ID: 1144880457

View in Genome Browser
Species Human (GRCh38)
Location 17:18428024-18428046
Sequence AGCTAGAGGGTGCCCCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144880457_1144880460 -8 Left 1144880457 17:18428024-18428046 CCTGTCAGGGGCACCCTCTAGCT No data
Right 1144880460 17:18428039-18428061 CTCTAGCTGACTGTAAAACGAGG No data
1144880457_1144880461 -7 Left 1144880457 17:18428024-18428046 CCTGTCAGGGGCACCCTCTAGCT No data
Right 1144880461 17:18428040-18428062 TCTAGCTGACTGTAAAACGAGGG No data
1144880457_1144880462 -6 Left 1144880457 17:18428024-18428046 CCTGTCAGGGGCACCCTCTAGCT No data
Right 1144880462 17:18428041-18428063 CTAGCTGACTGTAAAACGAGGGG No data
1144880457_1144880463 -5 Left 1144880457 17:18428024-18428046 CCTGTCAGGGGCACCCTCTAGCT No data
Right 1144880463 17:18428042-18428064 TAGCTGACTGTAAAACGAGGGGG No data
1144880457_1144880469 30 Left 1144880457 17:18428024-18428046 CCTGTCAGGGGCACCCTCTAGCT No data
Right 1144880469 17:18428077-18428099 CCTCCCTTGTTCTAGAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144880457 Original CRISPR AGCTAGAGGGTGCCCCTGAC AGG (reversed) Intergenic
No off target data available for this crispr