394250-18394272 CACTGTCCCCATGGGGAAGGGGG No data
1144875279_1144875288 -6 Left 1144875279 17:18394233-18394255 CCTAGAACTACAGCCCTCACTGT No data
Right 1144875288 17:18394250-18394272 CACTGTCCCCATGGGGAAGGGGG No data
1144875273_1144875288 7 Left 1144875273 17:18394220-18394242 CCTCCCCCATTTCCCTAGAACTA No data
Right 1144875288 17:18394250-18394272 CACTGTCCCCATGGGGAAGGGGG No data
1144875272_1144875288 12 Left 1144875272 17:18394215-18394237 CCTGTCCTCCCCCATTTCCCTAG No data
Right 1144875288 17:18394250-18394272 CACTGTCCCCATGGGGAAGGGGG No data
1144875275_1144875288 3 Left 1144875275 17:18394224-18394246 CCCCATTTCCCTAGAACTACAGC No data
Right 1144875288 17:18394250-18394272 CACTGTCCCCATGGGGAAGGGGG No data
1144875278_1144875288 -5 Left 1144875278 17:18394232-18394254 CCCTAGAACTACAGCCCTCACTG No data
Right 1144875288 17:18394250-18394272 CACTGTCCCCATGGGGAAGGGGG No data
1144875268_1144875288 21 Left 1144875268 17:18394206-18394228 CCACCTGCCCCTGTCCTCCCCCA No data
Right 1144875288 17:18394250-18394272 CACTGTCCCCATGGGGAAGGGGG No data
1144875267_1144875288 22 Left 1144875267 17:18394205-18394227 CCCACCTGCCCCTGTCCTCCCCC No data
Right 1144875288 17:18394250-18394272 CACTGTCCCCATGGGGAAGGGGG No data
1144875271_1144875288 13 Left 1144875271 17:18394214-18394236 CCCTGTCCTCCCCCATTTCCCTA No data
Right 1144875288 17:18394250-18394272 CACTGTCCCCATGGGGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144875288 Original CRISPR CACTGTCCCCATGGGGAAGG GGG Intergenic
No off target data available for this crispr