ID: 1144887117

View in Genome Browser
Species Human (GRCh38)
Location 17:18470884-18470906
Sequence CATCAGAGGGAGGGTGCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144887110_1144887117 -7 Left 1144887110 17:18470868-18470890 CCTCAGGAATAGGGCTCATCAGA No data
Right 1144887117 17:18470884-18470906 CATCAGAGGGAGGGTGCGGGAGG No data
1144887106_1144887117 19 Left 1144887106 17:18470842-18470864 CCTTGAGCAAATGGCTGGACAAT No data
Right 1144887117 17:18470884-18470906 CATCAGAGGGAGGGTGCGGGAGG No data
1144887105_1144887117 20 Left 1144887105 17:18470841-18470863 CCCTTGAGCAAATGGCTGGACAA No data
Right 1144887117 17:18470884-18470906 CATCAGAGGGAGGGTGCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144887117 Original CRISPR CATCAGAGGGAGGGTGCGGG AGG Intergenic
No off target data available for this crispr