ID: 1144875789

View in Genome Browser
Species Human (GRCh38)
Location 17:18396486-18396508
Sequence CTGTGGGCTGACTGCCATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144875783_1144875789 -6 Left 1144875783 17:18396469-18396491 CCTTCCCAAAGCGCTGACTGTGG No data
Right 1144875789 17:18396486-18396508 CTGTGGGCTGACTGCCATTTGGG No data
1144875780_1144875789 10 Left 1144875780 17:18396453-18396475 CCTTCCTTCTTTCCTTCCTTCCC 0: 141
1: 3641
2: 42545
3: 34924
4: 48605
Right 1144875789 17:18396486-18396508 CTGTGGGCTGACTGCCATTTGGG No data
1144875786_1144875789 -10 Left 1144875786 17:18396473-18396495 CCCAAAGCGCTGACTGTGGGCTG No data
Right 1144875789 17:18396486-18396508 CTGTGGGCTGACTGCCATTTGGG No data
1144875781_1144875789 6 Left 1144875781 17:18396457-18396479 CCTTCTTTCCTTCCTTCCCAAAG No data
Right 1144875789 17:18396486-18396508 CTGTGGGCTGACTGCCATTTGGG No data
1144875782_1144875789 -2 Left 1144875782 17:18396465-18396487 CCTTCCTTCCCAAAGCGCTGACT No data
Right 1144875789 17:18396486-18396508 CTGTGGGCTGACTGCCATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144875789 Original CRISPR CTGTGGGCTGACTGCCATTT GGG Intergenic
No off target data available for this crispr