ID: 1144875785

View in Genome Browser
Species Human (GRCh38)
Location 17:18396470-18396492
Sequence CTTCCCAAAGCGCTGACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144875778_1144875785 22 Left 1144875778 17:18396425-18396447 CCAAAAAGCAGCTTTCTGCACAA No data
Right 1144875785 17:18396470-18396492 CTTCCCAAAGCGCTGACTGTGGG No data
1144875781_1144875785 -10 Left 1144875781 17:18396457-18396479 CCTTCTTTCCTTCCTTCCCAAAG No data
Right 1144875785 17:18396470-18396492 CTTCCCAAAGCGCTGACTGTGGG No data
1144875780_1144875785 -6 Left 1144875780 17:18396453-18396475 CCTTCCTTCTTTCCTTCCTTCCC 0: 141
1: 3641
2: 42545
3: 34924
4: 48605
Right 1144875785 17:18396470-18396492 CTTCCCAAAGCGCTGACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144875785 Original CRISPR CTTCCCAAAGCGCTGACTGT GGG Intergenic
No off target data available for this crispr