ID: 1144885956

View in Genome Browser
Species Human (GRCh38)
Location 17:18461898-18461920
Sequence CTCCTCTTCTAGGGTAGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144885956_1144885961 26 Left 1144885956 17:18461898-18461920 CCTTTGCTACCCTAGAAGAGGAG No data
Right 1144885961 17:18461947-18461969 TGCTTATATACTTGATACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144885956 Original CRISPR CTCCTCTTCTAGGGTAGCAA AGG (reversed) Intergenic
No off target data available for this crispr