ID: 1144878581

View in Genome Browser
Species Human (GRCh38)
Location 17:18418229-18418251
Sequence CAGTGTTAGCTGCTGGAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144878576_1144878581 10 Left 1144878576 17:18418196-18418218 CCTACATTTCATAATAGAAAACC No data
Right 1144878581 17:18418229-18418251 CAGTGTTAGCTGCTGGAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144878581 Original CRISPR CAGTGTTAGCTGCTGGAATA AGG Intergenic
No off target data available for this crispr