ID: 1144885171

View in Genome Browser
Species Human (GRCh38)
Location 17:18453011-18453033
Sequence CAGTGTTAGCTGCTGGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144885171_1144885176 10 Left 1144885171 17:18453011-18453033 CCTTATTCCAGCAGCTAACACTG No data
Right 1144885176 17:18453044-18453066 GGTTTTCTATTATGAAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144885171 Original CRISPR CAGTGTTAGCTGCTGGAATA AGG (reversed) Intergenic
No off target data available for this crispr