ID: 1144875781

View in Genome Browser
Species Human (GRCh38)
Location 17:18396457-18396479
Sequence CTTTGGGAAGGAAGGAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144875781_1144875789 6 Left 1144875781 17:18396457-18396479 CCTTCTTTCCTTCCTTCCCAAAG No data
Right 1144875789 17:18396486-18396508 CTGTGGGCTGACTGCCATTTGGG No data
1144875781_1144875791 11 Left 1144875781 17:18396457-18396479 CCTTCTTTCCTTCCTTCCCAAAG No data
Right 1144875791 17:18396491-18396513 GGCTGACTGCCATTTGGGGCAGG No data
1144875781_1144875790 7 Left 1144875781 17:18396457-18396479 CCTTCTTTCCTTCCTTCCCAAAG No data
Right 1144875790 17:18396487-18396509 TGTGGGCTGACTGCCATTTGGGG No data
1144875781_1144875785 -10 Left 1144875781 17:18396457-18396479 CCTTCTTTCCTTCCTTCCCAAAG No data
Right 1144875785 17:18396470-18396492 CTTCCCAAAGCGCTGACTGTGGG No data
1144875781_1144875788 5 Left 1144875781 17:18396457-18396479 CCTTCTTTCCTTCCTTCCCAAAG No data
Right 1144875788 17:18396485-18396507 ACTGTGGGCTGACTGCCATTTGG No data
1144875781_1144875792 12 Left 1144875781 17:18396457-18396479 CCTTCTTTCCTTCCTTCCCAAAG No data
Right 1144875792 17:18396492-18396514 GCTGACTGCCATTTGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144875781 Original CRISPR CTTTGGGAAGGAAGGAAAGA AGG (reversed) Intergenic
No off target data available for this crispr