ID: 1144875672

View in Genome Browser
Species Human (GRCh38)
Location 17:18395877-18395899
Sequence CTGGGACCACCTGGAGCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144875661_1144875672 25 Left 1144875661 17:18395829-18395851 CCTATTCGTGCAAGCGTCACCTT No data
Right 1144875672 17:18395877-18395899 CTGGGACCACCTGGAGCTCAAGG No data
1144875660_1144875672 29 Left 1144875660 17:18395825-18395847 CCTGCCTATTCGTGCAAGCGTCA No data
Right 1144875672 17:18395877-18395899 CTGGGACCACCTGGAGCTCAAGG No data
1144875666_1144875672 6 Left 1144875666 17:18395848-18395870 CCTTGCTGGGAGGGAATCTGAAT No data
Right 1144875672 17:18395877-18395899 CTGGGACCACCTGGAGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144875672 Original CRISPR CTGGGACCACCTGGAGCTCA AGG Intergenic