ID: 1144887887

View in Genome Browser
Species Human (GRCh38)
Location 17:18476451-18476473
Sequence TACCCAGCCCCATTATTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144887878_1144887887 12 Left 1144887878 17:18476416-18476438 CCACCCTTCCCCACAAGCACCCT No data
Right 1144887887 17:18476451-18476473 TACCCAGCCCCATTATTTTCTGG No data
1144887885_1144887887 -7 Left 1144887885 17:18476435-18476457 CCCTGTGCACAGGCAATACCCAG No data
Right 1144887887 17:18476451-18476473 TACCCAGCCCCATTATTTTCTGG No data
1144887880_1144887887 8 Left 1144887880 17:18476420-18476442 CCTTCCCCACAAGCACCCTGTGC No data
Right 1144887887 17:18476451-18476473 TACCCAGCCCCATTATTTTCTGG No data
1144887879_1144887887 9 Left 1144887879 17:18476419-18476441 CCCTTCCCCACAAGCACCCTGTG No data
Right 1144887887 17:18476451-18476473 TACCCAGCCCCATTATTTTCTGG No data
1144887884_1144887887 2 Left 1144887884 17:18476426-18476448 CCACAAGCACCCTGTGCACAGGC No data
Right 1144887887 17:18476451-18476473 TACCCAGCCCCATTATTTTCTGG No data
1144887882_1144887887 3 Left 1144887882 17:18476425-18476447 CCCACAAGCACCCTGTGCACAGG No data
Right 1144887887 17:18476451-18476473 TACCCAGCCCCATTATTTTCTGG No data
1144887886_1144887887 -8 Left 1144887886 17:18476436-18476458 CCTGTGCACAGGCAATACCCAGC No data
Right 1144887887 17:18476451-18476473 TACCCAGCCCCATTATTTTCTGG No data
1144887881_1144887887 4 Left 1144887881 17:18476424-18476446 CCCCACAAGCACCCTGTGCACAG No data
Right 1144887887 17:18476451-18476473 TACCCAGCCCCATTATTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144887887 Original CRISPR TACCCAGCCCCATTATTTTC TGG Intergenic
No off target data available for this crispr