ID: 1144888095

View in Genome Browser
Species Human (GRCh38)
Location 17:18477579-18477601
Sequence AGGGACTGTCCCTGCAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 2, 1: 0, 2: 8, 3: 31, 4: 227}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144888095 Original CRISPR AGGGACTGTCCCTGCAGTGT GGG Intronic
900386670 1:2413839-2413861 AGGGGCCATTCCTGCAGTGTGGG - Intergenic
900556446 1:3283237-3283259 CGGGGCTGTCCCTGCAATGGAGG + Intronic
901640767 1:10692025-10692047 AGAGCCTGTCCCTGGAGTGCTGG + Intronic
902411051 1:16211817-16211839 AGGTAATGTCCCTGCTGTCTGGG - Intronic
903258902 1:22120703-22120725 AGGTACTGTCCCTGCACTTGGGG + Intronic
903986064 1:27229721-27229743 AGTGACTGCCTCTGCAGAGTTGG + Intergenic
904287047 1:29459570-29459592 AGTGACTGTCCCTCCAGCATAGG - Intergenic
904437963 1:30511563-30511585 AGAGACTGTATCAGCAGTGTAGG - Intergenic
913087015 1:115448488-115448510 AGGAACCTTCCCTGCAGGGTTGG + Intergenic
913712481 1:121499480-121499502 AGGGGATGTCCCAGCAATGTAGG - Intergenic
916437138 1:164787677-164787699 AGGGACTGTCACAGCATTGTGGG - Intronic
916456074 1:164972230-164972252 AGTGCCTGTCCCTGCAGTGATGG + Intergenic
917188946 1:172392979-172393001 TGGGACTGCCCTTGCAGGGTGGG - Intronic
918044540 1:180933820-180933842 AGGGACAGTGCCTGGAGTGGGGG + Intronic
918229855 1:182518362-182518384 AGGGAATATCCTGGCAGTGTGGG + Intronic
919924762 1:202186539-202186561 AGGGGCTGTCCCCGCAGTGTGGG + Intergenic
922675041 1:227544573-227544595 AGGGGCTGTCCCTGAGCTGTGGG + Intergenic
924582124 1:245331579-245331601 TGGGACTGTCCCTGGATTGGTGG + Intronic
1064869581 10:19922331-19922353 TGGGGCTGTCCCTGGAGGGTAGG + Intronic
1069504194 10:68982356-68982378 AGCCAGTGTCCCTGAAGTGTGGG - Intronic
1069804685 10:71112924-71112946 AGGGAATATCCCAGCTGTGTGGG + Intergenic
1070584877 10:77756563-77756585 AGGGATTGTCCAGGCAGTGTGGG - Intergenic
1070647757 10:78213227-78213249 TGGGCCTCTCCCAGCAGTGTGGG + Intergenic
1071352734 10:84762985-84763007 AGAGAATGTGCCTGCAGTGGGGG + Intergenic
1073176182 10:101559078-101559100 AGGGACTGTCCCTCACGGGTGGG - Intergenic
1073179478 10:101575068-101575090 AGGGATGTTCCCTGCAGTGTGGG + Intronic
1075780182 10:125012344-125012366 GGGGACGGTCCCTGCAGGGACGG + Intronic
1076222275 10:128744012-128744034 AGGCAATGTACCTGCAGTGTGGG - Intergenic
1076796896 10:132802849-132802871 AGGCCCTGTCCCTGCAGGGCTGG + Intergenic
1079103735 11:17557594-17557616 TGGGATTGACCCTGCAATGTGGG + Intronic
1080136492 11:28860599-28860621 ATAGACTGTACCTTCAGTGTTGG - Intergenic
1080645436 11:34184580-34184602 AGGAGCTCTCCCTGCCGTGTGGG - Intronic
1080923970 11:36737116-36737138 AGGAATTATCCCAGCAGTGTGGG + Intergenic
1082955289 11:58863906-58863928 AGGAACTGGCCCTGGAGAGTAGG + Intronic
1083877687 11:65532907-65532929 AGACACTGTCCTTGCTGTGTGGG + Intronic
1084569547 11:69951168-69951190 AGAGCCTGTCCCAGCAGTGCAGG + Intergenic
1084595747 11:70116068-70116090 ACGGACTGTCCCAGCAGAGTGGG + Intronic
1085519569 11:77130182-77130204 AGGGACTGCCCCAGGAATGTGGG - Intronic
1085530481 11:77189511-77189533 AGGCCCTGTCCCAGCACTGTGGG + Intronic
1091451635 12:575846-575868 AAGGGCTCTCCCTGCAGTGGGGG - Intronic
1093135386 12:15443863-15443885 AGGGAATGTTCCTACACTGTTGG + Intronic
1093428427 12:19055580-19055602 AAGGACTGTCCCTCCACTTTAGG + Intergenic
1094165585 12:27439278-27439300 AGGGATTATCCCAGCAGTGTGGG - Intergenic
1097130322 12:56806558-56806580 AGGGACTGTCTGGACAGTGTGGG - Intergenic
1098979732 12:76943217-76943239 AATGACTGTCCCTGCAGCCTTGG - Intergenic
1100326392 12:93543669-93543691 AGGCTCTGTCCCTGGAGAGTTGG - Intergenic
1102433948 12:112905699-112905721 TGTGACTGTCCCTGCAGAGCAGG + Intergenic
1103447078 12:121001447-121001469 AGGGACTGTCGCTGCTTCGTGGG + Exonic
1104665104 12:130642224-130642246 AGGGCCTCTCCCTGGAGTGTGGG - Intronic
1107004879 13:35598308-35598330 AGTCCCTGTCCCTGCAGTCTGGG - Intronic
1108036219 13:46293061-46293083 AGAGGCTGTCCATGCAGTGCAGG - Intergenic
1114181207 14:20369437-20369459 TGGGTCTGTCCCTGGAGTTTGGG + Exonic
1114557399 14:23569909-23569931 AAGGGCTGTCCCTGCATTGAAGG - Intronic
1114693404 14:24606047-24606069 AGGGCCTGTCCCTCCAATGGGGG - Intergenic
1116402156 14:44521229-44521251 AGGGATTATCCCAGCAGTGTGGG + Intergenic
1119684326 14:76619380-76619402 TTTGACTGTCCTTGCAGTGTAGG - Intergenic
1121350315 14:93168188-93168210 AGGAACAGTCCCTGCAGAGGGGG + Intergenic
1122488051 14:102094885-102094907 AGAGCCTGTCCCTGAAGAGTTGG + Intronic
1202895176 14_GL000194v1_random:2556-2578 AGGGGCACTCCCTGCAGGGTAGG - Intergenic
1123538432 15:21262037-21262059 TGGTACACTCCCTGCAGTGTGGG - Intergenic
1124597473 15:31102768-31102790 AGGGTCTGTCACCGCAGAGTGGG + Intronic
1127599206 15:60518470-60518492 AGGGACTGCCCTTGCAGGGCTGG + Intronic
1127815024 15:62600423-62600445 GTGGACTTTTCCTGCAGTGTTGG + Intronic
1128982434 15:72197452-72197474 AGGGACGGTCCCGGCAGCATCGG - Intronic
1130836509 15:87654966-87654988 AGGGACTGGGCATGGAGTGTAGG + Intergenic
1131252566 15:90839952-90839974 AGGGGACGTCCCTGCAGTGGGGG - Intergenic
1132196408 15:99917560-99917582 AGGGACTGTCCCTCCCGGGAGGG - Intergenic
1132209223 15:100008002-100008024 AGGGACTGCACCTGTAGTGCTGG + Intronic
1132808815 16:1788039-1788061 CGGGACTCACCGTGCAGTGTGGG - Exonic
1135300872 16:21325950-21325972 AGAGCCTGTCCCTGCAGCTTAGG - Intergenic
1136377118 16:29872266-29872288 AGGGACTTTCCCTGAAGCCTGGG + Exonic
1138590744 16:57998471-57998493 AGGGAGGGTCCCAGCAGTGCCGG + Exonic
1140170476 16:72599001-72599023 AGGGACTGACACTGGAGAGTGGG + Intergenic
1141178807 16:81738591-81738613 GGGGACCGTCCGTGCACTGTAGG + Intergenic
1141647198 16:85373846-85373868 AGAGACTGGCCCTGCCGTGGCGG - Intergenic
1142281974 16:89153533-89153555 AGGGGCCGTCCCTGCCGTGCAGG + Intronic
1142697138 17:1639927-1639949 GGGGACTGTGTCTGCAGTGCCGG - Exonic
1143316244 17:6035542-6035564 AGGGACTGTCTCTGCAAGATGGG - Intronic
1144888095 17:18477579-18477601 AGGGACTGTCCCTGCAGTGTGGG + Intronic
1145144110 17:20466724-20466746 AGGGACTGTCCCTGCAGTGTGGG - Intronic
1145760792 17:27424642-27424664 AGAGGCTCTCCCTGCAGGGTAGG + Intergenic
1145791753 17:27631984-27632006 GAGGACTGTCCCTGCAGCGTGGG + Intronic
1145799566 17:27674197-27674219 GGGGACTGTGGCTACAGTGTGGG - Intergenic
1146603811 17:34240794-34240816 AGGGACTGTACTTGGAGTGTAGG + Intergenic
1146724932 17:35148891-35148913 AGAGAGTGTCCCCACAGTGTGGG - Intronic
1147721309 17:42541195-42541217 AGGCACTGTACCTGCAGTCATGG - Exonic
1148615488 17:48997313-48997335 GGGGTCTTTCCCTGCAGGGTGGG + Intergenic
1148953655 17:51335909-51335931 AGGGTCTGACCCTGCAGTGGTGG + Intergenic
1150897690 17:69233541-69233563 AGGGACTGGCCCTAAAGTGATGG - Intronic
1152014465 17:77741320-77741342 AGGTACTTTGCCTGCAGTTTGGG - Intergenic
1152421250 17:80194291-80194313 AGGGACTGTCCTTGGGGTGGGGG - Intronic
1156611195 18:38726762-38726784 AGGGACTTTCTTGGCAGTGTTGG - Intergenic
1159182653 18:64928851-64928873 ATACACTGTCCCTGCAGTGCTGG - Intergenic
1160017313 18:75154631-75154653 AGGGACTGTGCATGCATCGTCGG + Intergenic
1160093997 18:75853963-75853985 AAGGATGGTCCTTGCAGTGTGGG - Intergenic
1161234939 19:3193127-3193149 AGTGACTGTCCCTGGAGGGCAGG - Intronic
1161605419 19:5212245-5212267 CGTGGCTGTCCCTGCAGTGCCGG - Exonic
1161724405 19:5919945-5919967 AGGGGATGTCCCTGCAGGCTGGG - Intronic
1161766976 19:6213540-6213562 AGGGGCTGCCCCTGCAGCCTTGG - Intronic
1164574391 19:29397260-29397282 AGAGTGTGTCCCTGCAGTGGAGG - Intergenic
1164957996 19:32403677-32403699 ATGGACTGTGACTGCAGTGGTGG - Intergenic
1165657135 19:37543993-37544015 AGGGAATGTGTCTGGAGTGTTGG + Intronic
1166675438 19:44738017-44738039 AGGGACTGTCCCTCCTGGATAGG + Intergenic
1166883442 19:45942995-45943017 AGGGACTGACTCTCCATTGTGGG - Intronic
1166939413 19:46353690-46353712 AGGGCCTGTCCTCGCAGGGTTGG + Intronic
1167166887 19:47804625-47804647 AGGGAGGGTCCCGGCAGGGTGGG - Intronic
925086923 2:1115822-1115844 AGGGACAGTCACTGAAGTTTGGG + Intronic
925114470 2:1366813-1366835 AGGAACAGTGCCTGCTGTGTGGG - Intronic
925353100 2:3216379-3216401 AGTCACTGTCACTGCATTGTTGG - Intronic
929128386 2:38541555-38541577 AGGGACTGTCCCGGAACTCTTGG - Intergenic
930933591 2:56919281-56919303 AGGGCCAGTCCCTGCCATGTAGG + Intergenic
932280292 2:70485493-70485515 AGGGACTGTGCCAGCACTTTGGG - Intronic
935233648 2:101120057-101120079 AGGGACCCTCTCTGCACTGTGGG - Intronic
939861568 2:147427370-147427392 AGGGAATGTCCTTCAAGTGTGGG - Intergenic
940878728 2:158924301-158924323 AAGGACAGTCCCTACATTGTAGG + Intergenic
947096210 2:226570129-226570151 AAGGACTTTTCCTGCAGGGTTGG - Intergenic
948197592 2:236107013-236107035 AGGGTCTGGACCTGCTGTGTGGG + Intronic
948675867 2:239596314-239596336 TGTGACTGTCCCTGCAGAGCAGG + Intergenic
1168828907 20:833737-833759 AGGGACTTTCCCTGCGGTGGGGG + Intronic
1169421906 20:5467173-5467195 ACGATCTGTCCCGGCAGTGTAGG - Intergenic
1169984164 20:11423329-11423351 AGGGACTGTGCCTGGAGGGATGG - Intergenic
1170205496 20:13793675-13793697 AAGGATTTTCACTGCAGTGTTGG - Intronic
1170485136 20:16807912-16807934 AGTTCCTGGCCCTGCAGTGTAGG + Intergenic
1170820138 20:19750510-19750532 AGTGATTATCCCTGGAGTGTGGG - Intergenic
1171880837 20:30616600-30616622 AGAGATTGTCCTTGCTGTGTGGG - Intergenic
1172124903 20:32619741-32619763 AGGGGCTTTGCCTGCAGTATTGG + Intergenic
1172246714 20:33450474-33450496 AGGGACTGCCCTTGCAGAGGAGG + Intergenic
1174497928 20:50962267-50962289 ATGGACTGTGGCTGAAGTGTTGG - Exonic
1176614879 21:9018543-9018565 AGGGACACTCCCTGCAGGGTAGG - Intergenic
1177104832 21:16942961-16942983 AGGGAATGTCCCAATAGTGTGGG + Intergenic
1178679189 21:34658104-34658126 AGGGGCTGTCTGTGCATTGTAGG + Intergenic
1179080410 21:38165689-38165711 AGAGACTGTCCCAACACTGTCGG - Intronic
1179523650 21:41961602-41961624 AGGGATGGACCCTGCAGAGTGGG + Intergenic
1179557780 21:42191415-42191437 TGGGACTGTCCCAGCTATGTGGG + Intergenic
1179767605 21:43584779-43584801 AGGGTCTTTCCCAGCAGTGTCGG - Intronic
1179937385 21:44614010-44614032 AGGGACTGCCCCTGCTCTGCTGG + Intronic
1180353097 22:11819809-11819831 ACGGACTCTCGCTGAAGTGTGGG - Intergenic
1180385148 22:12172548-12172570 ACGGACTCTCGCTGAAGTGTGGG + Intergenic
1180985975 22:19904098-19904120 AGGGACTGTCCTCCCAGTCTTGG - Intronic
1182134116 22:27884448-27884470 AGGGAACTTCCCTGCAGAGTAGG - Intronic
1182289697 22:29267986-29268008 AGGGACGGTCGCTGAAGAGTCGG - Intronic
1182466001 22:30516689-30516711 TGTGACTGCCCCTGCAGAGTGGG + Intergenic
1184327483 22:43800192-43800214 AGGGGATGTCCCAGCAGCGTGGG - Intronic
1184586663 22:45452621-45452643 AGAGGCAGTCCCTGCAGTGAGGG + Intergenic
1185159498 22:49214706-49214728 CAGGGCTGTCCCTGCACTGTGGG - Intergenic
1185320613 22:50198740-50198762 GGGAACGGCCCCTGCAGTGTGGG - Exonic
949900402 3:8809987-8810009 AGGGAATCTCTCTGAAGTGTGGG + Intronic
950178755 3:10896080-10896102 AGGCATTGACCCTGCAGTGAAGG + Intronic
951095524 3:18625238-18625260 AGTGTCTAGCCCTGCAGTGTTGG + Intergenic
952644394 3:35638930-35638952 TGGGATTGTCTCTGCAGAGTTGG + Intronic
953668772 3:44945157-44945179 AGTGAGTGTACCTGCAGTGGTGG + Exonic
954444613 3:50540058-50540080 AGGGACTATCCCTGCCCTGCTGG + Intergenic
954451143 3:50572303-50572325 AGGCACTGTCCCTGAAGTCATGG - Intronic
954984407 3:54776827-54776849 ATAGACTATCCCTGCTGTGTGGG + Intronic
957107801 3:75913036-75913058 AGTCACTGTGTCTGCAGTGTTGG + Intronic
958523020 3:95215723-95215745 AGGGACTATCACTGAAGAGTTGG + Intergenic
960932305 3:122865840-122865862 AAGAAATGTCCCTGAAGTGTAGG - Intronic
961012178 3:123443726-123443748 AGGGGTTTTCCCTGCAGTGTGGG - Intronic
961453465 3:127013053-127013075 CTGGTCTGTCCCAGCAGTGTGGG + Intronic
961547831 3:127647783-127647805 AGTGACTGTTCCTGAAGTGCTGG - Intronic
963165847 3:142202485-142202507 AGGGCCTGTCCTGGCAGTGAAGG - Intronic
966609691 3:181855991-181856013 CATGAGTGTCCCTGCAGTGTTGG + Intergenic
968088404 3:195885066-195885088 AGTGACTGACCCTGGGGTGTTGG - Intronic
968253063 3:197240272-197240294 AGGGGATGTCCCAGTAGTGTGGG - Intronic
968960972 4:3743496-3743518 TGGGCCTGCCCCTGCAATGTTGG + Intergenic
969574093 4:8026338-8026360 AGGGCCTGTCCCTACAGCTTTGG - Intronic
973908390 4:55553336-55553358 AGGGCCTATCCCTCTAGTGTTGG - Intergenic
974220769 4:58968276-58968298 AATGGCTGTCTCTGCAGTGTAGG + Intergenic
977438681 4:97035293-97035315 AGGAACTGTCCCTGCCCTGAAGG - Intergenic
977459063 4:97300990-97301012 AGAGACTGACCCTGAAGTGATGG + Intronic
978099755 4:104823768-104823790 AGGGTCAGTCTCTGCAGTTTTGG + Intergenic
978621230 4:110636490-110636512 AGGATTTGTTCCTGCAGTGTTGG + Intronic
980776808 4:137447291-137447313 AGGGAAAGTTCCTTCAGTGTAGG + Intergenic
983197462 4:164823161-164823183 AGAGAGTGACCCTGCAGTGTTGG + Intergenic
983648667 4:170017510-170017532 AGGGACTTTTCCTGCAGTGTTGG - Intronic
984432316 4:179664815-179664837 AGGTACTGCCCCAGCAGAGTGGG - Intergenic
985541587 5:489960-489982 GGGGGCTGTCCGGGCAGTGTGGG - Intronic
986456369 5:7924606-7924628 CCGGACTGTGCCTGCAGTGGTGG - Intergenic
989217379 5:38919226-38919248 TGGGACAGTCCCCTCAGTGTGGG + Intronic
990647311 5:57858938-57858960 ACCAAGTGTCCCTGCAGTGTTGG - Intergenic
991493074 5:67202108-67202130 AGGTACTGTGCTTGCACTGTTGG - Intergenic
992095112 5:73355904-73355926 AATGACAGGCCCTGCAGTGTAGG + Intergenic
992826570 5:80554986-80555008 AGGGGCTGTCCCTCCAGTGTCGG + Intergenic
993034732 5:82744553-82744575 AGGGATTATCCTGGCAGTGTGGG - Intergenic
997362132 5:133301812-133301834 TGGGACTGTTGCTGCAGTGTTGG + Intronic
999653629 5:153791960-153791982 TGGGATAGTCCATGCAGTGTGGG - Intronic
1001332485 5:170772195-170772217 AGGTCCTGACCCTGCTGTGTGGG + Intronic
1002421598 5:179152049-179152071 AGGGACAGGCCCTGAAGTGGGGG - Intronic
1004713148 6:18191530-18191552 GGGGACTGTCTTTGCACTGTAGG + Intronic
1005612086 6:27535993-27536015 ATGGACTCTCCCTGGGGTGTGGG - Intergenic
1005807740 6:29490784-29490806 AGCTACTGTCCCTGGAGTGGTGG + Intergenic
1006115952 6:31776350-31776372 CGGGACTGTCCCTCCTTTGTGGG - Intronic
1006417751 6:33914732-33914754 CGTGACTGTCCCTGCAGAGCCGG - Intergenic
1007040817 6:38720426-38720448 AAGGATTATCCCAGCAGTGTGGG - Intronic
1008060098 6:46988026-46988048 AGGGAATGTCAGTGCACTGTTGG - Intergenic
1008997266 6:57673400-57673422 ATGGACTGCCACTGGAGTGTGGG - Intergenic
1009693484 6:67066707-67066729 AGGGAATATTCCGGCAGTGTGGG + Intergenic
1011195990 6:84779766-84779788 AAGGACTTTCACTGCTGTGTGGG - Intergenic
1011615506 6:89194258-89194280 AGGGATTATCCCGGCAGTGTGGG - Intronic
1013168731 6:107617177-107617199 CTGGAGTGTCACTGCAGTGTGGG + Intronic
1013361129 6:109394791-109394813 AGGGACTGTTCTTGGAGTGATGG + Intronic
1014053987 6:116991535-116991557 AGGGAATCTCGCTGCAATGTTGG + Intergenic
1015804219 6:137092257-137092279 AGTGACTGCTTCTGCAGTGTGGG + Intergenic
1016155368 6:140800276-140800298 AGGGGATATCCCTGCAATGTGGG + Intergenic
1018442829 6:163828803-163828825 AGGGACTGTGCCCTCACTGTTGG - Intergenic
1018856518 6:167678965-167678987 AGGGGCTGGCCCAGCAGTGAGGG - Intergenic
1019060425 6:169253804-169253826 AGAGACCGGCCCTGCAGTGCAGG + Exonic
1019303966 7:323605-323627 AGTTACTGTCCCTGCAGGGCGGG - Intergenic
1022374149 7:29797743-29797765 AAGGACTGTCACTGCAATGTAGG - Intergenic
1025106378 7:56174891-56174913 AGGGGCTGTCCCTGGAGCGCCGG + Intergenic
1026291213 7:69007820-69007842 AGGGACTGTCACTCCAGTGACGG + Intergenic
1027714747 7:81655864-81655886 AGAAAATGTCCCTGCAATGTGGG + Intergenic
1030683069 7:112452414-112452436 AGGCACCGTCCCAGCATTGTGGG - Intronic
1030713391 7:112780696-112780718 AGGGTCTTGCTCTGCAGTGTGGG - Intronic
1032513632 7:132491400-132491422 AGGCACTGTCCCTCCAGAGAAGG + Intronic
1032863763 7:135905659-135905681 AGGCCCTCTCCCTGCAGGGTTGG - Intergenic
1033223063 7:139541581-139541603 TGGGACTTTCCCTGCAGACTGGG - Intronic
1033979292 7:147144106-147144128 AGAGACTGTCCCTTTATTGTGGG + Intronic
1037826663 8:22164352-22164374 AGGGCTTGTCCCTGCGGTGTGGG - Exonic
1040023505 8:42761405-42761427 ATGGACTAGCCCTGCAGTCTCGG + Intronic
1040105199 8:43537720-43537742 AGAGACGGTCCCTGCTGTGCAGG + Intergenic
1042591469 8:70402691-70402713 AGGGCCTGTCCCTTCAGGGGCGG + Intronic
1043321731 8:78995302-78995324 AAGGAATGTCCATGCACTGTTGG + Intergenic
1044993823 8:97820326-97820348 AGGGTCTCTCCCTGTAGTCTAGG + Intronic
1045657800 8:104405128-104405150 AATGACTGTCCCCACAGTGTCGG + Intronic
1047283415 8:123465390-123465412 AGGGAGTTTCTCTGCAGTGACGG - Intronic
1047970452 8:130079901-130079923 AGGGACTATCCCAGCAGTCGAGG - Exonic
1049217499 8:141414913-141414935 AGGGGCTGTTCCTGCAGTCCAGG - Intronic
1049689776 8:143953396-143953418 AGGGGCTGACCCTGCTGTGAAGG + Intronic
1051143326 9:14001728-14001750 AGGCCCTGTCCCTGCATTTTTGG + Intergenic
1052880661 9:33599390-33599412 AGAGACTGTCCTTGCTGTGTGGG + Intergenic
1052956344 9:34255758-34255780 ACGGAGTGTCCCTGCAGTCTTGG + Exonic
1053495312 9:38544820-38544842 AGAGACTGTCCTTGCTGTGTGGG - Intronic
1053666875 9:40323202-40323224 AGAGACTGTCCCTGCTGTGTGGG + Intronic
1053916467 9:42948309-42948331 AGAGACTGTCCCTGCTGTGTGGG + Intergenic
1054328302 9:63728982-63729004 AGAGGCACTCCCTGCAGTGTAGG + Intergenic
1054378027 9:64463230-64463252 AGAGACTGTCCCTGCTGTGTGGG + Intergenic
1054517734 9:66053081-66053103 AGAGACTGTCCCTGCTGTGTGGG - Intergenic
1055152777 9:73022991-73023013 AGGGACTGTCCCTTTAGTTGTGG + Intronic
1055985917 9:82056491-82056513 AGAGACTGTCCATGCTGTGTGGG + Intergenic
1056585423 9:87924642-87924664 AGAGACTGTCCGTGCTGTGTGGG - Intergenic
1056611457 9:88128298-88128320 AGAGACTGTCCGTGCTGTGTGGG + Intergenic
1056887428 9:90456966-90456988 AGAGCCTGTCCCTGCAATGCAGG + Intergenic
1057075392 9:92135741-92135763 AGGGGCTGTCCCTGCGGTGTGGG + Intergenic
1057297654 9:93858977-93858999 AGGAGCTGGCCCTGCAGTGATGG + Intergenic
1057675211 9:97132178-97132200 AGAGACTGTCCTTGCTGTGTGGG - Intergenic
1057745453 9:97747434-97747456 AGAGACTCTCCCTGCAGTGGTGG + Intergenic
1060602972 9:124890283-124890305 AGGGCCTGTCTCTCCAGGGTAGG - Intronic
1061506429 9:131034262-131034284 AGGGACTGCCCCTGCCTTGGAGG - Intronic
1061507699 9:131040824-131040846 AGAGGCTGTGCCTGCACTGTGGG - Intronic
1062239825 9:135530918-135530940 AGTGACTCTACCTGCAGAGTGGG - Intergenic
1186831514 X:13394978-13395000 AGGGGCTGTCCCTCCAGGGTCGG + Intergenic
1186849857 X:13569711-13569733 GGGTGCTGTCCCTGCAGTCTGGG - Exonic
1187182550 X:16956676-16956698 AGGGACAGTTCCTGCAGTCCCGG + Intronic
1192975457 X:76279255-76279277 AGGGATTATCCCAGCAGAGTGGG + Intergenic
1193179938 X:78442633-78442655 TTGGACTCTCCCTACAGTGTAGG - Intergenic
1193227240 X:78998418-78998440 AGGCCCTGCACCTGCAGTGTTGG - Intergenic
1193691027 X:84642731-84642753 AGGGAATGTTTATGCAGTGTTGG + Intergenic
1197260625 X:124313278-124313300 AGGGATTATCCCAGCAGTATGGG - Intronic
1197998701 X:132409344-132409366 AGGGACTGTCCCAGTGGAGTAGG + Intronic
1199091047 X:143692720-143692742 AGGGACTGCCCATGCACTGCAGG - Intergenic
1199245057 X:145594022-145594044 AGGAAATGTCCTGGCAGTGTGGG - Intergenic
1199459549 X:148069497-148069519 AGGGAGTATCCTGGCAGTGTGGG + Intergenic
1200182453 X:154159042-154159064 AGAGGCTTTCACTGCAGTGTGGG + Intergenic
1200188107 X:154196156-154196178 AGAGGCTTTCACTGCAGTGTGGG + Intergenic
1200193757 X:154233296-154233318 AGAGGCTTTCACTGCAGTGTGGG + Intergenic
1200199512 X:154271100-154271122 AGAGGCTTTCACTGCAGTGTGGG + Exonic
1201420741 Y:13795870-13795892 AGGGCCTTTCCATGCAGTATAGG - Intergenic