ID: 1144876626

View in Genome Browser
Species Human (GRCh38)
Location 17:18400527-18400549
Sequence GATCCTCTGTTCTGGCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144876621_1144876626 8 Left 1144876621 17:18400496-18400518 CCCAAGGGCAGCTTCCTCACACT No data
Right 1144876626 17:18400527-18400549 GATCCTCTGTTCTGGCCCAGAGG No data
1144876615_1144876626 30 Left 1144876615 17:18400474-18400496 CCCTGCGGTCAGACCCGACTGGC No data
Right 1144876626 17:18400527-18400549 GATCCTCTGTTCTGGCCCAGAGG No data
1144876619_1144876626 17 Left 1144876619 17:18400487-18400509 CCCGACTGGCCCAAGGGCAGCTT No data
Right 1144876626 17:18400527-18400549 GATCCTCTGTTCTGGCCCAGAGG No data
1144876620_1144876626 16 Left 1144876620 17:18400488-18400510 CCGACTGGCCCAAGGGCAGCTTC No data
Right 1144876626 17:18400527-18400549 GATCCTCTGTTCTGGCCCAGAGG No data
1144876622_1144876626 7 Left 1144876622 17:18400497-18400519 CCAAGGGCAGCTTCCTCACACTG No data
Right 1144876626 17:18400527-18400549 GATCCTCTGTTCTGGCCCAGAGG No data
1144876616_1144876626 29 Left 1144876616 17:18400475-18400497 CCTGCGGTCAGACCCGACTGGCC No data
Right 1144876626 17:18400527-18400549 GATCCTCTGTTCTGGCCCAGAGG No data
1144876623_1144876626 -6 Left 1144876623 17:18400510-18400532 CCTCACACTGTCCTCATGATCCT No data
Right 1144876626 17:18400527-18400549 GATCCTCTGTTCTGGCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144876626 Original CRISPR GATCCTCTGTTCTGGCCCAG AGG Intergenic