ID: 1144888168

View in Genome Browser
Species Human (GRCh38)
Location 17:18477853-18477875
Sequence GTGGGGAGGCAGAATGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1750
Summary {0: 1, 1: 2, 2: 13, 3: 202, 4: 1532}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144888154_1144888168 17 Left 1144888154 17:18477813-18477835 CCGAGGGGCTGGAGTGGGTGGGC 0: 2
1: 1
2: 5
3: 53
4: 472
Right 1144888168 17:18477853-18477875 GTGGGGAGGCAGAATGGGGAGGG 0: 1
1: 2
2: 13
3: 202
4: 1532
1144888152_1144888168 18 Left 1144888152 17:18477812-18477834 CCCGAGGGGCTGGAGTGGGTGGG 0: 2
1: 2
2: 5
3: 88
4: 589
Right 1144888168 17:18477853-18477875 GTGGGGAGGCAGAATGGGGAGGG 0: 1
1: 2
2: 13
3: 202
4: 1532

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144888168 Original CRISPR GTGGGGAGGCAGAATGGGGA GGG Intronic
900342832 1:2196945-2196967 GTTGGGAGCCAGAGTGGGGAAGG - Intronic
900518426 1:3094259-3094281 CTGTGGAGGCAGGGTGGGGATGG - Intronic
900792212 1:4688080-4688102 GTGGGGAGCCAGGATGGGGAAGG + Intronic
900804296 1:4757208-4757230 CAGGGGAGGCGGAAAGGGGAGGG - Intronic
900833904 1:4985325-4985347 GTGGGCAGGTAGGATGGTGAGGG - Intergenic
900842668 1:5067110-5067132 ATGGGCTGGCAGAATGGGGCAGG + Intergenic
901192280 1:7419824-7419846 GTGGAGAGGAAGAATGGGGTGGG - Intronic
901451890 1:9340901-9340923 GCGGGGAGGCAGAGTGGGAAGGG + Intronic
901648459 1:10729071-10729093 GTTGGGAGGCAGCTGGGGGAAGG + Intronic
901700582 1:11043152-11043174 TGTGGGAGGCAGAGTGGGGAGGG - Intronic
901779626 1:11585104-11585126 GTGGAGAGGGAGCATGGAGAAGG + Intergenic
901838536 1:11939345-11939367 GTGGGGATGAAGGATGGGGGAGG + Intronic
901961268 1:12828403-12828425 GTGAGGAGGCCCAAGGGGGATGG - Intronic
901967861 1:12883008-12883030 GTGAGGAGGCCCAAGGGGGATGG - Intronic
901975665 1:12942138-12942160 GTGAGGAGGCCCAAGGGGGATGG - Intronic
901983259 1:13053273-13053295 GTGAGGAGGCCCAAGGGGGATGG - Intronic
901998830 1:13175645-13175667 GTGAGGAGGCCCAAGGGGGATGG + Intergenic
902009509 1:13259627-13259649 GTGAGGAGGCCCAAGGGGGATGG + Intronic
902017315 1:13318772-13318794 GTGAGGAGGCCCAAGGGGGATGG + Intronic
902092757 1:13916491-13916513 GTAGGGATGCTGAATGGGTAGGG - Intergenic
902384682 1:16069578-16069600 GTGAGGAGGCAGAGTGGTTATGG + Intronic
902388153 1:16087952-16087974 GTGGGGAGGCACAGGGAGGAGGG - Intergenic
902531793 1:17095372-17095394 GTGGGGGAGCAGAATGGGAGTGG + Intronic
902546526 1:17193867-17193889 GTGGGCATGGAGAATGTGGAGGG + Intergenic
902873741 1:19328883-19328905 GTGAGTAGGCAGAATGAGGTAGG - Exonic
903045845 1:20563606-20563628 GTGGGGATGCAGAGAGGGGAGGG + Intergenic
903135860 1:21308821-21308843 CTGGGCAGGCAGGAAGGGGAGGG - Intronic
903225773 1:21893516-21893538 GTGGGGAGAGAGGATGGGGAGGG + Intronic
903387615 1:22938221-22938243 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
903594279 1:24482297-24482319 GTGGGGGGCCAGGATGGGGGTGG - Intergenic
903935567 1:26892582-26892604 GGGAGCAGGGAGAATGGGGATGG + Intronic
904047656 1:27618183-27618205 GAGGGCAGGCAGGAGGGGGACGG + Intronic
904115725 1:28160536-28160558 GGGGGGAGGCAAGGTGGGGATGG - Intronic
904128685 1:28260103-28260125 GAGGGGAGACAGAGTGGGGGAGG - Intronic
904616368 1:31752399-31752421 GTGAGGAGGCAGGGTGGGGGCGG - Intronic
904880011 1:33689212-33689234 CTGGGGTGGGAGAATGAGGAAGG + Intronic
905038228 1:34930546-34930568 GTGGGGAAGCCGCAGGGGGAGGG + Intergenic
905106366 1:35565751-35565773 TTGGGGAGGAAGTCTGGGGAGGG - Exonic
905121878 1:35688717-35688739 TTGAGGAGGGAGAGTGGGGAAGG + Intergenic
905226439 1:36482078-36482100 GTGGGGAGGGAGGAGGGGGCTGG + Intronic
905310688 1:37046903-37046925 GTGGGGGGTCAGAAGGAGGAGGG + Intergenic
905869282 1:41394039-41394061 GCTGGGAGGCAGAAAGGTGAGGG - Intergenic
906280407 1:44549598-44549620 ATGGGGAAGCAGAACTGGGAGGG - Intronic
906601839 1:47137367-47137389 GTGGGGAGAGTGAAGGGGGAGGG - Intergenic
906678041 1:47707809-47707831 GTGGGGTGGAAGACTTGGGATGG + Intergenic
906751580 1:48267498-48267520 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
906766686 1:48440509-48440531 GTGGGGATTCATACTGGGGATGG - Intronic
906908495 1:49921089-49921111 GTGGGGTGGGAGTATGGGGGAGG + Intronic
906953205 1:50350783-50350805 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
907132271 1:52107632-52107654 GGGAGGAGGGAGAATGGGAAAGG - Intergenic
907236555 1:53054543-53054565 GTGGGGGGCAAGAGTGGGGAGGG - Intergenic
907236799 1:53056824-53056846 TTGGGGAGGCAGAAGGTGGGAGG - Intergenic
907398439 1:54208848-54208870 GTGGGGAGTTGGGATGGGGAGGG + Intronic
907426120 1:54380283-54380305 GTGAGGAGGAACCATGGGGAGGG - Intronic
907491301 1:54810570-54810592 CTGGGGAAGCAGGATGGGGCGGG - Intronic
907842349 1:58170159-58170181 GTGGGGATCCATACTGGGGATGG - Intronic
907979475 1:59467347-59467369 GTGGGGTGGGGGAATGGGGGAGG + Intronic
908059616 1:60333459-60333481 GTGGGGAGCTAGAAAGGGGCTGG - Intergenic
908182391 1:61618883-61618905 ATGGGCAGGCAGAAGGGGGAGGG + Intergenic
908339421 1:63161306-63161328 GTGGGGAGACAGATTGGGGCTGG + Intergenic
908393946 1:63708013-63708035 GTGGGGAGACAGAATTTGGCTGG - Intergenic
908556291 1:65259789-65259811 GAGGGGTGGGAGGATGGGGAGGG + Intronic
908579842 1:65502960-65502982 GTGAGCAGGCAAAATGGGGGAGG + Intronic
908904760 1:68995401-68995423 GGGTGGGGGCACAATGGGGAGGG + Intergenic
908978166 1:69922959-69922981 GTGGGGTGGCAGGAGGGGGGAGG - Intronic
909359413 1:74743687-74743709 GTGGGGAGCCATACTGGGGATGG + Intronic
909380520 1:74992464-74992486 GTGGGGTGGGAGGAGGGGGAGGG + Intergenic
909636950 1:77827364-77827386 CTTGGGAGGCTGAGTGGGGAGGG + Intronic
909663608 1:78110036-78110058 GTGGGGTGGGGGAAGGGGGAGGG + Intronic
909723586 1:78807067-78807089 GTGAGGAGGCAGGAGGGGGGTGG + Intergenic
909770917 1:79420138-79420160 GTGGGGTGCCGGAAGGGGGAAGG + Intergenic
910057458 1:83049746-83049768 GTGGGGTGGCGGAATGGAGGAGG + Intergenic
910397440 1:86806638-86806660 GTGGGGATCCATAGTGGGGATGG + Intergenic
910682928 1:89885835-89885857 CTGTGGAGGCAGAATGGGCAAGG + Intronic
910730054 1:90385286-90385308 CTGAGAAGGCAGCATGGGGAAGG + Intergenic
910823093 1:91372586-91372608 GTGGGTGGGGTGAATGGGGAGGG + Intronic
910840680 1:91558426-91558448 TTGGGGAGGGGGAAGGGGGATGG - Intergenic
911019644 1:93374089-93374111 GTGGGGAGGATGATTGGGGAAGG - Intergenic
911430028 1:97773781-97773803 ATGGGGAGCTAGAAGGGGGATGG - Intronic
911764448 1:101657004-101657026 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
912021304 1:105111540-105111562 GTGGGGATCCATACTGGGGATGG - Intergenic
912065193 1:105730017-105730039 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
912214032 1:107586698-107586720 GTAGGAAGGAAGCATGGGGAAGG + Intronic
912252953 1:108030071-108030093 GTGGGCAGGCAGAATCAGTAAGG + Intergenic
912387679 1:109280358-109280380 GTAGGGAGACAGGATGGGCAAGG + Intronic
912424306 1:109573024-109573046 GTTGAGAGTCAGAATTGGGAGGG + Intronic
912613499 1:111073667-111073689 ATGGGGTGGGGGAATGGGGAGGG - Intergenic
912776088 1:112507481-112507503 GTGGGCGGGCAGAGTGGGAAGGG - Intronic
912875565 1:113355199-113355221 CTTGGGAGGCAGAAGTGGGAGGG - Intergenic
912890692 1:113526509-113526531 GTGGGTATGCAGTATGGAGAAGG + Intronic
912913738 1:113790157-113790179 GTGGGGAGTGGGAATGGAGAAGG + Intronic
912974972 1:114321317-114321339 GTGGGGAGGCAGAGAGAGTAGGG + Intergenic
913219774 1:116650045-116650067 GTGGTAAGGCAGAAAGGAGAGGG - Intronic
913314937 1:117541606-117541628 GTGGGGAGGCCCAAGGGAGACGG + Intergenic
913322918 1:117601949-117601971 GTAGGGATCCAGAAGGGGGATGG - Intergenic
913452215 1:119000082-119000104 GTGGTGAGGAAGAGTGGGGTGGG + Intergenic
913469525 1:119174819-119174841 GTGGGGATCCATACTGGGGATGG - Intergenic
914542820 1:148632287-148632309 TTTGGGAGGCAGAAGTGGGAGGG + Intronic
914818852 1:151084152-151084174 TTAGGGAGGCAGAAGTGGGAGGG - Intronic
915167578 1:153957128-153957150 GTGGGGAGGCAAATCTGGGAGGG - Intronic
915260571 1:154674010-154674032 GTGGGGATCCATACTGGGGATGG - Intergenic
915293433 1:154902068-154902090 TGGGGGAGTCAGTATGGGGATGG + Intergenic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
915835697 1:159173087-159173109 GTGGGGAGAGTGAAGGGGGAGGG + Intronic
916058326 1:161082973-161082995 GTGGGGAGGCAGCAGGTGGTTGG - Intronic
916114439 1:161475087-161475109 GTGGGGATCCATACTGGGGATGG - Intergenic
916502160 1:165396508-165396530 GTGGGGAGGGAGAGCTGGGAGGG - Intergenic
916939534 1:169664531-169664553 GTGGGGATCCATACTGGGGATGG - Intronic
917086135 1:171307373-171307395 GTGGGGATCCATACTGGGGATGG - Intergenic
917279884 1:173370371-173370393 GTGGGGATCCATACTGGGGATGG - Intergenic
917281162 1:173379232-173379254 GTGGGGATCCATACTGGGGACGG - Intergenic
917445790 1:175104995-175105017 GTGGGGATCCATACTGGGGATGG + Intronic
917485480 1:175451362-175451384 GTGGGGTGGGGGAAGGGGGAAGG - Intronic
917661606 1:177182025-177182047 GTGCGGAGAAGGAATGGGGAGGG + Intronic
917731477 1:177879283-177879305 GTTTTGAGGAAGAATGGGGAGGG + Intergenic
917925716 1:179787717-179787739 GTCTGGTGGCAGAATGGAGAAGG + Intronic
917965864 1:180178184-180178206 GTGGGGAGGGGGACTGGGAAGGG - Intronic
918048647 1:180956005-180956027 GGAGGGAGGGAGAAAGGGGAAGG - Intergenic
918135539 1:181670745-181670767 GTGGGGTGGGGGCATGGGGAAGG - Intronic
918188141 1:182145593-182145615 GTGGGGAGACAGAAAGAGGAAGG + Intergenic
918216317 1:182394486-182394508 GTGGGGGTGAAGAATGGGGGCGG - Intergenic
918405282 1:184206278-184206300 GTTGGGAGGAGGAAAGGGGAGGG - Intergenic
918457107 1:184732323-184732345 GTGGGGATGGGGAATAGGGAGGG + Intronic
918606827 1:186437601-186437623 GTGGGGTGGCGGGAGGGGGAAGG - Intergenic
918725611 1:187918097-187918119 TTGGAGACTCAGAATGGGGAGGG + Intergenic
918809284 1:189094445-189094467 CTGGGGAGCCAGAAGGGAGATGG - Intergenic
918967627 1:191372630-191372652 GTGGGGTGGGGGAATGGGGGAGG - Intergenic
919048162 1:192480347-192480369 ATGGGGAGCTAGAAGGGGGATGG - Intergenic
919110888 1:193217436-193217458 TAGGGGAGCCAGAAAGGGGATGG + Intronic
919199891 1:194342756-194342778 ATCGGGAGACAGAAGGGGGATGG - Intergenic
919207506 1:194436862-194436884 GTGGGAAGGCCGAAAGTGGATGG + Intergenic
919492261 1:198219540-198219562 TTGGAGACTCAGAATGGGGAAGG + Intronic
919558658 1:199092779-199092801 GTGGGGATCCATACTGGGGATGG - Intergenic
919582497 1:199394010-199394032 GGGAGGAGGGAAAATGGGGATGG - Intergenic
919804307 1:201371987-201372009 GTGGAGAGCCAGAAAGGGGCAGG - Intronic
920086469 1:203421307-203421329 GAGGGGAGGGGGAAAGGGGAGGG + Intergenic
920108129 1:203568924-203568946 CTGAGGAGGCAGCCTGGGGAAGG - Intergenic
920297443 1:204967632-204967654 GTGAGGAGGCAGAATGGTCTTGG + Intronic
920497325 1:206464572-206464594 GTGGGGAGGGAGAAGGTGGCTGG - Intergenic
920756452 1:208738385-208738407 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
920923201 1:210315527-210315549 GTGTGGCGGCAGAAGGGAGAAGG - Intergenic
921019703 1:211224708-211224730 GTGGGGATCCATACTGGGGATGG - Intergenic
921063443 1:211606169-211606191 CTGGGGAGGAAAAATGGAGATGG - Intergenic
921221714 1:212978371-212978393 ATGGGGAGAAAGACTGGGGAAGG + Intronic
921403533 1:214753476-214753498 ATGGGGAGCCAGAAGAGGGATGG - Intergenic
921582900 1:216915442-216915464 GTGGAGAGGAAGAAGGGAGAAGG + Intronic
921977885 1:221222221-221222243 GTGGGGAAGCAGAATGTGTAGGG + Intergenic
922022160 1:221716307-221716329 TTTGTGAGACAGAATGGGGAGGG - Intronic
922223761 1:223627926-223627948 GTGGGGAGGCAGACGTGGGAGGG + Intronic
922419513 1:225450033-225450055 TTGGGGAGGCAGGATGGTGCAGG + Intergenic
922689440 1:227676663-227676685 GTGGGGAGGGGGAGGGGGGAGGG - Intronic
922802798 1:228371869-228371891 TTGGGGTGGCAGAAAGGGGCTGG - Exonic
922814776 1:228440766-228440788 GTTGGGAGGCAGAGGTGGGAGGG - Intergenic
923026916 1:230211663-230211685 CTTGGGAGGCTGAAAGGGGAGGG + Intronic
923631109 1:235649940-235649962 GTGGGGGCCCAGACTGGGGAAGG + Exonic
923853228 1:237819574-237819596 TTTGGGAGGCTGAAGGGGGATGG + Intronic
923993268 1:239463831-239463853 GCGGGGAGAAAAAATGGGGAGGG - Intronic
924095815 1:240549746-240549768 TTGGCAAGGCAGAAAGGGGAAGG + Intronic
924286008 1:242487060-242487082 GTGGGGTGGCAGCAGGGGGGAGG + Intronic
924493225 1:244560407-244560429 GTGGGGGGGCAGGATGGGAGTGG + Intronic
924718740 1:246603766-246603788 CTAGGGAGGCAGTAGGGGGATGG + Intronic
1062801982 10:387646-387668 GTGGACAGACAGTATGGGGAGGG + Intronic
1063120663 10:3103690-3103712 GGGGTGAGGCAGAATGGCCATGG - Intronic
1063191289 10:3697222-3697244 CTGGGGAGGAGGAATGAGGATGG - Intergenic
1063233245 10:4086728-4086750 CGGGGGAGGCAGAAGAGGGACGG - Intergenic
1063301434 10:4852595-4852617 GTGGGGTGGCACAGTGGTGAAGG - Intergenic
1063321693 10:5057716-5057738 GTGGGGATCCATACTGGGGATGG + Intronic
1063338544 10:5240736-5240758 GTGGGGTGGGGGGATGGGGAAGG + Intergenic
1063434268 10:6017980-6018002 GGGGGGAGGCAGGGTGGGGCTGG + Intronic
1064389288 10:14927572-14927594 GTGGGGGGGGAGAAAGGAGAGGG + Intronic
1064501789 10:15981570-15981592 GTGGGGTGGGGGAATGGGGGAGG - Intergenic
1064603560 10:17016324-17016346 GTGGGGATCCATACTGGGGAAGG + Intronic
1064795547 10:19007584-19007606 GGAGGGAGGGAGAGTGGGGAGGG - Intergenic
1065044979 10:21739090-21739112 GTGGGGTGTCAGAGTGAGGATGG - Intronic
1065308282 10:24389400-24389422 GTGGGGTGGGGGAATGGGGGAGG + Intronic
1065647357 10:27849401-27849423 GTGGGGTGGGAGGAGGGGGAGGG + Intronic
1065810036 10:29433864-29433886 GTGGGGGGTGGGAATGGGGATGG - Intergenic
1065908175 10:30278122-30278144 GTGGGTAGGGAGAAAGGGGAGGG + Intergenic
1066164893 10:32776130-32776152 GTGGGGTGGGGGAATGGGGGAGG + Intronic
1066184295 10:32994233-32994255 GTGGGGAGGCAGAATATCAAAGG - Intronic
1066502551 10:36008253-36008275 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
1066594173 10:37030601-37030623 GTGGGGTGGGGGAAGGGGGAAGG + Intergenic
1066614565 10:37282110-37282132 GTGGGGATCCATACTGGGGATGG + Intronic
1066693773 10:38060273-38060295 CTGTGGAAGCAGAGTGGGGATGG - Intronic
1066999044 10:42588869-42588891 CTGTGGAAGCAGAGTGGGGATGG + Intronic
1067204054 10:44198666-44198688 GTGTGTGGGCAGAGTGGGGAGGG + Intergenic
1067256284 10:44645626-44645648 GTGGGGTGGGGGAAAGGGGAGGG + Intergenic
1067300967 10:45009315-45009337 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1067419764 10:46135134-46135156 GTTAGGAGGCGGCATGGGGAGGG + Intergenic
1067426254 10:46214277-46214299 GTTAGGAGGCGGCATGGGGAGGG - Intergenic
1067473825 10:46553705-46553727 TTGTGGAGGGGGAATGGGGAAGG - Intronic
1067505115 10:46841731-46841753 GTTAGGAGGCGGCATGGGGAGGG + Intergenic
1067616553 10:47762220-47762242 GTGGGGAGGAAGAGGGGGCAAGG + Intergenic
1067660540 10:48233776-48233798 GTGGGGAGGATGAAGGGGCAGGG - Intronic
1067693720 10:48520561-48520583 GAGGGGAGGAACAATGGGCAGGG + Intronic
1067745536 10:48933020-48933042 GTGGGGAGGCAGCAGAGGCAGGG + Intronic
1067769273 10:49111656-49111678 GTGGAGAGGTACAACGGGGAGGG - Intronic
1067968853 10:50945991-50946013 TTAGGGAGGCAGAAAGAGGATGG - Intergenic
1068057055 10:52024471-52024493 GTGGGGTGGGGGAATGGGGGAGG - Intronic
1068404939 10:56575702-56575724 GTGGGGATCCATATTGGGGATGG + Intergenic
1068500323 10:57835200-57835222 GTGGGGATCCATACTGGGGATGG - Intergenic
1069304069 10:66946743-66946765 GTGGGGAGAGAAAATGGGGAGGG - Intronic
1069365077 10:67687917-67687939 GTGGGGATCCATACTGGGGATGG + Intronic
1069620381 10:69833870-69833892 TTGGGGAGGCAGACCGTGGAGGG + Intronic
1069718470 10:70535416-70535438 GGGGGGAGGAGGAAGGGGGAAGG - Intronic
1069840820 10:71338209-71338231 GTGGGTGGGCAGCATGGGGCAGG - Intronic
1069895582 10:71678462-71678484 TGGGGTAGGCAGCATGGGGAAGG - Intronic
1069944869 10:71978899-71978921 ATGGGGAGGCATCCTGGGGAGGG - Intronic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070030671 10:72674173-72674195 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1070150105 10:73800202-73800224 GAGGGGAGGCACACTGGGCAGGG + Intronic
1070311359 10:75276122-75276144 GTGGGGACGCAGGAGGGGCAGGG + Intergenic
1070363845 10:75716997-75717019 ATGGGGAGAGAGAAAGGGGATGG - Intronic
1070681354 10:78451538-78451560 GTGGGGAGGCAGGAGGGATATGG - Intergenic
1070683041 10:78462431-78462453 GGAGGGAGGCAGGATGGGGCAGG + Intergenic
1070702454 10:78613529-78613551 GAGGGGAGGGGGAATAGGGAAGG + Intergenic
1070710291 10:78676635-78676657 GTGGGGTGGCAGGAGGGGGGAGG - Intergenic
1070729233 10:78813856-78813878 GGATGGAGGCAGAATGGGGCAGG - Intergenic
1071111673 10:82164758-82164780 GTGGGGAGCTAGTTTGGGGAAGG + Intronic
1071606949 10:87000916-87000938 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
1071834870 10:89408885-89408907 GTGGGGATCCATAATGGGGATGG - Intronic
1071880526 10:89892186-89892208 GTGGGTAAGCAGAAGGGAGAAGG - Intergenic
1071893797 10:90041989-90042011 GATGGGAGCCAGAATGGGGATGG + Intergenic
1072108022 10:92291830-92291852 TTGGGGAGGGGGAAGGGGGAGGG - Intronic
1072371647 10:94770856-94770878 GTGGGGATCCATACTGGGGATGG + Intronic
1072388247 10:94955063-94955085 GTGGGGTGGCAGAGTGGGGAGGG - Intronic
1072410322 10:95196001-95196023 CTGGGAAGGCAGAATGGGTGGGG - Intronic
1072444979 10:95491252-95491274 TTGGGAAGTCAGAGTGGGGAAGG - Intronic
1072610486 10:97014347-97014369 GTGGGGAGGCTAAAAGGAGATGG + Intronic
1072801414 10:98394798-98394820 GTGGAGAGGTAGAAGAGGGAAGG + Intronic
1072807868 10:98435948-98435970 GTGGTTAGGAAGAATGGGGAGGG + Intronic
1072808804 10:98444236-98444258 GTGGGGAAGGAGATTTGGGAGGG - Intronic
1072897177 10:99376991-99377013 GTGGGGAGGAAGAAGGGGGAGGG - Intronic
1072976221 10:100061095-100061117 GGGGGTGGGGAGAATGGGGATGG + Intronic
1073348427 10:102801922-102801944 GGGGGGAGGAAAAGTGGGGAGGG - Intronic
1073584111 10:104692201-104692223 GTGGGGATGCAGAGTGTGGGAGG + Intronic
1073585336 10:104704531-104704553 GTGAGGAGGGAAACTGGGGATGG + Intronic
1073588857 10:104736922-104736944 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1074163755 10:110857020-110857042 GGGGGGAGGGGGAAGGGGGAAGG + Intergenic
1074252915 10:111770616-111770638 GTGGGGTGGGGGGATGGGGAGGG + Intergenic
1074742638 10:116499924-116499946 GTGGGGATCCATACTGGGGATGG + Intergenic
1074831102 10:117250037-117250059 GTGGGGAAGCAGAAAGGGTTTGG + Intronic
1075473992 10:122717572-122717594 GTGGGGAGAGAATATGGGGAGGG - Intergenic
1075592858 10:123705029-123705051 CTGGGCAGGCGGGATGGGGAAGG + Intergenic
1075606240 10:123812821-123812843 GTGGGGATGGGGGATGGGGAAGG - Intronic
1075680636 10:124328755-124328777 GTGGGGAGGCAGAAAAGTGATGG - Intergenic
1075772189 10:124948655-124948677 GTGGGGAGGGATAATGGACAGGG - Intronic
1075808273 10:125205639-125205661 GTGGGGAGGCTGGACAGGGAAGG + Intergenic
1075992113 10:126846798-126846820 GTGGGGAGTCAGGACGGGGATGG - Intergenic
1076221947 10:128740889-128740911 GTGGGGTGGCAGAAGGAGGCTGG + Intergenic
1076305013 10:129460038-129460060 GTGAGGATGCAGAAAGAGGATGG + Intergenic
1076320614 10:129578532-129578554 GTGGGGTGGGAGGAGGGGGAGGG + Intronic
1076348460 10:129797110-129797132 GTGTGGAGGCAGAGTGGTGCTGG - Intergenic
1076412488 10:130262041-130262063 CTGGGGAGGCAGAACCGGGCAGG - Intergenic
1076598913 10:131644534-131644556 GTGGAGAGGCAGCACGGAGAGGG + Intergenic
1076613187 10:131738949-131738971 GTGGGGAGGGAGCATGGGGTGGG - Intergenic
1076732044 10:132444043-132444065 GTGGGGAGGGAGTGAGGGGAGGG - Intergenic
1076944757 10:133638184-133638206 GTGGGGAGAGAGAATGGGCCGGG - Intergenic
1077045681 11:544244-544266 GTGTGGAGGCAGCTTGGGGGTGG + Intronic
1077091265 11:779399-779421 GAGGGGAAGAGGAATGGGGAGGG - Intronic
1077135892 11:998325-998347 GCGGGGGGTCAGAATGGGGGCGG - Intronic
1077230214 11:1455325-1455347 CTGGGGAGGCAGGCTGGGGGCGG - Intronic
1077485068 11:2834858-2834880 GTGGGGAGGGAGACTTGGGATGG - Intronic
1077555481 11:3224021-3224043 GAGGGGAGGGGGAATGTGGATGG + Intergenic
1077712440 11:4550836-4550858 GTGGGGAGCTGGAAAGGGGATGG - Intergenic
1077712978 11:4554366-4554388 GTGGGGAGCCGGAAAGGGGATGG - Intergenic
1078113927 11:8426178-8426200 ATGGGGAGCCAGAAGGGAGATGG + Intronic
1078129080 11:8596977-8596999 GGAGGGAGGCAGAGAGGGGAGGG + Intergenic
1078143784 11:8709591-8709613 GTGGGGAGGTAGAATGCCCATGG - Intronic
1078159417 11:8827964-8827986 GTGGGGAGGGGGAACGGGGGTGG + Intronic
1078473569 11:11611379-11611401 GTGGGCAAGGAAAATGGGGAAGG + Intronic
1078812635 11:14783608-14783630 GTGGGGTGGGGGAGTGGGGAGGG + Intronic
1078826013 11:14930870-14930892 GTGGGGAGGCTAAAAGGGAATGG + Intronic
1078879828 11:15437140-15437162 TTGGGGAGGGAAAGTGGGGAAGG + Intergenic
1078898096 11:15615928-15615950 GTGGGGATGCAGAAGGCAGAAGG - Intergenic
1079081135 11:17414476-17414498 GGAGGGAGGCAGGATGTGGAGGG - Intronic
1079174491 11:18126633-18126655 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1079688886 11:23397996-23398018 GTGGGGAGGATGATTGGTGAGGG - Intergenic
1079731204 11:23939069-23939091 GTGGGGATCCATACTGGGGATGG + Intergenic
1079804763 11:24916476-24916498 GTGGGGTGGCAGGAGGGGGGAGG - Intronic
1079811646 11:25004793-25004815 GTGGGGATCCATACTGGGGATGG + Intronic
1080168332 11:29267665-29267687 GTGGGGTGGCGGGAGGGGGAGGG + Intergenic
1080456906 11:32427017-32427039 GAGGGGAGGGAGGATGGGGATGG + Intronic
1080643172 11:34169825-34169847 GGGGGAGGGCAGGATGGGGACGG - Intronic
1080759919 11:35238447-35238469 GTGGGGAGTGGGAATGGGAATGG + Intergenic
1081033446 11:38114002-38114024 GTGGGGATCCATAATGGGGACGG - Intergenic
1081146013 11:39563189-39563211 GTGGGGATCCATACTGGGGATGG - Intergenic
1081192775 11:40124673-40124695 GTGGGGAGGCAAAGGAGGGATGG + Intronic
1081421440 11:42877483-42877505 GTGGGGATCCATACTGGGGATGG - Intergenic
1081633184 11:44703027-44703049 GTGGGGAGGTGGGGTGGGGATGG + Intergenic
1081713068 11:45230412-45230434 GTGGGGAAGTGGAATGGGGCTGG - Intronic
1081737015 11:45411331-45411353 GAGAGGTGGGAGAATGGGGAAGG - Intergenic
1081789956 11:45775532-45775554 GAAGGGAGGCAGAGAGGGGAGGG - Intergenic
1081805387 11:45887131-45887153 GTGGGGAGGCAGTATTTGCATGG - Intronic
1082207985 11:49462252-49462274 GGGGGGAGGGGGAAGGGGGAGGG - Intergenic
1082668540 11:56005622-56005644 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
1082710365 11:56547301-56547323 ATGGGGAGCCAGAAAGGGGACGG - Intergenic
1082897280 11:58205277-58205299 TCAGGGAGGAAGAATGGGGATGG - Intergenic
1082915682 11:58433904-58433926 GTGGGGAGGGGGGAGGGGGAGGG + Intergenic
1083047821 11:59752671-59752693 GTGGGGTGGGGGAACGGGGAGGG - Intronic
1083154936 11:60816641-60816663 TTGGGGAGGTACAATGGGAAGGG + Intergenic
1083318060 11:61828378-61828400 GTCGGCAGGCAGCATGGGGAAGG + Exonic
1083533782 11:63449927-63449949 GGGGGTGGGCAGAAAGGGGAGGG - Intergenic
1083729100 11:64643365-64643387 GGGGGGCGGGAGAAGGGGGAAGG + Intronic
1083857700 11:65401311-65401333 CTGGGGAGGGAGGCTGGGGAGGG - Intronic
1083892020 11:65600184-65600206 GTGGGTGGGCAGAAGGGGCAGGG - Intronic
1083920357 11:65778984-65779006 GTGGGGAGCCAGCATGGGCCGGG + Exonic
1084420759 11:69059387-69059409 GCGGGGACCCAGAATGGGGGAGG + Intronic
1084557860 11:69885629-69885651 TGGGGAAGGCAGAATGGGGAGGG + Intergenic
1084557879 11:69885685-69885707 TGGGGAAGGCAGAATGGGGAGGG + Intergenic
1084557897 11:69885727-69885749 GGGGGAGGGCAGAAGGGGGAGGG + Intergenic
1084557902 11:69885741-69885763 GGGGGAGGGCAGAGTGGGGAGGG + Intergenic
1084753594 11:71220764-71220786 CTGGGGAAGAGGAATGGGGAGGG + Intronic
1084767972 11:71324838-71324860 GTGGGGAGCAAGAATGAGGCAGG + Intergenic
1085829083 11:79880523-79880545 GTGGGGGTGCAGAATGGGCATGG + Intergenic
1086317405 11:85609005-85609027 GTGGGGATCCATACTGGGGATGG - Intronic
1086723650 11:90153010-90153032 GTGGGAAGGAAGAGTTGGGAGGG - Intronic
1086931670 11:92700258-92700280 GTGTAAAGGCAGAGTGGGGATGG + Intronic
1086978956 11:93172587-93172609 GTGGGGTGGGGGGATGGGGAGGG - Intronic
1087075015 11:94120692-94120714 GTGGGGATCCATACTGGGGATGG - Intergenic
1087335526 11:96839605-96839627 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1087677090 11:101175682-101175704 GTGGGGAGCCAGAAAGGGGATGG - Intergenic
1087762069 11:102111495-102111517 GTGGGGAGGAAGGAAGGGGGTGG + Intronic
1087774314 11:102243550-102243572 GGGAGGAGGGAGAAGGGGGAAGG + Intergenic
1087908901 11:103729916-103729938 GTGGAGAGGAAGAAGGGGGGTGG + Intergenic
1088081592 11:105923049-105923071 CTGGGGGGTTAGAATGGGGAAGG - Intronic
1088273663 11:108061640-108061662 GAAGGGAGGCAAAACGGGGAGGG - Intronic
1088324655 11:108589316-108589338 GAGGGCAGGCAGAATGTGTAGGG + Intronic
1088416845 11:109598525-109598547 GTGGGGTGGGTGAGTGGGGAGGG + Intergenic
1088492560 11:110401893-110401915 GTGGGGATCCATACTGGGGATGG - Intergenic
1088520043 11:110687459-110687481 ATAGGGAGGCAGTGTGGGGAAGG + Intronic
1088553021 11:111033794-111033816 TTGGAGACGCAAAATGGGGAGGG + Intergenic
1088710634 11:112505442-112505464 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1088718915 11:112574791-112574813 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1088848560 11:113687706-113687728 GTGGAGAGGGAGAGTGGAGAGGG + Exonic
1089141601 11:116289128-116289150 GTGGTGTGGCAGAGAGGGGAGGG + Intergenic
1089293013 11:117449887-117449909 GAGGGAAGGGAGGATGGGGATGG - Intronic
1089454504 11:118618191-118618213 TTGGGGAGGGAAAATGGGAAGGG - Intronic
1089499171 11:118922675-118922697 GGGAGGGGGCAGAAGGGGGATGG - Intronic
1089528310 11:119110978-119111000 GAGAAGAGGCAGAACGGGGAGGG + Intronic
1090043322 11:123309784-123309806 GGGTGGAGGCAGCCTGGGGAAGG + Intergenic
1090224683 11:125063057-125063079 GTGGTGAGGCAGAAAGTGCAGGG + Intronic
1090257043 11:125292149-125292171 CTGGGGAGGCGGACTGGAGAGGG - Intronic
1090940561 11:131384472-131384494 GTGGGGCGGAACAATGGGGTGGG + Intronic
1091312446 11:134584405-134584427 GTGGGGAGGCAGCAGGGGGGTGG - Intergenic
1091872738 12:3908473-3908495 GTGGGGAAGGAGATGGGGGAAGG - Intergenic
1092205779 12:6613623-6613645 ATGGTGGTGCAGAATGGGGAGGG - Intergenic
1092283969 12:7118140-7118162 GTGGGGAGACAGGCTGGGGTGGG + Intergenic
1092472324 12:8790780-8790802 GTGGGGATCCATACTGGGGATGG - Intergenic
1092479106 12:8844223-8844245 GTTGGGAGGGAGAGTGGGGAGGG + Intronic
1093345267 12:18033793-18033815 GTGGGGATCCATACTGGGGATGG - Intergenic
1093580560 12:20780779-20780801 GTGGGGATCCATACTGGGGATGG + Intergenic
1094084737 12:26577014-26577036 GGGGGAAGGCAGAAGGTGGAAGG - Intronic
1094111395 12:26866458-26866480 CTGGGGAGGCTGAAGTGGGAGGG - Intergenic
1094131754 12:27082313-27082335 GACGGGAGGCAGAAAGTGGATGG + Exonic
1094174949 12:27531690-27531712 GTGGGGAGTCTGAAAGGGGGAGG + Intronic
1094338085 12:29383247-29383269 GTGGGGATCCATACTGGGGATGG + Intergenic
1094406473 12:30121538-30121560 ATGGGGAGCCAAAAGGGGGATGG - Intergenic
1095348262 12:41179084-41179106 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
1095415548 12:41973306-41973328 GTGGGGTGGGAGAGTGGGGAGGG - Intergenic
1095578190 12:43763699-43763721 GAGGGGAGGGAAAATGGGGGTGG - Intronic
1095957208 12:47813629-47813651 GTGCGGAGACAGGGTGGGGATGG + Intronic
1095982537 12:47981435-47981457 GTGGGGAGGCAGAGTGGGAGAGG + Intronic
1096423569 12:51481551-51481573 GTGGGGAGACAGCAGGGGGCAGG + Intronic
1096487808 12:51995296-51995318 GTGGGGAGGGAGTCTGGGGTGGG + Intronic
1096775099 12:53958812-53958834 CTGGGGAGGCAGCTAGGGGAAGG - Exonic
1096777756 12:53974323-53974345 GTGGAGGGGGAGAAAGGGGAGGG + Intronic
1096813002 12:54183522-54183544 GTGTTGAGACAGAATGGGGCGGG + Intronic
1096848640 12:54421315-54421337 GTGGGGAGGAGGACTGGGGCAGG - Intergenic
1097050427 12:56219907-56219929 CTGAGGAGGCTGAAGGGGGAAGG + Intronic
1097131128 12:56811347-56811369 GGGGGAAGCCAGAAAGGGGATGG + Intergenic
1097166605 12:57089445-57089467 GTGGGGAAGCAGGACGGGGGTGG + Intronic
1097188471 12:57208375-57208397 GGGCAGAGGCAGCATGGGGAGGG - Intronic
1097300228 12:58010131-58010153 GTGGGGGTGCAGAATGATGATGG + Intergenic
1097327085 12:58289104-58289126 CGGGAGAGGCAGACTGGGGAGGG + Intergenic
1097701736 12:62827465-62827487 GTGGGAAGGCTGACTTGGGAAGG - Intronic
1097782525 12:63724513-63724535 GTGAGAAGGCAGATTGGGGTAGG + Intergenic
1097787428 12:63776908-63776930 GTGGGGGAGGAGAGTGGGGATGG + Intergenic
1098032073 12:66265471-66265493 GTGGGGAGGCAGCAAGGGGCAGG - Intergenic
1098141418 12:67453673-67453695 CTGGCGCGGCAGAATGAGGAGGG + Intergenic
1098384370 12:69903439-69903461 GCGGGGAGGCAGAGTGGTTAGGG + Intronic
1098384462 12:69904168-69904190 GTGGGGAGACAGAAAGGAAAAGG - Intronic
1098450844 12:70616703-70616725 GTGGGGAGAGAGAATGGCAATGG - Intronic
1098523531 12:71460743-71460765 GAGAGGAGGAAGAATGGGGCTGG - Intronic
1099029822 12:77512250-77512272 ATGGGCAGGCACAAGGGGGAAGG + Intergenic
1099196854 12:79626731-79626753 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1099239563 12:80123175-80123197 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1099376269 12:81898943-81898965 GTGGGGATCCATACTGGGGACGG - Intergenic
1099561023 12:84174079-84174101 GGGTGGAGGCAGAAGGGGGCTGG + Intergenic
1099626894 12:85087084-85087106 GTGGGGTGGGGGGATGGGGAGGG - Intronic
1099653284 12:85456736-85456758 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1099668623 12:85661635-85661657 GTGGGCAGGGGGAATGGCGAGGG - Intergenic
1099784222 12:87239391-87239413 GTTGGGAGGGAGAGTGGGGGTGG + Intergenic
1099842495 12:87983532-87983554 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1100016319 12:90015136-90015158 GTGTGGACTCAGAATGGGGCAGG + Intergenic
1100195027 12:92236082-92236104 GTGGGGTGGGAGAAAGGAGACGG + Intergenic
1100206373 12:92354412-92354434 ATGGGGAGCCAGCAGGGGGATGG - Intergenic
1100209815 12:92389109-92389131 GTGGGGATCCACACTGGGGATGG - Intergenic
1100256334 12:92886626-92886648 GAGGGGAGGGGGAAGGGGGAAGG + Intronic
1100390972 12:94146629-94146651 GAGGGGAGGAAGAAGGGGAAAGG - Intergenic
1100478119 12:94952737-94952759 ATGAGGAGCCAGAAAGGGGATGG - Intronic
1100670147 12:96802819-96802841 GTGGGTAGGGAGCAGGGGGAGGG - Intronic
1101027187 12:100621860-100621882 GTGGGGAGGGAGGGTGGGGGGGG + Intronic
1101332188 12:103766113-103766135 GTTGGGAGGCAGGATGGGCTGGG - Intronic
1101828178 12:108236953-108236975 GAGGGGAGACAGAAGAGGGAAGG + Intronic
1102065475 12:109971564-109971586 TTTGGGAGGCAGAAGGGGGTGGG - Intronic
1102275034 12:111575418-111575440 ATGGGGAGGCTGAAATGGGAAGG - Intronic
1102746988 12:115258064-115258086 ATGGAGAGGAAAAATGGGGAAGG - Intergenic
1102813190 12:115841705-115841727 GTGGGAAGAGAGAAGGGGGAAGG - Intergenic
1102865218 12:116368887-116368909 GAGGGGAAGCAGAATGTAGACGG + Intergenic
1102872895 12:116427672-116427694 GTGTGCAGGCAGGATGGGGCGGG + Intergenic
1102887688 12:116534134-116534156 GGGGGGAGGCAGGTGGGGGAGGG - Intergenic
1103058624 12:117841265-117841287 GGGGGAAGGCAGAAAGGGCAAGG - Intronic
1103731234 12:123029061-123029083 GGGAGGAGGCAGCATTGGGAGGG - Intronic
1103734732 12:123052986-123053008 CTTGGGAGGCTGAAGGGGGAGGG - Intronic
1103992435 12:124808101-124808123 GTGGGGAGGCAGAGTCGGAGCGG - Intronic
1104096813 12:125565602-125565624 GTGGGGAGCTGGAAGGGGGATGG + Intronic
1104238305 12:126961237-126961259 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1104306203 12:127612766-127612788 GTGGGGATCCATACTGGGGATGG - Intergenic
1104742503 12:131188754-131188776 CTGGGCAGGCAGAAAGGGGTGGG + Intergenic
1104766682 12:131334227-131334249 CTGGGAAGTCATAATGGGGAAGG - Intergenic
1105018551 12:132801367-132801389 GTGGGGAGGCTGAGGTGGGAGGG + Intronic
1105210667 13:18254963-18254985 GTGGGGAGGGAGGGTGGGGAGGG + Intergenic
1105241123 13:18610257-18610279 GTGGGGTGGAAGAGTGGGGGGGG + Intergenic
1105508065 13:21028071-21028093 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1105641407 13:22268845-22268867 GTGGGGAGCCAGACTGAGCAGGG + Intergenic
1105734775 13:23256520-23256542 GTGGGGTGGGGGAATGGGGGAGG - Intronic
1105749253 13:23407099-23407121 TTCGGGTGGCAGAATGAGGATGG - Intronic
1105762507 13:23527343-23527365 GTGGGGATCCATACTGGGGATGG - Intergenic
1105947642 13:25203132-25203154 GAGGGATGGCAGAATGGGGAGGG + Intergenic
1106060367 13:26284861-26284883 TGGGGGAGGGAGATTGGGGAGGG + Intronic
1106540988 13:30690092-30690114 GGGGGGAGCCAGAAAGGAGATGG - Intergenic
1106568822 13:30908684-30908706 GTGGGGAGGGAGGGAGGGGAGGG - Intronic
1107328834 13:39274891-39274913 GGAGAGAAGCAGAATGGGGAAGG + Intergenic
1107645484 13:42490580-42490602 GTGGGGAGGGAGAAGCAGGAAGG + Intergenic
1107813186 13:44219529-44219551 TCAGGGAGGCAGAATAGGGAGGG - Intergenic
1108346422 13:49551125-49551147 GGGGGGAGGGAGAAGGGGGAAGG + Intronic
1108360783 13:49666333-49666355 ATGTGGAAGCAGAGTGGGGAGGG + Intronic
1108848620 13:54702751-54702773 GTGGGGATCCATACTGGGGATGG - Intergenic
1109058908 13:57587167-57587189 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1109365802 13:61354992-61355014 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
1109846049 13:67992730-67992752 GTGGGGTGGGGGAATGGGGGAGG - Intergenic
1109943635 13:69404518-69404540 GTGGGGAGCCAGAAAGAGGATGG - Intergenic
1110361289 13:74628628-74628650 TTGTGGAGGCAGAATGGAGGGGG + Intergenic
1110479886 13:75961647-75961669 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1110695563 13:78484115-78484137 GTGGGGTGGGGGAATGGGGGAGG + Intergenic
1110776303 13:79411928-79411950 GGGGGGAAGCAGAATTGGGTGGG - Intergenic
1110824458 13:79956303-79956325 GTGGGGTGGCAGGATGGGGGAGG + Intergenic
1111097640 13:83535587-83535609 TGGGGGAGGCAGAAGGGAGATGG - Intergenic
1111262489 13:85760395-85760417 ATGGGGAGCCAGAAGGGGTATGG + Intergenic
1111413810 13:87912463-87912485 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1111640069 13:90957385-90957407 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1111763180 13:92492343-92492365 GTGGGGTGGGAGAGGGGGGAGGG + Intronic
1111793792 13:92891574-92891596 GTGGGGTGGGAGGAGGGGGAGGG + Intergenic
1111878124 13:93921496-93921518 ATGGGGAGCTAGAAAGGGGATGG + Intronic
1111957057 13:94770834-94770856 GTGGGGAGGGAGGGTGGGAAAGG + Intergenic
1112097733 13:96152972-96152994 GTAGGGAGGGGAAATGGGGAAGG - Intronic
1112148449 13:96729163-96729185 GTGGGGTGGGAGTGTGGGGAAGG + Intronic
1112198644 13:97252391-97252413 TTGGGGAGGCTGTATGGGTATGG - Intronic
1112485434 13:99815286-99815308 GTGGGGATGGTGCATGGGGATGG + Intronic
1112488002 13:99836889-99836911 GTGGGGTGGGGGAAGGGGGAGGG + Intronic
1112538395 13:100283302-100283324 GTGGGGATCCATACTGGGGATGG - Intronic
1112626572 13:101111468-101111490 GGGAGGAGGCAGAAGGAGGAGGG - Intronic
1112705275 13:102061073-102061095 ATGTGGAGCCAGCATGGGGATGG - Intronic
1112929240 13:104714023-104714045 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1113179805 13:107612122-107612144 GAGGGGAGGAGGAGTGGGGAGGG + Intronic
1113633683 13:111905418-111905440 GCGGGGACGCAGAAGGGGGCGGG - Intergenic
1113633714 13:111905490-111905512 GCGGGGACGCAGAAGGGGGCGGG - Intergenic
1113697218 13:112354922-112354944 GAAGGGAGACAGAAGGGGGAGGG + Intergenic
1113741377 13:112714457-112714479 GTGAGGAGGGAGAAAGGGAAGGG - Intronic
1113750488 13:112773496-112773518 GAGGGCAGGGAGAGTGGGGAAGG - Intronic
1113759962 13:112840329-112840351 GTGGGGAGGCTGAGTCTGGAGGG - Intronic
1113909758 13:113836422-113836444 GAGGGGGAGGAGAATGGGGAAGG + Intronic
1113955597 13:114098632-114098654 GAGGGGAGGCAGGAAGGGCAAGG + Intronic
1114231902 14:20790718-20790740 ATGGGGAGCCAGAAGAGGGAAGG - Intergenic
1114522121 14:23346486-23346508 GGGAGGAGGCAGGGTGGGGACGG + Exonic
1114952910 14:27779426-27779448 GTGGGGAGGGGGGAGGGGGAGGG + Intergenic
1114996939 14:28365485-28365507 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1115053064 14:29088720-29088742 GTGGAGAGGGGAAATGGGGATGG + Intergenic
1115091728 14:29585071-29585093 GTGGTGAGGCAGAATTGAAAGGG - Intronic
1115412748 14:33093968-33093990 GTGGGGTGGGGGAAGGGGGAGGG + Intronic
1115421474 14:33199706-33199728 GAGGGGAAGAAGAAGGGGGAGGG - Intronic
1115710629 14:36046933-36046955 ATGGGGAAGCATAATTGGGAGGG - Intergenic
1115979138 14:39030262-39030284 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1116209702 14:41919835-41919857 GTGGGGAGGGAGTAGGGGGGAGG - Intergenic
1116548696 14:46206034-46206056 GTGGGGATGCAAAATGGTGCAGG + Intergenic
1116651324 14:47596537-47596559 GGGAGGAGACAGAGTGGGGAAGG - Intronic
1116687353 14:48056897-48056919 GTTGGGAGGCAGAAAGGGAATGG - Intergenic
1116813405 14:49561476-49561498 GAGGGGTGGGAGAGTGGGGAGGG - Intergenic
1117764035 14:59061352-59061374 GTGGGGAGACAGAGTGGGTAAGG - Intergenic
1117996538 14:61483321-61483343 GGGGAGAGGCAGAATTGGGTGGG - Intronic
1118095001 14:62526361-62526383 GTGGGGTGGGGGGATGGGGAGGG + Intergenic
1118892789 14:69923816-69923838 GGAGGGAGGCAGAATAGGGCAGG + Intronic
1119143939 14:72293479-72293501 GTGGGAAAGCGGAAAGGGGAGGG - Intronic
1119345515 14:73920474-73920496 CTGGGTAGGTAGAATGGAGACGG + Intronic
1119478137 14:74942829-74942851 TTGGGCAGGGAGCATGGGGAGGG + Intronic
1119534777 14:75394147-75394169 GTGGGGAGAAAAGATGGGGATGG - Intergenic
1119548894 14:75493655-75493677 GCGGGGATGGAGAGTGGGGAGGG + Intergenic
1119548901 14:75493668-75493690 GTGGGGAGGGGGACTGGGGAGGG + Intergenic
1119641438 14:76318148-76318170 CTGGGGTGGAAGACTGGGGAAGG - Intronic
1119818334 14:77591320-77591342 GTGGGGAGGGTGGATGAGGAAGG + Intronic
1119931483 14:78551767-78551789 GGGGGGAAGTAGAGTGGGGAAGG - Intronic
1119950406 14:78738675-78738697 GTGGGGAAAAAGAATGGGGTGGG - Intronic
1120198812 14:81515503-81515525 GTGGGGATCCATACTGGGGACGG - Intronic
1120280463 14:82431747-82431769 ATGGGAAGGCAGAAGGGGGATGG + Intergenic
1120726181 14:87944075-87944097 GTGGGGACGAGGGATGGGGAAGG - Intronic
1120894070 14:89514155-89514177 GTGGTGAGGGAGAAGGAGGATGG + Intronic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1121277323 14:92677240-92677262 GTGGGAAGGAGGAAAGGGGAAGG - Intronic
1121694204 14:95899669-95899691 GTGAGGAGGCAGCATGAAGACGG - Intergenic
1121720450 14:96105254-96105276 GTGGGGGGTCAGCATGGGGCGGG - Intergenic
1121737468 14:96228463-96228485 GTGGGGAGCTGGAAAGGGGATGG + Intronic
1122292411 14:100686868-100686890 CTGGAGAGGCAGGAGGGGGAGGG + Intergenic
1122312376 14:100805210-100805232 CCAGGGAAGCAGAATGGGGAGGG + Intergenic
1122487983 14:102094516-102094538 GTGGGGAGGGAGTGTGGGGAAGG + Intronic
1122781125 14:104143989-104144011 TTGGGGAGGGAGCCTGGGGAAGG + Intronic
1122830238 14:104392443-104392465 CTGGGGAGGCAGCAAGGGGCGGG - Intergenic
1122874302 14:104656454-104656476 GTGTGGAGGCAGTGAGGGGAGGG + Intergenic
1122917078 14:104864370-104864392 GAGGTGAGGGAGAATGTGGAAGG - Intergenic
1123587885 15:21775137-21775159 TTTGGGAGGCCAAATGGGGAGGG - Intergenic
1123624523 15:22217702-22217724 TTTGGGAGGCCAAATGGGGAGGG - Intergenic
1123888271 15:24749044-24749066 GTGGGCACCCAGAGTGGGGAGGG - Intergenic
1124439833 15:29677863-29677885 GTGGGGAGGCAGGCTGGTGGTGG + Intergenic
1124849828 15:33325696-33325718 GGGGGAAGGCAGAGAGGGGAAGG - Intronic
1125154572 15:36571321-36571343 GTGGGCAGGGAGCACGGGGAGGG - Intergenic
1125320932 15:38487406-38487428 GTGGGGATGAAAATTGGGGAAGG + Exonic
1125590926 15:40854100-40854122 GTGGGGATGGGGGATGGGGAGGG - Intronic
1125883139 15:43210300-43210322 CTGGGGAACCAGAATGGGGCAGG - Intronic
1126165891 15:45653572-45653594 CTTGGGAGGGAGAATGGGGCTGG - Intronic
1127027633 15:54824997-54825019 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
1127124260 15:55796884-55796906 GTGGGGGTGCTGAATGGGGTGGG - Intergenic
1127136900 15:55933535-55933557 GGGGGGAGGGGGAAGGGGGAGGG + Intronic
1127151856 15:56083850-56083872 GTGGGGTGGCAGAAGGAGGGAGG + Intergenic
1127559089 15:60118106-60118128 GTGGGGAGGTAGGTGGGGGAGGG + Intergenic
1128046062 15:64618608-64618630 TTGGGGAGCCAGAAGGGAGATGG + Intronic
1128302010 15:66571868-66571890 GTGGTGAGGAGGAAAGGGGAAGG + Intergenic
1128304157 15:66587034-66587056 GAGGAGGGGGAGAATGGGGAGGG - Intronic
1128697149 15:69775032-69775054 GTGGGGTGGAGGGATGGGGAAGG + Intergenic
1128740978 15:70083532-70083554 GAGGGGAGGGAGGAGGGGGAAGG - Intronic
1128744640 15:70104734-70104756 GTTGGGATGGGGAATGGGGAGGG + Intergenic
1128747346 15:70123824-70123846 ATGGAGAGGCAAGATGGGGACGG + Intergenic
1128762006 15:70223497-70223519 GAGGGGAGGCAGGAGGGGCAGGG - Intergenic
1129045983 15:72734597-72734619 GTGGGGAGGTGGAATGGGCAGGG + Intronic
1129050126 15:72774278-72774300 ATGAGGAGGAAGAATGGGGTGGG + Intronic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1129456306 15:75677652-75677674 GTGGGGAGGGACAATGGGAGAGG - Intronic
1129514777 15:76150690-76150712 GTGTGGCGCCAGGATGGGGAGGG - Intronic
1129684172 15:77675883-77675905 TTGGGGAGCCAGAGTGGGGATGG - Intronic
1130061368 15:80572492-80572514 GTGGGTAGGAAGAGAGGGGAGGG - Intronic
1130064476 15:80592748-80592770 GTGGGGCCTCAGAATGGGCAAGG - Intronic
1130073751 15:80671052-80671074 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1130350269 15:83085184-83085206 GTGGGGAGGCAGCAGGAGGTGGG + Intergenic
1130419919 15:83734851-83734873 GTGGGGAGGGCTAGTGGGGAGGG + Intronic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130430447 15:83842050-83842072 ATGGGAAGGCAGAAGGGGGATGG - Intronic
1130430479 15:83842219-83842241 ATGAGGAGGCAGAAGGGGGATGG + Intronic
1130551370 15:84891801-84891823 GCGGGGAGGCTGAATGGGCAGGG + Intronic
1130906598 15:88244959-88244981 CTGGGGCTGCAGAGTGGGGAAGG + Intronic
1130975356 15:88769452-88769474 GTGGGTGGGGAGAGTGGGGAGGG - Intergenic
1131254705 15:90854441-90854463 TTGGGAAGCCAGAATGGGCACGG + Intergenic
1131411225 15:92209806-92209828 GTGGGGATCCATACTGGGGATGG - Intergenic
1131557746 15:93414248-93414270 ATGGGGGGCCAGAAGGGGGACGG + Intergenic
1131731656 15:95287893-95287915 GTGGGGCGGCGGACTGGGGGAGG + Intergenic
1131772757 15:95758047-95758069 GTGGGTAGGGAGAAAGGGGAGGG + Intergenic
1132241943 15:100264811-100264833 GGGGGGAGGCAAAAATGGGAAGG + Intronic
1132296176 15:100736387-100736409 CTGGGGACGGGGAATGGGGATGG - Intergenic
1132497229 16:269607-269629 GTGAGGAGGCAGAAGGGTCAGGG - Intronic
1132622681 16:875214-875236 GTGGGGATGCTGAAAGGGGAGGG - Intronic
1132685290 16:1159539-1159561 GTGAGGAGGCAGAGTGCGGGTGG + Intronic
1132884535 16:2176814-2176836 GTGGGGATGGAGGGTGGGGATGG - Exonic
1133326115 16:4943400-4943422 GTGGGCAGGCCGGATGGGGTGGG + Intronic
1133414249 16:5593978-5594000 GTGTGGGGGCAGGATGGGGGTGG - Intergenic
1133648888 16:7790858-7790880 GTTGGGAGTCAGACTGGGCAGGG - Intergenic
1133720364 16:8488966-8488988 GGGGGGAGGCAGAGGGAGGAAGG + Intergenic
1134066874 16:11233992-11234014 GTGGGCAGGATGAATGGGGTGGG - Intergenic
1134084850 16:11349316-11349338 GTGGGGATGCAGGAAGGAGAGGG + Intronic
1134346652 16:13397930-13397952 GCGGGGAGCCAGAAGGGAGATGG + Intergenic
1134401529 16:13914501-13914523 GGGGAGAGGCTGAAGGGGGAGGG - Intergenic
1135193255 16:20372591-20372613 CTGGGCAGGAAGAATGGAGAAGG + Intronic
1135352196 16:21738515-21738537 ATGGGGAGCTAGAAAGGGGATGG + Intronic
1135450686 16:22554637-22554659 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
1135611181 16:23868755-23868777 GTGGGGATGGAGACTGGGGCCGG + Intronic
1135660177 16:24289606-24289628 GTAGGGAGCTAGAATGGGGATGG - Intronic
1135924328 16:26679355-26679377 GGGGGAAGGGAGACTGGGGATGG - Intergenic
1135939718 16:26810482-26810504 ATGAGGAGGCATAAGGGGGATGG + Intergenic
1136393585 16:29980468-29980490 GGTGGGAGGAAGGATGGGGATGG - Intronic
1136540762 16:30926586-30926608 GGGAGGTGGCAGAGTGGGGAGGG - Intronic
1136711444 16:32240390-32240412 GTGGGGAGGCAGCAGGGAGGAGG - Intergenic
1137031259 16:35526558-35526580 GTGGGGAGGCAGCAGGGAGGAGG + Intergenic
1137550222 16:49432484-49432506 GTGGGGAGGAAGCATCAGGAAGG - Intergenic
1137579060 16:49622348-49622370 GTGGGGAGTGAGAATGGGGAGGG - Intronic
1137621587 16:49879951-49879973 CTGGGGAGGGTGAATGGGCAGGG + Intergenic
1137894393 16:52195418-52195440 GTGGGGTGGGGGAATGGGGGAGG - Intergenic
1137908446 16:52350916-52350938 AAGGGAAGGCAGAATGGGGAGGG - Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1137977270 16:53042328-53042350 GGGGAGAGGCAGAATGGGAGAGG - Intergenic
1138227700 16:55311975-55311997 GTGGGTAGGGAAAAGGGGGAAGG - Intergenic
1138504700 16:57472431-57472453 GTGGGGAGGAGGAAATGGGAAGG + Exonic
1138706935 16:58924788-58924810 TTGGGGAGGCAGAAGTGGGCTGG - Intergenic
1138731216 16:59197146-59197168 GTGGGGGGGGGGAATGGAGAGGG - Intergenic
1138984082 16:62305624-62305646 GTGGGCAGAGGGAATGGGGAAGG + Intergenic
1139284455 16:65798071-65798093 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1139406508 16:66723236-66723258 GTGGGGAAGCTGAATGTTGAGGG - Exonic
1139838810 16:69861676-69861698 GTGGGGAGGAAGAATTGAGGGGG + Intronic
1139889401 16:70238966-70238988 GTGGGGAGAGGGAATGAGGAAGG + Intergenic
1140339112 16:74139790-74139812 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
1140509659 16:75497893-75497915 GGAGGGAGGAAGAATAGGGAGGG - Intergenic
1140586590 16:76299994-76300016 GTGGGGTGGGGGAGTGGGGAGGG + Intronic
1140748141 16:77999146-77999168 ATGGGCAGCCAGAAGGGGGATGG + Intergenic
1141252193 16:82368903-82368925 ATGGGGAGAGAGAGTGGGGAGGG + Intergenic
1141588963 16:85054805-85054827 TTGGGGAGGCCTAAAGGGGATGG + Intronic
1141724041 16:85774542-85774564 GGGGTGAGCAAGAATGGGGAAGG + Intronic
1141729910 16:85815188-85815210 CTGGGGAGGGGAAATGGGGAGGG - Intergenic
1141883333 16:86874403-86874425 GTGGGGAGGCAGGACAGGGAAGG - Intergenic
1141984594 16:87571613-87571635 CTGGGGAGGCAGGGTGGGAAAGG + Intergenic
1142034554 16:87855269-87855291 ATGGGGAGGCACAAGGGGGTGGG - Intronic
1142117804 16:88369208-88369230 GTGGGGTGGGGGAATGGCGAGGG - Intergenic
1142342680 16:89534156-89534178 CTGGGGATGGAGAATGGGGAGGG - Intronic
1142548218 17:720529-720551 GTGGGGAGGATGGATTGGGAGGG + Intronic
1142725529 17:1810910-1810932 GTTGGGAGCCAGAAGGGAGATGG - Intronic
1142825659 17:2508500-2508522 TGGGGGAGGCAGCATGGAGAAGG - Intronic
1143482443 17:7235449-7235471 GTGGGGAGGAAGGATAGGGTGGG + Exonic
1143591008 17:7885680-7885702 TTGGACAGGCAGAGTGGGGACGG + Intronic
1143773523 17:9183022-9183044 GTGGGGTGGGTTAATGGGGAAGG + Intronic
1143884621 17:10056733-10056755 GTGGGGAGGGAGACGGGAGAGGG - Intronic
1143942149 17:10553615-10553637 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
1144302859 17:13939090-13939112 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1144320844 17:14117926-14117948 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1144501897 17:15795452-15795474 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
1144789269 17:17848353-17848375 TTGGGGAGGCAGGATGTGAAGGG + Intronic
1144888168 17:18477853-18477875 GTGGGGAGGCAGAATGGGGAGGG + Intronic
1145144038 17:20466450-20466472 GTGGGGAGACAGAATGGGGAGGG - Intronic
1145761322 17:27426763-27426785 CTGGGGAGGCAGCCTGGGCAGGG - Intergenic
1145791829 17:27632258-27632280 GTGGGGAGGCAGGGTGGGGAGGG + Intronic
1146163204 17:30570870-30570892 GGGGGGAGGCAGAAAGGAGGGGG - Intergenic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1147025112 17:37575163-37575185 GTGGGGGGGAATAATGGGGATGG + Intronic
1147363401 17:39945039-39945061 GTGGGGGGGCAGGTTGAGGAGGG + Intergenic
1147533092 17:41298589-41298611 CGGGGGAGCCAGAAGGGGGATGG - Intergenic
1147855952 17:43480178-43480200 GAGGGCAGGCAGATTGGGGTTGG - Intergenic
1147921148 17:43917851-43917873 GTGGGGAGGCTCCATGCGGATGG - Exonic
1148035549 17:44656798-44656820 GTGGGGAGGCCGAACGGGGCGGG + Intronic
1148084506 17:44985807-44985829 TGGGGGAGCCAGAAGGGGGATGG - Intergenic
1148151394 17:45398359-45398381 GCAGGGAGGCAGGATGGGGGAGG - Intronic
1148358920 17:46995966-46995988 GTGGGGAGGCAGCATGGATGGGG - Intronic
1148359996 17:47003862-47003884 GTGGGGTGGAGGAAGGGGGAAGG - Intronic
1148374604 17:47131530-47131552 GAGGGGAGGGAGAAGGGGAAAGG + Intronic
1148394194 17:47295379-47295401 GAGGGGAGCCAGAAAAGGGAGGG - Intronic
1148793206 17:50185080-50185102 CTGGGGAGACAGATTTGGGAAGG + Exonic
1148911845 17:50947107-50947129 GTGGGGGTGCAGGCTGGGGAAGG + Intergenic
1148936078 17:51165712-51165734 GTGGGGCGGCTGATTGGGGCTGG + Intronic
1149003543 17:51781074-51781096 TTGGGGAGGAAGAACTGGGAGGG + Intronic
1149159153 17:53668952-53668974 GGGGGGAGGGAGAGTGGGGAAGG + Intergenic
1149217096 17:54370216-54370238 CTGGGGAGTTAGAAGGGGGATGG + Intergenic
1149499459 17:57140861-57140883 TTTGGGAGGCCGAATGGGGGTGG + Intergenic
1149865105 17:60147231-60147253 GTGTGGAGGCAGCATTGGGTGGG - Intergenic
1150120725 17:62599512-62599534 ATGGGAAGGCAGAAATGGGAGGG + Intronic
1150125188 17:62630571-62630593 CTGGGAGGCCAGAATGGGGATGG + Intronic
1150652351 17:67018304-67018326 GTGGGGAGGCGGAAGGGTGGGGG + Intronic
1150999025 17:70352137-70352159 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1151305538 17:73260802-73260824 CTGGGGAGGGAAAATTGGGATGG - Intronic
1151499835 17:74481593-74481615 GGGTGGAGGCAGGAAGGGGAAGG + Intronic
1151520977 17:74629318-74629340 GTGGGGAGGGGGAGGGGGGAGGG + Intergenic
1151568028 17:74910854-74910876 GTGGGGATCCATACTGGGGATGG - Intergenic
1151748025 17:76022059-76022081 GTGGGGAGACAGAAAGTGGGGGG + Intronic
1152254138 17:79227604-79227626 GTGGGGAGGCTGACTGGCGGCGG + Intronic
1152609428 17:81308309-81308331 GTGGGGGGGCACCATGGAGAGGG + Intergenic
1152945205 17:83194324-83194346 GTGGGGAGGCAGGATTGGGGAGG - Intergenic
1153059637 18:982008-982030 GTGGGGAGAGAGAAAGTGGAAGG - Intergenic
1153330417 18:3867666-3867688 GTTGGGAGGAGAAATGGGGATGG + Intronic
1153842753 18:9021945-9021967 CTGGGGAGGCTGAAGTGGGAGGG - Intergenic
1154041457 18:10860026-10860048 GGAGGGAGGCAGATTGGAGACGG + Intronic
1155667750 18:28331841-28331863 GTGGGAAGGCAGATTAGGAAGGG + Intergenic
1155735844 18:29221217-29221239 GTGGGGTGGGGGGATGGGGAAGG + Intergenic
1155746104 18:29357944-29357966 GTTGGGAGACAGAAGGAGGATGG + Intergenic
1155756841 18:29509145-29509167 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
1156043904 18:32856795-32856817 GTGGGGAGGGGGAAGGGGGGAGG - Intergenic
1156111418 18:33731843-33731865 GTGAGGAGGAGGAAGGGGGAAGG - Intronic
1156221450 18:35056530-35056552 GTATGGAGGCAGGATGGGGAGGG + Intronic
1156439266 18:37167445-37167467 ATGGGGTGTCAGAAGGGGGATGG + Intronic
1156752456 18:40475435-40475457 GAGGGGAGGCAGGGAGGGGAGGG + Intergenic
1157002369 18:43542317-43542339 GATGGGAGCCAGAAAGGGGATGG + Intergenic
1157127813 18:44973788-44973810 GTGGAGAGGCAGACAGAGGAGGG + Intronic
1157261870 18:46182499-46182521 CTTGGGAGGCAGAGTTGGGAGGG + Intronic
1157481912 18:48060565-48060587 CTGAGGAGGCGGAATGGGCAAGG - Intronic
1157589319 18:48826900-48826922 GTGGGGAAATGGAATGGGGAAGG + Intronic
1157914857 18:51654946-51654968 ATGGGGAGGCGGAGTGGGGAAGG - Intergenic
1158278204 18:55791910-55791932 GTGGGAGGGCAGGATGGGGAGGG - Intergenic
1158588200 18:58758811-58758833 GTGGGGGCGCAGAGTGGGGTGGG - Intergenic
1158907676 18:62029665-62029687 GTGGGGAGGCGGAGGGGAGAAGG + Intergenic
1159165315 18:64691525-64691547 TAGGGGTGGGAGAATGGGGAGGG - Intergenic
1159300662 18:66562128-66562150 GTGGGGAGTGGGCATGGGGATGG + Intronic
1159417604 18:68173259-68173281 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1159968601 18:74621551-74621573 GTGGGGAGGCCCATGGGGGAAGG - Intronic
1160433372 18:78827632-78827654 CTGGGGAGGTGGAATGGGGGTGG - Intergenic
1160925137 19:1540701-1540723 GGGGGGAGGAAGCAGGGGGACGG + Intergenic
1161030755 19:2056763-2056785 GAGGGGAGGAAGAAGGGGGGAGG - Intergenic
1161321471 19:3643621-3643643 GCGGGGAGGGAGAGTGGAGAGGG - Intronic
1161387961 19:4007085-4007107 GTGGGGAGGCAGGATGGGGGGGG + Intergenic
1161448299 19:4329918-4329940 GAGGGGCTGCAGGATGGGGACGG - Intronic
1161598221 19:5163426-5163448 GTGGGGATCCATACTGGGGATGG + Intronic
1161847708 19:6721087-6721109 GAGGGGAAGTAGAATGGGGGAGG + Intronic
1161849803 19:6732424-6732446 GGGGGGAGGCAGGCAGGGGAGGG - Intronic
1161978663 19:7619557-7619579 GTGGGGAGGGGGGATGGGGGAGG + Exonic
1162015920 19:7846433-7846455 GTGGGCAGGCAGGATGGAGTGGG + Intronic
1162107928 19:8381969-8381991 GTGGGGATCCATACTGGGGATGG - Intronic
1162178182 19:8847249-8847271 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
1162237459 19:9320473-9320495 GTGGGGATCCATACTGGGGATGG + Intergenic
1162973199 19:14193477-14193499 CTGGGAAGGCTGAAGGGGGAGGG + Intronic
1163206054 19:15803472-15803494 GGAGGGAGGGAGAAGGGGGAGGG + Intergenic
1163530752 19:17847650-17847672 GTGGGGAGGAGGGATTGGGAAGG - Intronic
1163736424 19:18984077-18984099 GTGGAGAGCCAGAAAGGAGAGGG + Intergenic
1163749355 19:19066305-19066327 CTGGGGTGGCAGAAAGGGGTCGG + Intronic
1164193284 19:22930960-22930982 GTGGGGTGGGAGGATGGGGGAGG + Intergenic
1164331583 19:24263916-24263938 GTGGGGTGGGAGGATGGGGGAGG - Intergenic
1164360345 19:27501113-27501135 GTGGGGTGGGAGGAGGGGGAAGG - Intergenic
1164431824 19:28195542-28195564 GTGGGGAGGGAGAAGGCAGAAGG + Intergenic
1164659487 19:29949922-29949944 GTGGGGAGACGGGAGGGGGAGGG + Intronic
1164721832 19:30438238-30438260 GTGGGGAGGGAGAGAGGGGAGGG - Intronic
1164749780 19:30644508-30644530 GTGGGGTGGGAGGATGGGGGAGG - Intronic
1165614517 19:37188030-37188052 GTGGGAAGGCAGATGGGTGAGGG + Intronic
1165788759 19:38478215-38478237 GTGGGGAGTCAGGATGGGGGTGG - Intronic
1165847096 19:38825222-38825244 GTGGGGATCCATACTGGGGATGG - Intronic
1165847420 19:38827120-38827142 GAGGGGAGGGAGAAAGGGGAGGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166116854 19:40661609-40661631 TTTGGGAGGCTGATTGGGGAGGG - Intergenic
1166151760 19:40880251-40880273 GTGTGGAGGGAGAAGGGGGTTGG + Intronic
1166164083 19:40974459-40974481 GTGGGGTGGGAGAATGGGGAGGG + Intergenic
1166194033 19:41194515-41194537 GTAGGGAGGAAGAAAGAGGAGGG - Intronic
1166254848 19:41596135-41596157 GTGAGGTGCCAGGATGGGGATGG - Intronic
1166561793 19:43737551-43737573 GTGGGGAGGAGGAATGAGGCAGG - Intronic
1166793742 19:45413847-45413869 GTGGGAAGGCAGGACGGGCAAGG + Intronic
1166803983 19:45474003-45474025 GAGGGGAGGAAGAAGGGGGATGG - Exonic
1166864970 19:45830310-45830332 CTGGAGAGGCAGCAGGGGGATGG - Intronic
1166870600 19:45868038-45868060 GTGGGGAGGGAGATGGGAGAGGG + Intronic
1167007438 19:46784986-46785008 GCGGGGAGGGAGAAAAGGGACGG + Intronic
1167483631 19:49747507-49747529 GTTGGGAGGCAGAACTGGAATGG - Intronic
1167707553 19:51090531-51090553 GTGGGGAGGCTGCCTGAGGAGGG + Intergenic
1167719360 19:51168051-51168073 GTGGGGACGCAGGATCAGGAGGG - Intergenic
1167727422 19:51225766-51225788 GAGGGGATGCAGAATCAGGAGGG - Intronic
1167758129 19:51426239-51426261 CAGGGGAGCCATAATGGGGATGG - Intergenic
1167777146 19:51565709-51565731 GGGAGGAGGCAGGATGAGGAAGG - Intergenic
1168149611 19:54438048-54438070 CTGGGTAGGGAAAATGGGGAGGG + Intergenic
1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG + Intronic
1168296659 19:55380329-55380351 GAGGGGAGGGGGAAGGGGGAAGG - Intronic
1168709398 19:58490051-58490073 CTGGGGAGGCTGAAGTGGGAGGG - Intronic
925305963 2:2848653-2848675 GTGGGGAGAGAGAGAGGGGATGG - Intergenic
925755406 2:7128115-7128137 GGGGGGAGGGGGAAAGGGGAGGG - Intergenic
925755516 2:7128312-7128334 GGGGGAAGGGAGAAAGGGGAGGG - Intergenic
925839810 2:7980506-7980528 TGGGGGAGGCAGAAGGGAGATGG - Intergenic
925889854 2:8424938-8424960 GTGGGGAGGAAGGAAGTGGAGGG - Intergenic
926023104 2:9514363-9514385 GGGGGGAGGGGGAAGGGGGAAGG + Intronic
926043052 2:9690235-9690257 GTGGGGAGGCAGTGTGAGAAGGG + Intergenic
926124508 2:10263916-10263938 GGGGGGAGGGGGAAGGGGGAAGG + Intergenic
926220123 2:10930681-10930703 GTGGTGAGGATGAACGGGGATGG + Intergenic
926264494 2:11302533-11302555 GTGGGAAGTCAGATTGGAGAAGG - Intronic
926401482 2:12501606-12501628 GTGGAGGGGCAGGAAGGGGAAGG - Intergenic
926464846 2:13175552-13175574 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
926753647 2:16219303-16219325 GGGGGGAGGGAGAAGGGGGGAGG - Intergenic
926862838 2:17327012-17327034 GTAGTGAGGCTGAATGTGGAGGG - Intergenic
927039126 2:19210416-19210438 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
927083163 2:19650242-19650264 GTGGGGAGGAGGGATGGAGAAGG + Intergenic
927500876 2:23582424-23582446 GTGGGGGTGGAGGATGGGGATGG + Intronic
927503170 2:23595792-23595814 GTGGAGAGACAGCATGGGAAGGG - Intronic
927558125 2:24049986-24050008 GTCGGGGGGCTGGATGGGGAAGG + Intronic
927896981 2:26789147-26789169 GTGGGGAGTCAGATTGGAGTGGG - Intronic
927963811 2:27257115-27257137 GTGGGGAGGAAGGCTGGGGCAGG + Intronic
927990123 2:27441975-27441997 GAGGGGAGGAAGAGAGGGGAGGG - Exonic
928017827 2:27674945-27674967 TTTGGGAGGCTGAAGGGGGATGG - Intronic
928115065 2:28540314-28540336 GAGGGGAGGCAGTGTGGGCAGGG - Intronic
928308829 2:30193469-30193491 CTAGGGAGGCAGCAGGGGGAGGG - Intergenic
928373551 2:30758060-30758082 GGGGCGAGGCCGAATGGAGAGGG - Exonic
928465198 2:31516961-31516983 GGGGTGGGGCAGAAGGGGGAGGG - Intergenic
928599685 2:32892021-32892043 GTGGGGTGGTAGAGTGGGGGTGG + Intergenic
928819341 2:35342186-35342208 ATGGGGAGCCAGAAGGGAGATGG - Intergenic
929035991 2:37692241-37692263 GTGGGGTGGGGGAATGGGGGAGG + Intronic
929330381 2:40674654-40674676 GTGGGGATCCATACTGGGGATGG - Intergenic
930038539 2:47103095-47103117 GTGGGGATCCATACTGGGGATGG - Intronic
930050855 2:47215302-47215324 ATGGGGATGAAGGATGGGGAGGG + Intergenic
930255535 2:49085963-49085985 GTGGGGGGGGGGAGTGGGGAGGG + Intronic
930260053 2:49134914-49134936 GTGGGGTGGGAGGATGGGGGAGG + Intronic
930442659 2:51428521-51428543 GTGGGGTGGGGGGATGGGGAGGG + Intergenic
930560817 2:52957924-52957946 GAGGGGAGACAGAATAGAGAGGG + Intergenic
930752261 2:54945224-54945246 GAGGGGAGAGAGAAGGGGGAGGG - Intronic
930752270 2:54945254-54945276 GAGGGGAGAGAGAAGGGGGAGGG - Intronic
930826322 2:55700287-55700309 GAGGGGAGGGGGAGTGGGGAGGG - Intergenic
930835401 2:55788259-55788281 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
930838488 2:55819985-55820007 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
930977323 2:57479092-57479114 ATGGGGAGGCTGTATTGGGATGG - Intergenic
931340771 2:61398579-61398601 CGGGGGAGGGAGAAAGGGGAGGG + Intronic
931491137 2:62749126-62749148 GTGGGGTGGGGGGATGGGGAAGG - Intronic
931511430 2:63000092-63000114 GGGGGGAGGCAGGATGGGTGGGG + Intronic
931658048 2:64527949-64527971 GTGGGGAGGAAGAAAGGAGGTGG + Intronic
931848009 2:66224665-66224687 GTGGCGAGGCAGCATGGGATGGG + Intergenic
931855706 2:66299737-66299759 GAGGGGAGCCAGCATGGGGAGGG + Intergenic
932049937 2:68388305-68388327 GAGGGGAGGGGGAATGGAGATGG + Intronic
932121597 2:69105665-69105687 GTGGGGAAGGAAAATGGGAAAGG - Intronic
932427139 2:71645285-71645307 TTGGGGAGCCAGAAGGGAGATGG + Intronic
932433853 2:71691718-71691740 GGGTGGAGGCAAACTGGGGAGGG - Intergenic
932585087 2:73022618-73022640 GTAGGGAGGGGGAAGGGGGAAGG + Intronic
932691486 2:73917429-73917451 GTTGGGAGGCAGTATGGGGAAGG - Intronic
932744889 2:74325862-74325884 GAGGGGAGGGGGAAAGGGGAAGG + Intronic
932824065 2:74924475-74924497 ATGGGGTGGCAGAACTGGGAAGG + Intergenic
932884416 2:75535766-75535788 TTGGAGACTCAGAATGGGGAAGG + Intronic
932925125 2:75964443-75964465 GTAGGGAGGCAGAATGGTTTTGG - Intergenic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933171671 2:79132312-79132334 GAGGGGAAGCAAAATGGGAAGGG - Intergenic
933642320 2:84777094-84777116 GTGGGGTGGCAGGATTGGGGAGG + Intronic
933771707 2:85748834-85748856 GTGGAAAGGGAGAGTGGGGAGGG - Intergenic
933890064 2:86759812-86759834 GTGGGGAGGAAGGAAGGGGGAGG + Intronic
934553740 2:95276894-95276916 CTGGGGAGGCAGGATGGGAATGG + Intronic
934704901 2:96470648-96470670 CTGGGGAGGCAGGATGGGACAGG + Intergenic
934785222 2:97000223-97000245 GTGGGGAGGCTGAAGTGGGAGGG - Intronic
934863058 2:97780432-97780454 GTGGGGTGGGAGAGTGGGGCAGG - Intronic
934930506 2:98418507-98418529 GTGGGGAGGATGAATGGGGGGGG + Intergenic
935063291 2:99626539-99626561 GAGGGGAGGGAGAAGGGAGAAGG - Intronic
935138819 2:100333142-100333164 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
935143370 2:100376146-100376168 GTGGGGTGGGAGGAGGGGGAGGG + Intergenic
935594959 2:104871160-104871182 GTTTGGATGCAGAATTGGGATGG - Intergenic
935618202 2:105107121-105107143 GTGGGGAGGCAGAAGGAGCGAGG - Intergenic
935837271 2:107068550-107068572 GGGCGGGGGCAGAATTGGGATGG - Intergenic
935958172 2:108399242-108399264 ATGGGGAGGTAGCAAGGGGATGG - Intergenic
936159743 2:110075784-110075806 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
936184922 2:110295569-110295591 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
936351188 2:111713747-111713769 GTGGGGTGGGGGAGTGGGGAGGG + Intergenic
936407838 2:112223108-112223130 GTGGGGTGGGGGAGTGGGGAGGG + Intronic
936742338 2:115528209-115528231 GTGGGGTGGGGGAGTGGGGAGGG + Intronic
936777648 2:115993634-115993656 GTGGGGTGGGAGGATGGGGGAGG + Intergenic
936927475 2:117751971-117751993 GTGGGGAGGGGGGAGGGGGAAGG + Intergenic
937227781 2:120379514-120379536 GTGGGTAGAAAGACTGGGGAGGG + Intergenic
937268178 2:120630287-120630309 AGGGGGTGGCAGAGTGGGGAGGG + Intergenic
937474620 2:122204105-122204127 TTGGGGAGTCACAATGGGGCAGG + Intergenic
937508898 2:122570722-122570744 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
937870569 2:126783106-126783128 CTGGGGAGGCAAAGAGGGGAAGG + Intergenic
938049777 2:128158180-128158202 GTAGGGTAGGAGAATGGGGAAGG + Intronic
938122635 2:128644731-128644753 GTAGAGAGGGAGAAAGGGGAAGG - Intergenic
938574830 2:132594161-132594183 GTTTGAAGGCAGAATGGGGTGGG - Intronic
939322955 2:140648288-140648310 GTGGGGTGGGGGAGTGGGGAGGG + Intronic
939724364 2:145697867-145697889 GTGGGGTGGGGGAATGGGGGAGG + Intergenic
939857853 2:147382047-147382069 TTGGGGAGGCTGTATGTGGAGGG + Intergenic
940125424 2:150317456-150317478 GTGGGGTGGGGGAGTGGGGAGGG + Intergenic
940321814 2:152385332-152385354 GTAGGGAGGGAGGCTGGGGATGG + Intronic
940450968 2:153836649-153836671 GTGGGGAGGGGGGAGGGGGAGGG - Intergenic
940660014 2:156534120-156534142 ATGGGGAGCTAGAAAGGGGATGG + Intronic
940677808 2:156746554-156746576 GTGTGGAGGGAAAATGGGGAAGG - Intergenic
940781023 2:157933726-157933748 AAGGGAAGGCAGAATGGGGCTGG + Intronic
941038196 2:160590516-160590538 GAGGGGAAGGAGAAGGGGGAGGG - Intergenic
941057312 2:160803320-160803342 GTGGGGTGGGAGGATGGGGGAGG + Intergenic
941158737 2:162010900-162010922 CTGGGGAAGCATAATAGGGAGGG - Intronic
941159825 2:162023624-162023646 AAGGGCAGGCAGACTGGGGAAGG - Intronic
941284869 2:163598231-163598253 TGGGGGAGGCAGAGTGAGGAAGG - Intronic
941309619 2:163912599-163912621 ATGGGGAGCCAGAAGAGGGATGG - Intergenic
941690445 2:168495919-168495941 GTTGGGAGACAGGGTGGGGATGG - Intronic
941870590 2:170381011-170381033 GTTGAGAGGCTGAGTGGGGAGGG + Intronic
941925179 2:170887207-170887229 GTGAGGAGGGAGGATGGGGGAGG + Intergenic
941974398 2:171386998-171387020 TTGGGGAGTCAGAAGGGAGATGG - Intronic
942906103 2:181182553-181182575 GTGGGGTGGGAGGAGGGGGAAGG + Intergenic
942960981 2:181829644-181829666 GTTGGGAGGAAGGAGGGGGACGG - Intergenic
942983174 2:182106525-182106547 ATGGGGAGCCAGAAGTGGGATGG - Intronic
943103066 2:183510462-183510484 GTGGGGATCCACACTGGGGATGG + Intergenic
943133753 2:183887938-183887960 GTGGGGATCCATACTGGGGATGG - Intergenic
943277214 2:185882830-185882852 GTGGGGTGGGAGGAGGGGGAGGG - Intergenic
943549861 2:189325166-189325188 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
943838878 2:192552264-192552286 TTGGGGAGCCAGAAGAGGGATGG + Intergenic
944251513 2:197583769-197583791 GTGGGGTGGGGGAGTGGGGAGGG - Intronic
944462938 2:199970765-199970787 GTGGGGTGGGGGAGTGGGGATGG - Intronic
944516096 2:200513107-200513129 TTGGTGAGGCAGGAAGGGGAGGG + Intronic
944729009 2:202499413-202499435 GTGGGGATCCATAATGGGGATGG - Intronic
944845483 2:203663955-203663977 TTGGGGAGGCTGAAGGGGGCAGG - Intergenic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946191872 2:218011722-218011744 GTGGGGAGCTGCAATGGGGACGG - Intergenic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946283422 2:218683726-218683748 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
946332873 2:219020151-219020173 CTGGGGAGGGTGAATGGGGAGGG - Intronic
946614715 2:221497114-221497136 CTGTGGAGGCAGTTTGGGGAAGG + Intronic
947291516 2:228580808-228580830 ACGGGTAGGTAGAATGGGGAAGG + Intergenic
948192504 2:236070778-236070800 GCGGGGAGGCATCAGGGGGATGG + Intronic
948220181 2:236263057-236263079 GTTGGGAGGGAGAATGGGGGTGG + Intronic
948690113 2:239696744-239696766 CTGGGGAGGCAGAGCGGGGTTGG - Intergenic
948710386 2:239821622-239821644 TTGGGGAGGCAGAAAGCGGTGGG - Intergenic
948765373 2:240216640-240216662 GTGGGGTGGAAGGATGGGGGTGG + Intergenic
948765424 2:240216747-240216769 GTGGGGTGGAAGGATGGGGGTGG + Intergenic
948765448 2:240216799-240216821 GTGGGGTGGAAGGATGGGGGTGG + Intergenic
948765493 2:240216903-240216925 GTGGGGTGGAAGGATGGGGGTGG + Intergenic
948765541 2:240217007-240217029 GTGGGGTGGAAGGATGGGGGTGG + Intergenic
948919351 2:241054174-241054196 GTGGGGAAGTAGCATTGGGAGGG - Intronic
948948285 2:241232974-241232996 CTGGGGAGGAAGAAGGGGAAGGG + Intronic
949038414 2:241832068-241832090 GAGGGGAGGCAGTGAGGGGAGGG + Intergenic
1168797786 20:623004-623026 GTGGGGAAGCAGAGTGGGTGAGG + Intergenic
1168958336 20:1850077-1850099 GTGGGGAAGGAGGATGGGGTTGG + Intergenic
1169213433 20:3779891-3779913 GTGGAGATGCGGAAAGGGGAAGG + Intronic
1169235381 20:3926038-3926060 GTGGGTGGCCAGAATGGAGAGGG + Intronic
1169440128 20:5626927-5626949 AAGGGGAGCCAGAAGGGGGATGG - Intergenic
1169500840 20:6158917-6158939 GTGGGGAGCCAGGATGGTCAGGG - Intergenic
1169638581 20:7722566-7722588 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
1169641604 20:7758425-7758447 AGGGGTAGGGAGAATGGGGAGGG - Intergenic
1170440962 20:16378312-16378334 GAGGGAAGGAAGAAAGGGGAGGG + Intronic
1170785275 20:19462247-19462269 GTGGGGAGGCAGATGGCGGGTGG + Intronic
1170834059 20:19868691-19868713 TTGGGGACCCAGAAAGGGGAAGG + Intergenic
1170986882 20:21266761-21266783 GAGGGGAGGCAACCTGGGGAGGG + Intergenic
1171024765 20:21619803-21619825 GAGGGGAGGCAGAAGTGGAAAGG + Intergenic
1171261506 20:23738426-23738448 GTGGGGATCCATACTGGGGATGG - Intergenic
1171270651 20:23814317-23814339 GTGGGGAGCCCTACTGGGGATGG - Intergenic
1171284491 20:23925944-23925966 GTGGGGAGGGAGAAGGAGGGAGG - Intergenic
1171291812 20:23986654-23986676 GTGGGGAGGGAGGGTGGGGAGGG + Intronic
1171316908 20:24203273-24203295 GTGTGGAGCCAGGAAGGGGAAGG - Intergenic
1171447890 20:25217602-25217624 GTGGGGAGGCGCCATGGGGTGGG + Intronic
1171517562 20:25750228-25750250 TGGGGGAGGCAGAAAGGAGATGG + Intergenic
1172008284 20:31831978-31832000 GGGGAGAGGCAGCATGGTGACGG - Intronic
1172094264 20:32453005-32453027 GTCTGCAGGCAGAACGGGGATGG + Exonic
1172113947 20:32562943-32562965 GAGGGGAGGGAGGGTGGGGAGGG + Intronic
1172114024 20:32563167-32563189 GGAGGGAGGGAGAGTGGGGAGGG + Intronic
1172114044 20:32563221-32563243 GTGAGGAGGGAGAGTGGGGAGGG + Intronic
1172114061 20:32563263-32563285 GTGGGGAGGGAGACTCGGGAGGG + Intronic
1172114066 20:32563276-32563298 CTCGGGAGGGAGAGTGGGGAGGG + Intronic
1172187498 20:33040220-33040242 GTGGGGAGGAAGCAGGGAGAAGG - Intronic
1172608217 20:36230067-36230089 GTGGGGTGGGGGAAGGGGGAAGG - Exonic
1172776231 20:37408820-37408842 GCGGGGAGTGAGAATCGGGATGG - Intergenic
1172841483 20:37904855-37904877 ATGGTGAGGCAGAAGGGGGCGGG - Intronic
1172965780 20:38833774-38833796 GTAAGCAGGCAGAATGGGGAAGG - Intronic
1173059618 20:39648747-39648769 TTGGAGATTCAGAATGGGGAGGG + Intergenic
1173144553 20:40513519-40513541 ATGGGGAGGCAGAGTGGGGCTGG - Intergenic
1173201532 20:40958786-40958808 GTGGGAAAGCGGGATGGGGAGGG - Intergenic
1173369928 20:42426417-42426439 ATGGGGAGGTGGAAAGGGGATGG - Intronic
1173440055 20:43067990-43068012 GAGGGGAGGAAGGAAGGGGAGGG + Intronic
1173440086 20:43068064-43068086 GAGGGGAGGAAGGAAGGGGAGGG + Intronic
1173440096 20:43068086-43068108 GAGGGGAGGAAGGAAGGGGAGGG + Intronic
1173617678 20:44413651-44413673 GTGAGGAGGGAGAACAGGGATGG - Intronic
1173784553 20:45783218-45783240 GTGGGGAGGCAGAGAAGGGGCGG + Intronic
1173801916 20:45899437-45899459 GAGTGGGGGCAGGATGGGGAAGG - Intronic
1173817477 20:45998987-45999009 GTCAGGAGGCAGAAGGAGGAAGG + Intergenic
1173825088 20:46043128-46043150 GTGGGGAGACAGAATGCTCAGGG - Intronic
1173876632 20:46376421-46376443 GTGGGGAGGGAGAGTCAGGAGGG - Intronic
1174080438 20:47967753-47967775 GGGGGGTGGTAGACTGGGGAAGG - Intergenic
1174276444 20:49407921-49407943 GTGGGGAGAAAGCATGGTGACGG - Intronic
1174488291 20:50874753-50874775 GGGAGCAGGCAGCATGGGGAGGG + Intronic
1174502597 20:50996648-50996670 GGAGGGAGGCAGGATGGGGCAGG + Intergenic
1174704429 20:52640975-52640997 GTGGGGTGGCGGAAGGGGGGAGG + Intergenic
1174927085 20:54772132-54772154 GTGGGCAGGAAGAGAGGGGAGGG + Intergenic
1175166344 20:57047283-57047305 ATGAGGAGGCCGAATTGGGAAGG - Intergenic
1175383294 20:58578175-58578197 TGGGGGAGGCAGGATGGGGTGGG - Intergenic
1175537899 20:59728158-59728180 GTGGGAGGGGAGAATGGGCATGG - Intronic
1175624617 20:60480108-60480130 GTGGGGAGGCAGGATGGGTAGGG - Intergenic
1175667723 20:60874308-60874330 GGGAGGAGGCAGGATGGTGATGG + Intergenic
1175752484 20:61508907-61508929 CTGTGGAGGCAGAGTGGGGAGGG - Intronic
1175871874 20:62212985-62213007 GGGGGGAGGGAGAGTGGGGATGG + Intergenic
1175872023 20:62213343-62213365 GGGGGGAAGGAGAGTGGGGATGG + Intergenic
1175872188 20:62213737-62213759 GGGGGGAAGGAGAGTGGGGATGG + Intergenic
1175998635 20:62822224-62822246 CTGGGGAGGGGGAATGGGGAGGG - Intronic
1176070475 20:63223611-63223633 GCTGGGAGGCAGCATGTGGAAGG + Intergenic
1176155612 20:63618673-63618695 CTGGGGAGGAAGAATAAGGATGG + Intronic
1176289777 21:5037836-5037858 GTGGGGAGGTAGAAGGGAGGAGG - Intronic
1176850387 21:13908258-13908280 GTGGGGATGCAGACAGAGGAGGG + Intergenic
1177143420 21:17381904-17381926 GTGGGGAGGGGGGAGGGGGAGGG + Intergenic
1177946407 21:27475305-27475327 GTGGGGAGGCAGAAAGAGCAGGG - Intergenic
1178199831 21:30390911-30390933 GTGGGGAGCTAGAAGGGGGATGG - Intronic
1178422361 21:32452707-32452729 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1178514064 21:33230756-33230778 GCGTGGAGGCAGGAGGGGGAAGG + Intronic
1178515605 21:33244575-33244597 TTGGGGAGGGAGAATGGGTAGGG + Intronic
1178810325 21:35875927-35875949 GTGGGTAGGAGGAAAGGGGAGGG + Intronic
1178917265 21:36713055-36713077 TTGGGGAGAGAGAATGGGGAGGG + Intronic
1178973574 21:37202474-37202496 GTGGGGAAGGAGAATGGTGGTGG - Exonic
1179095916 21:38314340-38314362 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
1179171585 21:38977030-38977052 CTGGGGAGGCAGTGTGGGGGTGG - Intergenic
1179295069 21:40054441-40054463 GTGGGGCAGCAGAAGGGTGATGG + Intronic
1179716100 21:43289433-43289455 CTGGGGAGGGAGAATTGGTAGGG - Intergenic
1179818993 21:43925525-43925547 GTGGGTAGACAAAAGGGGGAGGG + Intronic
1179867453 21:44225751-44225773 GTGGGGAGGTAGAAGGGAGGAGG + Intronic
1180068833 21:45426016-45426038 GTGGGGAAGCAGGAGGGGGCGGG - Intronic
1180132651 21:45836236-45836258 CTTTGGAGGCAGAATTGGGAGGG - Intronic
1180780729 22:18517940-18517962 GTGGGGAGGGAGGGTGGGGAGGG + Intronic
1180821066 22:18828086-18828108 GTGGTAAGGCAGAAAGGAGAGGG - Intergenic
1181030321 22:20146301-20146323 GTGGGAAAGCACACTGGGGAGGG + Intronic
1181191912 22:21147959-21147981 GTGGTAAGGCAGAAAGGAGAGGG + Intergenic
1181199624 22:21209577-21209599 GTGGGGAGGGAGGGTGGGGAGGG + Intronic
1181207285 22:21262551-21262573 GTGGTAAGGCAGAAAGGAGAGGG - Intergenic
1181400136 22:22646281-22646303 GTGGGGAGGGAGGGTGGGGAGGG - Intronic
1181471526 22:23143181-23143203 TTTGGGAGGCTGAAGGGGGAGGG + Intronic
1181566365 22:23741166-23741188 GTGTGCAGGAAGGATGGGGAGGG + Intergenic
1181600904 22:23951420-23951442 CTGTGGAGGGAGAATGGGCAGGG + Intergenic
1181607609 22:23989906-23989928 CTGTGGAGGGAGAATGGGCAGGG - Intergenic
1181649228 22:24249509-24249531 GTGGGGAGGGAGGGTGGGGAGGG + Intergenic
1181702108 22:24627379-24627401 GTGGGGAGGGAGGGTGGGGAGGG - Intronic
1181749602 22:24979779-24979801 GTGGGGAGGCGGCATGGGATGGG - Intronic
1182453290 22:30433746-30433768 ACGGGGTGGCAGAGTGGGGAGGG - Intergenic
1182519383 22:30876688-30876710 GTGGGGAGCCAGGATGGGAAAGG + Intronic
1182520315 22:30881211-30881233 GGGGGTAGGCAGAAGGGGCAGGG + Intronic
1182790961 22:32952312-32952334 GTGGACAGGCAGGGTGGGGAGGG + Intronic
1182876360 22:33694707-33694729 GTGGAGAGACAGGAGGGGGAAGG + Intronic
1183007645 22:34916630-34916652 GGAGGGAGGCAGAGAGGGGAAGG + Intergenic
1183119562 22:35719905-35719927 ATGGGGAGCCAGAAAGGGGATGG + Intronic
1183520378 22:38293329-38293351 GTGGGGAGGGAGAGAGGGGGAGG + Intronic
1183551005 22:38485303-38485325 GTGGGGAGGCAGAGTGTGAAGGG + Exonic
1183676103 22:39299645-39299667 CTGGGGAGGCAAGCTGGGGAGGG - Intergenic
1183678054 22:39310798-39310820 GTGGGGATGCTGACTGGGCAGGG - Intergenic
1183718722 22:39549784-39549806 GTGGGGAGTAAGGATGGGGTAGG - Intergenic
1183786394 22:40031386-40031408 TTAGGGAGGCAGCCTGGGGAAGG + Exonic
1184042340 22:41951560-41951582 TAGATGAGGCAGAATGGGGAGGG + Intergenic
1184355180 22:43974951-43974973 GAGGGGAGGAGGAAAGGGGAGGG + Intronic
1184455427 22:44607265-44607287 GTGGGGAAGGAGGATGGGGATGG + Intergenic
1184804818 22:46787769-46787791 GTAGAGAACCAGAATGGGGAGGG + Intronic
1184864192 22:47193233-47193255 GTGGCAAGGCAGAAAGGGGGCGG + Intergenic
1184934172 22:47706934-47706956 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1184950670 22:47840529-47840551 CTGGGGAGGCAGAAAGGGGCAGG - Intergenic
1185184737 22:49392198-49392220 GTGGAGAGACATGATGGGGAGGG - Intergenic
1185229808 22:49673554-49673576 GTGGGGAGGGGGAAGGGGAAGGG + Intergenic
1185411453 22:50685106-50685128 ATGGGAAAGCAGAATGGGGCTGG + Intergenic
1185417194 22:50716681-50716703 GTGGTGAGGCACAGAGGGGAAGG - Intergenic
1203219634 22_KI270731v1_random:32865-32887 GTGGTAAGGCAGAAAGGAGAGGG + Intergenic
1203271192 22_KI270734v1_random:53962-53984 GTGGTAAGGCAGAAAGGAGAGGG - Intergenic
949396742 3:3622569-3622591 CTGTGAAGGCTGAATGGGGAAGG - Intergenic
949617521 3:5770319-5770341 GATGGGAGCCAGAAGGGGGATGG + Intergenic
949808031 3:7976732-7976754 ATGTGGAGCCAGAAGGGGGATGG - Intergenic
950038399 3:9903426-9903448 GTGGGGAGGAGCAATGGGGCAGG - Intronic
950056814 3:10031697-10031719 AAGGGTAGACAGAATGGGGAAGG - Intronic
950085547 3:10254984-10255006 GTGGGAAGGAGGAAGGGGGAAGG - Intronic
950092077 3:10303025-10303047 CTGGGGAGGGGCAATGGGGAAGG + Intronic
950360241 3:12444807-12444829 GTGGGAAGGAAGAACGGGCAGGG - Intergenic
950442510 3:13018337-13018359 GTGGGAAGGCAGAGGGGGGCAGG + Intronic
950533184 3:13565007-13565029 TGGGGCAGGCAGGATGGGGAGGG - Intronic
950832084 3:15885040-15885062 GTGGGAAGGAAGAAAGAGGAAGG + Intergenic
951020493 3:17776968-17776990 GTGGGGATCCATATTGGGGATGG - Intronic
951106521 3:18750222-18750244 GTTGGGAGGCAGAATTGGGAGGG + Intergenic
951123558 3:18957946-18957968 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
951392527 3:22124068-22124090 GGGGTGAGGGAGAATGGGAATGG - Intronic
951418254 3:22451190-22451212 TTGGGGAGCCAGAATGCAGATGG + Intergenic
951702872 3:25513503-25513525 GAGAGGAGGCAGAATGGGAAAGG - Intronic
952101322 3:30016546-30016568 TTTGGGAGGCAGAATGGAGATGG + Intergenic
952453031 3:33449144-33449166 GTGGGGATCCATAGTGGGGATGG - Intergenic
952582284 3:34848614-34848636 GTGGGAAGGCAGACAGGGTAGGG - Intergenic
952940944 3:38443952-38443974 GTGGGGATCCATACTGGGGATGG + Intergenic
953328134 3:42029884-42029906 GTGGAGAGCCAGAATAGGGGAGG + Intronic
954290161 3:49645465-49645487 GTGGGGAGGCAGAGCTGGCAGGG - Intronic
954488993 3:50883116-50883138 GTGGGGTGGGGGAATGGGGGAGG + Intronic
954582164 3:51708764-51708786 GTGGGGAGGCAGAGTCAGAAGGG + Intronic
954586982 3:51744829-51744851 GTGGGGATCCATACTGGGGATGG - Intergenic
954619242 3:51986268-51986290 GTGAGGAGGCTGAAGGTGGAGGG + Exonic
954718754 3:52541923-52541945 GTGGGGTGGAAGCAGGGGGATGG - Intronic
954787258 3:53102976-53102998 GTGGGGAGGCCTCATGAGGAAGG - Intronic
954794225 3:53153345-53153367 GTGGGGAGGCAGAGGGAGGAAGG + Intergenic
954856958 3:53652378-53652400 TTGGGGAGGCAGAATAGGGGAGG + Intronic
955058304 3:55474862-55474884 GTGGGGAGGTAGAAGGTGGGGGG + Intronic
955162638 3:56479791-56479813 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
955756822 3:62233352-62233374 CTGGGGAGAGAGCATGGGGAAGG - Intronic
956149190 3:66223338-66223360 GTGGTGAGGCCTAATGGGTAAGG + Intronic
956172986 3:66447336-66447358 ATGGGGAGGCAGTGTGGGGCTGG - Intronic
956181141 3:66519145-66519167 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
956390830 3:68771106-68771128 ATGGGGAGTCAGAAGGGGGATGG - Intronic
956689282 3:71861105-71861127 ATGGGGAGCCTGAAGGGGGATGG - Intergenic
956735276 3:72233254-72233276 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
956842958 3:73157001-73157023 GTGGGGATCCATACTGGGGATGG + Intergenic
956870763 3:73415255-73415277 GTGGGGAGGAAGAGAGGAGAGGG + Intronic
957029275 3:75221396-75221418 GACGGGAGCCAGAAGGGGGATGG + Intergenic
957272618 3:78051345-78051367 GTGGGGAGGCAGAGGCAGGAGGG - Intergenic
957507413 3:81140816-81140838 GAAGGGAGGGAGAATGAGGAAGG + Intergenic
957758413 3:84522776-84522798 ATGGGGAGCTAGAAAGGGGATGG - Intergenic
957762971 3:84583683-84583705 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
957842686 3:85691974-85691996 GTGGGGTGGGAGAAGGGGGGAGG + Intronic
957894447 3:86403309-86403331 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
957980582 3:87504654-87504676 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
958001956 3:87761837-87761859 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
958074500 3:88658239-88658261 ATGGGGAGCCAGAAGGCGGATGG + Intergenic
958111286 3:89149625-89149647 GTGGGGAGGGGGGAGGGGGAGGG - Intronic
958168956 3:89914834-89914856 ATGAGGAGGTAGAAAGGGGATGG + Intergenic
958575811 3:95949075-95949097 GTGGGGATCCATACTGGGGATGG + Intergenic
958601388 3:96300286-96300308 GTGGGGATCCATACTGGGGATGG - Intergenic
959630198 3:108499047-108499069 GTGGGCAGCCAGATTGGGGCAGG - Intronic
959860732 3:111212083-111212105 GAGAGCAGGAAGAATGGGGAAGG - Intronic
960142100 3:114160778-114160800 GTGGGGAGGGAGAGTGTTGAAGG - Intronic
960378537 3:116932405-116932427 GTGGGAAGGGAGAATGGAAAAGG - Intronic
960501609 3:118445051-118445073 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
960506372 3:118499795-118499817 CTGGGGAGGAAGGCTGGGGAAGG - Intergenic
960736831 3:120790349-120790371 GTGGGGAGGTGGGTTGGGGATGG + Intergenic
960863023 3:122171123-122171145 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
960902144 3:122564167-122564189 GTGGGCGGGGAGAAGGGGGACGG - Intronic
961054660 3:123778044-123778066 GTGTGGAGTCAGAATAGAGAAGG - Intronic
961115353 3:124324359-124324381 ATAGAGAGGAAGAATGGGGAGGG - Intronic
961261664 3:125606866-125606888 GTGGGGATTCATACTGGGGACGG - Intergenic
961303974 3:125942506-125942528 GTGGGGTGGGAGAAGGGGGGAGG + Intergenic
961642197 3:128371678-128371700 GTTGGGGTGCAGAATGAGGAGGG + Intronic
961660274 3:128464942-128464964 GAGGGAAGGGAGAAGGGGGAAGG - Intronic
961880221 3:130056495-130056517 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
962151193 3:132895073-132895095 GTGGGGTGGGGGGATGGGGAGGG + Intergenic
962183455 3:133233181-133233203 GTGGGGTGGCGGAGCGGGGAGGG - Intronic
962347078 3:134626132-134626154 GTGGGAAGACAGGATGGGGGTGG + Intronic
962460714 3:135609993-135610015 GTTGGGTGGGAGAAGGGGGACGG + Intergenic
963234713 3:142945532-142945554 ATGGGGAGGTGGAAGGGGGATGG + Intergenic
963409219 3:144907361-144907383 GTGGGGATACATACTGGGGACGG + Intergenic
963655899 3:148049711-148049733 ATGGGGAGATAGAAAGGGGATGG - Intergenic
963706063 3:148689907-148689929 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
963808772 3:149753638-149753660 GTGTGGAGGAAGAGAGGGGAAGG + Intergenic
964064501 3:152562321-152562343 GTGGGGATCCATACTGGGGATGG - Intergenic
964378869 3:156076097-156076119 GGGTGGGGGCAGACTGGGGATGG - Intronic
964962518 3:162445623-162445645 GTGGGGTGGCAGGAGGGGGGAGG - Intergenic
965057572 3:163742221-163742243 GTGGGGTGGGGGAATGGGGGAGG + Intergenic
965094740 3:164210649-164210671 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
965165992 3:165195018-165195040 GTGGGGAGGAGGAAGTGGGAAGG - Intronic
965177415 3:165353271-165353293 GAAGAGAGGCAGAATGGGGAAGG - Intergenic
965526525 3:169725319-169725341 GTGGGGAGGAGGAATGGTGATGG - Intergenic
965535010 3:169814206-169814228 ATGGGGAGCCAGAAAGGGAATGG + Intergenic
965800695 3:172490963-172490985 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
965801726 3:172500857-172500879 GTGGGGTGGGAGGAGGGGGAGGG + Intergenic
965961979 3:174440246-174440268 GAGGGAAGGAAGAAGGGGGAAGG - Intronic
966460171 3:180167597-180167619 ATGGGGTGGGAGAGTGGGGAGGG + Intergenic
966624598 3:182002395-182002417 GTGGGGAGGGAGATGGGGGCAGG - Intergenic
966781607 3:183589017-183589039 GTGGGGAGGTAGAAAGGGACAGG + Intergenic
966943129 3:184759553-184759575 GTGGGAAGGGAGTTTGGGGAGGG - Intergenic
967344303 3:188436848-188436870 GTGAGCAGGCAGAGTGGGGTTGG + Intronic
967452771 3:189645647-189645669 GTGGGGTGGGGGAGTGGGGAGGG - Intronic
967456477 3:189692433-189692455 GTGGGGAGGGAGGAAGGGGAAGG - Intronic
968276218 3:197442306-197442328 GTGGGGAGGGAGAAGGCAGATGG + Intergenic
968647873 4:1749164-1749186 GTGGGGAGGGGGCAGGGGGAGGG - Intergenic
968741381 4:2333264-2333286 GTGGGGGGGCAGCTTGGGGAGGG - Intronic
968751476 4:2391637-2391659 TGGGGGAGGTGGAATGGGGAGGG - Intronic
968817432 4:2829275-2829297 ATAGGGAGGATGAATGGGGAAGG + Intronic
968966319 4:3770739-3770761 ATGGGGTGCCAGCATGGGGAGGG + Intergenic
968992610 4:3924850-3924872 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
969333407 4:6492963-6492985 GTGAGGAGGGAGACTGGGGAGGG - Intronic
969369211 4:6720576-6720598 GTGTGCAGACAGAGTGGGGACGG + Intergenic
969568211 4:7992639-7992661 GCAGGGAGGCAGAGTGGGGAGGG + Intronic
969711567 4:8847193-8847215 CTTGGGAGGCTGAGTGGGGAGGG + Intronic
969780150 4:9395026-9395048 GGGGGGAGGCAGAAGGGAAAAGG + Intergenic
969822741 4:9732772-9732794 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
969885243 4:10209440-10209462 GAAGGGAGACAGGATGGGGAAGG + Intergenic
969940367 4:10725542-10725564 CTGGGGAGGGGAAATGGGGATGG - Intergenic
970234437 4:13944477-13944499 ATGGGGAGCCAGAAGGGAGATGG - Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
970934626 4:21554641-21554663 GTGAGGGGGCACACTGGGGAAGG - Intronic
971099415 4:23446991-23447013 GTGGGGTGGGAGGATGGGGGAGG - Intergenic
971262621 4:25070742-25070764 GTGGGGACACAGAGTAGGGAAGG - Intergenic
971281206 4:25243870-25243892 GTGGGGATCCATACTGGGGATGG + Intronic
972073550 4:35054951-35054973 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
972133307 4:35862688-35862710 GTGGGGATCCATACTGGGGATGG + Intergenic
972369621 4:38410470-38410492 GGGAGAAGGCAGAGTGGGGATGG - Intergenic
972390251 4:38607010-38607032 ATGGGGAGTCAGAAGGGGGATGG + Intergenic
973299131 4:48560120-48560142 GTGAGGAGCAAGAATGGGAAGGG + Intronic
973668107 4:53183502-53183524 GTGGGGTGGGGGAGTGGGGAGGG + Intronic
974132286 4:57771578-57771600 GTGGGGTGGGAGGAGGGGGAAGG - Intergenic
974187311 4:58460602-58460624 GTGGGGATCCATACTGGGGATGG - Intergenic
974368639 4:60985699-60985721 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
974497986 4:62658101-62658123 GCGGGGAGGCTGAAGTGGGAGGG - Intergenic
974600814 4:64076762-64076784 ATGGGGAGGAATAATGTGGATGG + Intergenic
974877734 4:67718205-67718227 GTGGGGAGGCAGGGTGAGGGTGG + Intergenic
974993970 4:69129407-69129429 TGGGGGAGCCAGAAAGGGGACGG - Intronic
975329648 4:73099447-73099469 GTGGGGATGCAGCATGTGCAGGG - Intronic
975513063 4:75215154-75215176 GTGGGGTGGCGGGATGGGGGAGG - Intergenic
975595840 4:76047659-76047681 GTGGGGATCCATACTGGGGATGG + Intronic
975599001 4:76079696-76079718 GTGGGAAGCCATAATGGGGAGGG + Intronic
976037597 4:80843222-80843244 GTGGGGTGGCAGGCTGGGGGAGG - Intronic
976174322 4:82336534-82336556 GTGGGGATCCATACTGGGGATGG + Intergenic
976538981 4:86251317-86251339 GTGGGGAGGGAGGAGGGGGGAGG - Intronic
976545103 4:86326403-86326425 GTGGGGAGGACCAATAGGGAAGG + Intronic
976635111 4:87279564-87279586 GAGGAGAGGCAGAATGAGGCGGG + Intergenic
977140199 4:93361983-93362005 GTGGGGTGGGGGAAGGGGGAAGG - Intronic
977150705 4:93508007-93508029 GTGGGGTGGGGGAATTGGGAGGG + Intronic
977221954 4:94348048-94348070 GTGGGGTGGGGGAATGGGGGAGG + Intergenic
977568513 4:98607010-98607032 GTGGTGAGGCAGTTGGGGGAAGG + Intronic
977884091 4:102237809-102237831 GTGGGGATCCATACTGGGGATGG - Intergenic
977902622 4:102439551-102439573 GTGGAGAGGCAGAAAAGGAAGGG + Intergenic
977986759 4:103391378-103391400 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
978310141 4:107378655-107378677 ATGGGGAGACAGTAGGGGGATGG + Intergenic
978414784 4:108463778-108463800 ATGGGGAGCCAGAAGGGGTATGG - Intergenic
978529330 4:109698409-109698431 TTTGGGAGTCAGAAGGGGGATGG - Intronic
978547302 4:109885032-109885054 GTGGGGTGGGAGGAGGGGGAAGG - Intergenic
978596711 4:110385864-110385886 GTGGGGTGGGGGAATGGGGGAGG - Intronic
978621040 4:110634256-110634278 GTGGGGATCCAGGGTGGGGACGG + Intronic
978913685 4:114097081-114097103 TTGGAGACTCAGAATGGGGAAGG - Intergenic
978988448 4:115046218-115046240 ATAGGGAGGCAGAATGGGGCAGG - Intronic
979726945 4:123973575-123973597 GTGGAGTGGGAGAATGGGGGAGG + Intergenic
979751712 4:124287596-124287618 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
979781653 4:124659094-124659116 GAGGGGAGGGAGAAAGGGAAGGG - Intergenic
979827333 4:125255803-125255825 GTGGGGTGGGGGAATGGGGGAGG - Intergenic
980081033 4:128344347-128344369 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
980280658 4:130715292-130715314 GTGGGGTGGGAGAAGGGGGGAGG - Intergenic
980290901 4:130846706-130846728 GTGGGGATCCATACTGGGGACGG + Intergenic
980603134 4:135052251-135052273 TTTGGGAGGCAGAAGGGGGACGG - Intergenic
981075200 4:140584379-140584401 TTAGGGAGGAAGAATGGGGAAGG - Intergenic
981423800 4:144581083-144581105 ATGGGGAGCCAAAAGGGGGATGG - Intergenic
981443946 4:144813013-144813035 GTGGGTAGGGGGAAAGGGGAGGG + Intergenic
981457149 4:144966037-144966059 GGGGGTAGGCAGCAAGGGGAGGG + Intergenic
981528463 4:145730998-145731020 GTGCGGTGGCAGACTGTGGAGGG + Intronic
981532435 4:145765353-145765375 ATGGGGTGGAAGGATGGGGAGGG - Intronic
981585168 4:146292782-146292804 GAAGGGAGGCAGAATGGTCAGGG + Intronic
982217244 4:153093017-153093039 GTGGAGAGGGAGAATGGAGATGG - Intergenic
982325809 4:154127277-154127299 GTGGGGAGCTAGAAAGGGGATGG + Intergenic
982826826 4:160012504-160012526 GTGGGGTGGGGGAGTGGGGATGG + Intergenic
982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG + Intergenic
983272917 4:165584161-165584183 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
983763229 4:171440437-171440459 GTGTAGGGGCAGAAGGGGGATGG - Intergenic
983834936 4:172374662-172374684 GTGGGGATCCATACTGGGGATGG + Intronic
983905169 4:173174145-173174167 GTGTGGGGGGAGAAGGGGGATGG - Intronic
984105554 4:175541175-175541197 GAGGGGAGCTAGAAAGGGGATGG + Intergenic
984139997 4:175993138-175993160 GAGGGGAGGGAGAGAGGGGAGGG - Intronic
984438634 4:179736840-179736862 GTGGGGTGGGAGGATGGGGGAGG - Intergenic
984706023 4:182847830-182847852 GCAGGGAGGCTGAGTGGGGAAGG + Intergenic
984718462 4:182947962-182947984 GCGGGTGGGCAGCATGGGGAGGG + Intergenic
984760077 4:183356361-183356383 GGAGGGAGGCAGAAAGGAGAAGG - Intergenic
984917444 4:184736945-184736967 GTGGGGATCCATACTGGGGATGG - Intergenic
984958630 4:185071867-185071889 GTGGGGAGGCATCAGGGGAAAGG - Intergenic
985913450 5:2900533-2900555 CTGGGGAGGGAGAAAGTGGAGGG - Intergenic
985935041 5:3091127-3091149 GTGGGGTGGCAGGAAGGGGAGGG - Intergenic
986021996 5:3812946-3812968 GTGGGGAGGCAGGATGGGAGTGG + Intergenic
986161593 5:5234420-5234442 GTGGTGAGGCAGGGTGGGCAGGG - Intronic
986165274 5:5267444-5267466 ATGGGGAGCCAGAAAGGGGATGG + Intronic
986495073 5:8333202-8333224 ATGGGCAGGCAGAGTGGGTAGGG + Intergenic
986933303 5:12853975-12853997 GTGGGGATCCATACTGGGGATGG - Intergenic
987005705 5:13707253-13707275 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987212137 5:15693838-15693860 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987223580 5:15816490-15816512 GTGGGGAGGTGAAGTGGGGAAGG + Intronic
987475508 5:18387599-18387621 GTGGGTAGGGGGAGTGGGGATGG - Intergenic
987524559 5:19030774-19030796 GTGAGGAGGAAGAAGGGAGAAGG - Intergenic
987560502 5:19513988-19514010 ATGGGGTGGGAGAATGGGGGAGG - Intronic
987764022 5:22201952-22201974 GTGGGAAGTCAGAAGTGGGAAGG + Intronic
987875857 5:23680435-23680457 GTGGGGAGGTAGCATTTGGACGG + Intergenic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988357795 5:30200115-30200137 GTGGGGATCCATACTGGGGATGG - Intergenic
988801191 5:34698136-34698158 GAAGGGAGGCAGAGAGGGGAGGG - Intronic
989496236 5:42113825-42113847 GTGGGGATCCATACTGGGGATGG - Intergenic
989666684 5:43862596-43862618 GTGAGGTGGCAGGATGGGGTGGG + Intergenic
989685042 5:44075377-44075399 GTGGTGAGGCAAACTGGGGTGGG + Intergenic
989745490 5:44824649-44824671 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
989964373 5:50451076-50451098 GTGGGGATCCATACTGGGGATGG + Intergenic
989973019 5:50547066-50547088 GTGGGGTGGGGGAATGGGGGAGG + Intergenic
990022326 5:51142887-51142909 GTGGGGTGGAAGGATGGGGGAGG + Intergenic
990352642 5:54934275-54934297 ATGGGGTGGCAGCAGGGGGAAGG + Intergenic
990367877 5:55088666-55088688 GTGGGGATCCATACTGGGGATGG + Intergenic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
990541093 5:56772826-56772848 GTGGGAAGGCAGCATCGGGTTGG + Intergenic
990778099 5:59326116-59326138 GTGGGGTGGGAGGAGGGGGAAGG + Intronic
990873043 5:60454644-60454666 GTTGGGAGGCAGTGAGGGGAAGG + Intronic
991070858 5:62479078-62479100 GTGGGGTGGTGGAATGGGGGAGG - Intronic
991297055 5:65092862-65092884 TTGGGGTGGCAGATGGGGGAGGG - Intergenic
991368795 5:65896524-65896546 GAGGGGATGATGAATGGGGATGG + Intergenic
991634391 5:68689826-68689848 TTGGGGAGTCAGAGTTGGGAGGG - Intergenic
992093648 5:73340611-73340633 TGGGGGAGGCAGAAGGGGGATGG - Intergenic
992232566 5:74677857-74677879 GTGGAGACTCAGAAAGGGGAGGG - Intronic
992455191 5:76910009-76910031 GTGGGGATCCATACTGGGGATGG - Intronic
992652412 5:78872665-78872687 GTGGGGAGGGGGAGGGGGGAGGG + Intronic
992666030 5:79010564-79010586 CTGGGGTGGCAGAGTGGGGCTGG - Intronic
992672752 5:79076138-79076160 ATGGGGAGCCAGAAGGGGGATGG + Intronic
992765029 5:79990857-79990879 CTGGGGATGCAGAGTAGGGAGGG + Intronic
992804100 5:80320023-80320045 GTGGGGAGGAAGGGTGGGAAAGG - Exonic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
992972741 5:82079507-82079529 GTGGGGTGGGGGATTGGGGAGGG - Intronic
993038346 5:82783489-82783511 GTGGGGAAGCAGGATAGGAAAGG + Intergenic
993188104 5:84645940-84645962 ATGGGGAGCCAGAAGAGGGATGG - Intergenic
993188991 5:84656936-84656958 GTGGGGAGGGAGGATGGTGTGGG + Intergenic
993333454 5:86627905-86627927 TAGGGTAGGGAGAATGGGGATGG + Intergenic
993492474 5:88568931-88568953 GTGGGTCGGCAGAAGGGGGAGGG + Intergenic
993592177 5:89807782-89807804 GTGGGGGGGAAGAAGGGAGAGGG + Intergenic
993804602 5:92388710-92388732 GTGGGGTGGGGGAATGGGGGAGG + Intergenic
993937734 5:94024551-94024573 GTGGGGTGGCGGGCTGGGGAGGG - Intronic
994385339 5:99124782-99124804 GTGGGGTGGCGGGAGGGGGAAGG - Intergenic
994639563 5:102389984-102390006 TTGGGGAGGCTGAGTGAGGAGGG - Intronic
994948349 5:106425524-106425546 GTGGGGTGGGGGAATGGGGGAGG - Intergenic
995186491 5:109277159-109277181 GTGGGGTGGCAGGAGGGGGGAGG + Intergenic
995636414 5:114197673-114197695 GCTGGGAGGCAGAATAGGGGTGG + Intergenic
995795980 5:115941883-115941905 GTGGGGTGGGGGAATGGGGGAGG - Intergenic
995838481 5:116421435-116421457 TTGGGGAGGGTGACTGGGGAAGG + Intergenic
995945396 5:117638934-117638956 GAGGGGAGGCAGACCAGGGATGG - Intergenic
996012450 5:118495882-118495904 GTGGGGTGGGGGAAGGGGGAAGG + Intergenic
996171690 5:120300602-120300624 TTGAGGAGGTGGAATGGGGATGG + Intergenic
996228898 5:121036739-121036761 GTGGGGTGGGAGAGGGGGGAGGG - Intergenic
996256273 5:121408039-121408061 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
996340138 5:122428735-122428757 GTGGGGTGGGGGGATGGGGAAGG - Intronic
996359567 5:122630941-122630963 TTGGGGTGGCAGGATGGGGGAGG - Intergenic
996486598 5:124042268-124042290 CTGGGGAGCCAGAAGGGAGATGG - Intergenic
996650898 5:125874693-125874715 GTGAGGAAGCAGAATAGGGCTGG + Intergenic
997072391 5:130636108-130636130 GTGGGGATCCATACTGGGGATGG - Intergenic
997238269 5:132288118-132288140 GTCGGCAGGGAGGATGGGGAAGG + Intronic
997612325 5:135223872-135223894 GTGGGGAGGGAGAGAAGGGATGG + Intronic
997879761 5:137579159-137579181 GCTGGGAGCCAGTATGGGGAGGG - Intronic
998028014 5:138837501-138837523 GAGGGGAGGGAGGAGGGGGAGGG - Intronic
998915052 5:147003658-147003680 GTGGGGATCCATACTGGGGATGG - Intronic
999221213 5:149979336-149979358 GTGGGGAGGGAGAGTGAAGATGG + Intronic
999507485 5:152213169-152213191 GTGGGGAGGCGGGAGGGGGGAGG + Intergenic
999622981 5:153490975-153490997 GTGAGGGGGCAGCCTGGGGAGGG + Intronic
999658081 5:153829991-153830013 GTGGGGGGGAAGGTTGGGGAGGG + Intergenic
999965347 5:156803528-156803550 TTGGGAAACCAGAATGGGGAGGG + Intergenic
999977026 5:156922000-156922022 TTGGGGAGGGATAAAGGGGAAGG + Intronic
1000085219 5:157882532-157882554 GTGGGGATCCATACTGGGGATGG - Intergenic
1000234449 5:159344555-159344577 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
1000355964 5:160396138-160396160 GTGGGGTGGAAGAGTGGGGTGGG - Intronic
1000379302 5:160614669-160614691 CTGAGGAGGGAGAATGGGGTTGG - Intronic
1000470202 5:161631079-161631101 ATGGGGGGCCAGAAGGGGGATGG + Intronic
1000658892 5:163915412-163915434 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1000699208 5:164427454-164427476 GTGGGGTGGGGGAATGGGGGAGG - Intergenic
1000852882 5:166362125-166362147 GTGGGGAGCTGGAAAGGGGATGG + Intergenic
1001320940 5:170680928-170680950 GGAGGGAGGCAGAAAGAGGAAGG + Intronic
1001590317 5:172860333-172860355 GTGAGGGGGCAGAATGGTGCAGG - Intronic
1001614261 5:173029864-173029886 GAAGGAAGGCAGACTGGGGAGGG - Intronic
1001619564 5:173071945-173071967 CTTGGGAGGCAGAAGTGGGAGGG + Intronic
1001732652 5:173971908-173971930 GTGTGGAGGCAGCAGGGGGAGGG + Intergenic
1001896814 5:175389491-175389513 GTGGGGTGGCGGAATGGGGGAGG - Intergenic
1002051437 5:176573871-176573893 GTGGAGAGGCTGTGTGGGGAGGG + Intronic
1002092173 5:176812028-176812050 CTGAGGAGGCAGGATGGGGCGGG - Intronic
1002093721 5:176818810-176818832 GTCAGGAGGCAGCATGGGGATGG - Intronic
1002308214 5:178296726-178296748 GAGGGGTGGCAGAGTGGGAATGG + Intronic
1002314307 5:178333467-178333489 GTGGGGAGGCAGCCTGGATAAGG - Intronic
1002416657 5:179124357-179124379 GCTGGGAGGAAGAATGAGGATGG - Intronic
1002454901 5:179340279-179340301 GTGGGGAGGCAGAGGCGGGCAGG + Intronic
1002471215 5:179437385-179437407 CTTGGGAGGCAGAGTGGCGAAGG - Intergenic
1002475712 5:179464583-179464605 ATGGGGAGCCAGAAGGGGAATGG + Intergenic
1003020520 6:2505190-2505212 GGGGGGAGGAAGGATGGGGGAGG - Intergenic
1003230896 6:4252819-4252841 GTGGGGTGGGGGAAGGGGGAAGG + Intergenic
1003485796 6:6578049-6578071 TTTGGGAGGCAGAAGTGGGAGGG + Intergenic
1003649226 6:7943325-7943347 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1003676753 6:8211889-8211911 GTGAGAAGGCAGAATGGGAATGG + Intergenic
1003754738 6:9104266-9104288 GTGGGCAGGCAAAGAGGGGAGGG + Intergenic
1003805777 6:9724810-9724832 GTGGGGATCCATACTGGGGATGG - Intronic
1004170671 6:13293323-13293345 TTGGGGACTCAGAAGGGGGAGGG + Intronic
1004531349 6:16458196-16458218 GTGGGGATCCATAATGGGGATGG - Intronic
1004580449 6:16946273-16946295 GCAGGCAGGCAGATTGGGGAAGG - Intergenic
1004812227 6:19273729-19273751 GTGGGGATCCATATTGGGGATGG - Intergenic
1005492971 6:26363719-26363741 TTGGGGAGGGGGAAGGGGGAGGG + Intergenic
1005744291 6:28821960-28821982 GTAGGGAGGCAGAAGCGGGCAGG + Intergenic
1005825221 6:29628121-29628143 CTGGGGAGGCAGGAAGGGGGCGG + Intronic
1005825266 6:29628264-29628286 GAGGGGAGGAGAAATGGGGACGG + Intronic
1005969468 6:30749876-30749898 TGGCGGAGGCAGAATGGGCAGGG + Intergenic
1006113290 6:31761725-31761747 GTGGGGAGGGAGAAAAGGGAAGG - Intronic
1006187873 6:32190823-32190845 GTGGGGAGGGAGGGTGGGCAGGG + Exonic
1006337109 6:33426598-33426620 TTGGGGGGGCAGAAAGGGGGAGG - Intronic
1006347900 6:33498075-33498097 GTGGGAAGGCTGAGTGGGGTGGG - Intergenic
1006503977 6:34476413-34476435 GGGGGGAGGGAGTGTGGGGAGGG - Intronic
1006527280 6:34617705-34617727 GTAGGGAGTGAGAATGGGTAGGG - Intronic
1006964500 6:37968695-37968717 GCGGGAAGGCGGAAGGGGGAAGG - Intronic
1007030021 6:38618926-38618948 GTGGGGATCCATACTGGGGACGG - Intronic
1007155836 6:39742404-39742426 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1007381784 6:41494927-41494949 GGGGGGAGGCAGAGGGGGAAGGG + Intergenic
1007791630 6:44312325-44312347 GTGGGGAGTGAGGATAGGGATGG + Intronic
1008237527 6:49068324-49068346 GTGGGTGGGCAGACTGAGGATGG + Intergenic
1008587005 6:52959533-52959555 GTGGGGATCCATACTGGGGATGG + Intergenic
1008595737 6:53039944-53039966 AAGGTGAGGCATAATGGGGAGGG + Intronic
1008744406 6:54651800-54651822 GTGGGGTGGCGGGAGGGGGAGGG + Intergenic
1009189786 6:60616637-60616659 GTGGGGTGGGAGGATGGGGGAGG - Intergenic
1009229708 6:61047545-61047567 GTGGGGTGGGAGGATGGGGGAGG - Intergenic
1009470790 6:64027137-64027159 GTGGGGATCCATACTGGGGATGG - Intronic
1009599755 6:65783488-65783510 GTGGGAAGGAAAAAGGGGGAGGG - Intergenic
1009847906 6:69157014-69157036 GTGGCGCAGCAGAATGGTGAAGG + Intronic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010121466 6:72380246-72380268 GTGGGGTGGAAGGATGGGGGAGG + Intronic
1010369480 6:75090388-75090410 GAGGGGTTGCAGAATGGAGATGG - Intronic
1010621259 6:78078655-78078677 GTGGGGTGGGGGAATGGGGGAGG - Intergenic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1011149157 6:84249934-84249956 GTGGGGAGGCAGTGTTGGCAGGG + Intergenic
1011375060 6:86678873-86678895 GTGGGGATCCATACTGGGGATGG + Intergenic
1011380525 6:86737869-86737891 GTGGGGTGGGGGAGTGGGGAGGG + Intergenic
1011525477 6:88259615-88259637 GGGGGGAGGCGGAAGGGGGGAGG + Intergenic
1011771285 6:90676225-90676247 TTGGGGAGGGAGAAGGAGGATGG + Intergenic
1011803684 6:91047290-91047312 GTGGGGTGGGAGGAGGGGGAAGG - Intergenic
1011888316 6:92125768-92125790 GGAGAGAGGCAGAATGGGGTGGG - Intergenic
1012151912 6:95764252-95764274 GTGGGGTGGCGGGATGGGGGAGG + Intergenic
1012218351 6:96616901-96616923 GTGTGGGGGAAGAGTGGGGAGGG - Intergenic
1012319046 6:97819806-97819828 AAGGGGAGGCAGAACAGGGAAGG - Intergenic
1012440198 6:99255180-99255202 TGGGGGAGGCAGAAGGGAGACGG - Intergenic
1012757753 6:103253123-103253145 GTGGGGTGGGAGAGGGGGGAGGG + Intergenic
1013189386 6:107789384-107789406 GTGGGGAGGCAGGATGGGCTGGG - Intronic
1013236953 6:108205542-108205564 GTGGGGAGGCAGAGAGGTGGAGG - Intergenic
1013385217 6:109621741-109621763 GTGGGGAGGGGGGATGGGGGAGG + Intronic
1013869784 6:114743156-114743178 GTGTGGAGGGGGAGTGGGGAGGG - Intergenic
1013878298 6:114861884-114861906 GTGGGGAAGCAGAGCAGGGAAGG + Intergenic
1013907862 6:115238634-115238656 GTGGGGATCCATACTGGGGATGG + Intergenic
1013933830 6:115569680-115569702 GTGGGGTGGGGGAATGGGGGAGG - Intergenic
1013977407 6:116093604-116093626 GTGGGGATCCATACTGGGGATGG - Intergenic
1014403928 6:121024856-121024878 GTGGGGTGGGGGAATGGGGAAGG + Intergenic
1014571146 6:123009622-123009644 GGGAAGAGGCAGGATGGGGAGGG - Intronic
1014778127 6:125533788-125533810 TTGGGGAGGCAGAAAGGGGCAGG + Intergenic
1014786241 6:125623234-125623256 GGAGTGAGGCAGGATGGGGAAGG + Intergenic
1014809422 6:125869311-125869333 GTGGGGGGGAAGACTGGGGAGGG - Intronic
1015042867 6:128742809-128742831 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1015043857 6:128755543-128755565 GTGGGGTGGCAGGATGGGGGAGG + Intergenic
1015288549 6:131511435-131511457 ATGGGGAGCTAGAAAGGGGATGG - Intergenic
1015792950 6:136982307-136982329 GTGGGGAGGTAGGACAGGGAAGG + Intergenic
1015855610 6:137621587-137621609 GTGGGGAGGCAGATTATGGAGGG - Intergenic
1015891757 6:137976779-137976801 GTAGGGAGGCAGGATGGGAAAGG - Intergenic
1016161315 6:140883979-140884001 GGGAGGAGGAAGAAAGGGGAGGG - Intergenic
1016184014 6:141178676-141178698 GTGGGGATCCATACTGGGGATGG - Intergenic
1017008429 6:150044954-150044976 GTGGGGAGGAAGAGTGGGAGGGG - Intergenic
1017614224 6:156227661-156227683 GTGGGGAGGGGAAGTGGGGATGG + Intergenic
1017980135 6:159394173-159394195 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1018111529 6:160541000-160541022 GTGGGGAGGAAGGAAGGGGAGGG + Intronic
1018115490 6:160579626-160579648 CTTGGGAGGCATAATGGGGAAGG - Intronic
1018143036 6:160858810-160858832 GTGGGGTGGCAGGGTGGGGGGGG - Intergenic
1018245253 6:161816351-161816373 AAGGGGAGGCAGAGTGGGGTGGG + Intronic
1018323347 6:162636850-162636872 GTCGGGAGGCCGAAGTGGGAGGG + Intronic
1018754873 6:166840358-166840380 GTGGGGAGGTAGAGAGAGGAAGG - Intronic
1018829556 6:167432932-167432954 ATGGGGTGGCAGAGTGTGGATGG + Intergenic
1018829681 6:167433462-167433484 GTGGGGTGGCAGAGTGTGGATGG + Intergenic
1019057826 6:169235878-169235900 TGGGGGAGGGAGAATGTGGATGG - Intronic
1019153801 6:170025753-170025775 ATGGGGAGGGAGCATGTGGACGG + Intergenic
1019353026 7:564088-564110 GTGGGGAGACTGAACAGGGAGGG - Intronic
1019445445 7:1068634-1068656 GTTGGGGGGAAGACTGGGGATGG - Intronic
1019508355 7:1404804-1404826 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019508370 7:1404838-1404860 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019508385 7:1404872-1404894 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019508400 7:1404906-1404928 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019522735 7:1468021-1468043 ATGGGGAAGGAGGATGGGGAGGG - Intergenic
1019556185 7:1632726-1632748 GGGGGGAGGCAGAAGAGGCAAGG - Intergenic
1019637178 7:2082160-2082182 GAAGGGAGGCAGGAGGGGGAGGG + Intronic
1019717474 7:2546330-2546352 CTCGGGAAGCTGAATGGGGAGGG + Intronic
1019738956 7:2663424-2663446 ATGGGAGGGCAGAGTGGGGAGGG + Exonic
1019873856 7:3791620-3791642 GTGGGGAGGACGATTGGAGAAGG + Intronic
1019964079 7:4484679-4484701 GAGGGGAGGGAGAAAGAGGATGG + Intergenic
1020007962 7:4792309-4792331 GGGCGGAGCCAGAGTGGGGAGGG - Intronic
1020315256 7:6901206-6901228 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1020787116 7:12587348-12587370 GTGGGGAGTGAGGATGAGGATGG + Intronic
1020918343 7:14227603-14227625 GGAGGGAGGCAGAAAGGAGAAGG + Intronic
1021303852 7:19006725-19006747 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1021923430 7:25510627-25510649 GTGGGTGGGCTGAGTGGGGATGG + Intergenic
1022047393 7:26632981-26633003 GTGGGGTGGGAGGAGGGGGAAGG - Intergenic
1022461533 7:30612841-30612863 GTGGGAAGGCATATTGGGGCTGG + Intronic
1022508513 7:30921388-30921410 GTGGGGAGGAAGAAGAGAGAAGG + Intronic
1022877794 7:34552885-34552907 GTGGTGATGCAGCAGGGGGAGGG - Intergenic
1022941129 7:35240619-35240641 GTGAGAAGGCAGATTGGGGTAGG + Intronic
1022992760 7:35724910-35724932 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1023077975 7:36502249-36502271 GTGGGGATCCATACTGGGGATGG + Intergenic
1024465616 7:49709114-49709136 GTGGGGATGTAGCCTGGGGAAGG + Intergenic
1024594519 7:50920854-50920876 GAGGGGAGGCAGGGAGGGGAAGG - Intergenic
1025143822 7:56487285-56487307 TTTGGGAGGCTGAGTGGGGAGGG + Intergenic
1025238874 7:57255121-57255143 GTGGGGTGGCGGAAGGGGGGAGG + Intergenic
1025969249 7:66306955-66306977 GTGGGGAGGCTGAAGTGGGTGGG - Intronic
1026111066 7:67459302-67459324 ATGGGGATCCAGAAGGGGGATGG + Intergenic
1026248407 7:68644917-68644939 ATGGGGAGCTAGAAGGGGGATGG - Intergenic
1026272018 7:68844936-68844958 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1026902057 7:74042922-74042944 GTGGGGAGGCAGAAGGGCCCGGG - Intronic
1027397147 7:77767780-77767802 AGGGGGAGGGAGAAGGGGGAGGG - Intronic
1027397165 7:77767818-77767840 GGGGGGAGGGAGAAGGGGGGAGG - Intronic
1027397172 7:77767832-77767854 GGGGGGAGGGAGAAGGGGGGAGG - Intronic
1027964409 7:84987579-84987601 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
1028141131 7:87275602-87275624 CTCAGGAGGCAGAATGGGAAGGG + Intergenic
1028427536 7:90706968-90706990 ATGGGGAGGCAGGACAGGGAGGG - Intronic
1028495245 7:91453812-91453834 GTGGGGATCCATACTGGGGATGG + Intergenic
1028621628 7:92834192-92834214 GTGGGGCCGCAGAATGTGGGTGG + Intronic
1028687606 7:93609654-93609676 GTGGGGCAGGAGAATGAGGATGG + Intronic
1028929059 7:96392670-96392692 GGGCGGGGGCGGAATGGGGAGGG - Intergenic
1029110398 7:98210948-98210970 GTGGGGAGGCTGTCGGGGGACGG + Intergenic
1029611601 7:101629567-101629589 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1029663387 7:101978634-101978656 GTGGGGTCACAGAATGTGGAAGG - Intronic
1030214038 7:107025115-107025137 GGGGGAAGGCAGGCTGGGGAGGG + Intergenic
1030420496 7:109301710-109301732 GTGGGGATCCATACTGGGGATGG - Intergenic
1030433988 7:109491414-109491436 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1030616651 7:111744375-111744397 GTGGGGAGGTGGACTGGAGAGGG - Intronic
1030762605 7:113370015-113370037 GTGAGGAGCCAGGAAGGGGAGGG - Intergenic
1031107196 7:117559166-117559188 GTTTGGAGGAAGAATGGGAAAGG - Intronic
1031216401 7:118898762-118898784 GTTGGGTGGCAGACTGGAGAGGG - Intergenic
1031232308 7:119123647-119123669 ATGGGGAGCCAGCAGGGGGATGG - Intergenic
1031379412 7:121067256-121067278 GTGGGGTGGGGGAATGGGGGAGG - Intronic
1031503933 7:122557523-122557545 ATCCTGAGGCAGAATGGGGAGGG + Intronic
1031712651 7:125068270-125068292 GTGGGGAGCTGGAAAGGGGATGG + Intergenic
1031731763 7:125310336-125310358 GTGGGGATCCATACTGGGGATGG - Intergenic
1031990756 7:128197453-128197475 GAGGGGAGGCAGAAGAGGGTGGG + Intergenic
1032065778 7:128769300-128769322 GAGAGGAGGAGGAATGGGGACGG - Exonic
1032220124 7:129988156-129988178 GAGGCGAGGAAGGATGGGGAAGG + Intergenic
1032578874 7:133084986-133085008 CTGGGGAGGCTGAACTGGGAGGG - Intergenic
1032755766 7:134889331-134889353 GTGGGCAGACAGACTGGTGATGG - Intronic
1033354374 7:140587583-140587605 AAGGGGAGGGAGAATGGGGCTGG - Intronic
1033759267 7:144422409-144422431 GTGGGGATCCATACTGGGGATGG + Intergenic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1034263890 7:149772484-149772506 GAGGGGAGACGGAGTGGGGAGGG - Intronic
1034579998 7:152033768-152033790 GTGGGGATCCATACTGGGGATGG + Intronic
1034613535 7:152394327-152394349 GTGGGGAGTCAGATTGTGCAGGG - Intronic
1034752373 7:153582873-153582895 TGGGGAGGGCAGAATGGGGATGG + Intergenic
1034931301 7:155166005-155166027 CTGGGGAGCCAGAAGGGGGATGG - Intergenic
1034947098 7:155269348-155269370 GTGGGGTTAGAGAATGGGGAGGG + Intergenic
1034978549 7:155461512-155461534 GTTGGGAGGCACAGTGGGGAGGG + Intronic
1035238066 7:157512914-157512936 GTGGGGTGGGAGAAGGAGGAGGG + Intergenic
1035249175 7:157585748-157585770 GAGGGGAGGAGGAGTGGGGATGG + Intronic
1035606155 8:930931-930953 GTGGGGAGGGAGGCAGGGGAAGG + Intergenic
1035646693 8:1228077-1228099 GTGGGGTGGGGGAATGGGGGAGG + Intergenic
1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG + Intergenic
1036011570 8:4731217-4731239 GTGTGGAGGCTGAGTGGGAAAGG - Intronic
1036101859 8:5795690-5795712 ATGGGGAGAGAGAAGGGGGATGG - Intergenic
1036124263 8:6048659-6048681 GTGGAGAGGCTGAATGCAGAGGG + Intergenic
1036463493 8:8974735-8974757 TTGGGGAGGGTGAAGGGGGAGGG - Intergenic
1036734376 8:11297649-11297671 GTGGTGAGGCACAGTGGTGAAGG + Intronic
1037175889 8:15945438-15945460 ATGGGGAGCTAGAAGGGGGATGG - Intergenic
1037221969 8:16534614-16534636 GTGGGGAGGGAGGAGGGGGGAGG + Intronic
1037481991 8:19313865-19313887 GTGGGGTGGGAGTAGGGGGAAGG + Intronic
1037502202 8:19496977-19496999 GAGGGGAGGCGGGAGGGGGAGGG - Intronic
1037831838 8:22194420-22194442 GTGGGGACACAGGATGGGGTGGG - Intronic
1037920279 8:22801006-22801028 TTGGGGAGGCTGGATGGGCAGGG - Intronic
1038134832 8:24773884-24773906 AAGGGGAGGGAGAAAGGGGAGGG + Intergenic
1038162482 8:25053004-25053026 TTAGCCAGGCAGAATGGGGAAGG - Intergenic
1038301173 8:26350506-26350528 CTGGGGAGGCTGAAGTGGGAAGG - Intronic
1038570467 8:28657918-28657940 ATGGGAAGGCAGAAAGAGGAAGG - Intronic
1038638770 8:29307493-29307515 GTGGGGATCCATACTGGGGATGG - Intergenic
1038866631 8:31445372-31445394 GTGGGGTGGGAGGAGGGGGAGGG + Intergenic
1039086315 8:33783604-33783626 TGGGGGAGCCAGAAGGGGGATGG + Intergenic
1039290443 8:36088867-36088889 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
1039604035 8:38866240-38866262 CAGGGGAGGCAGACTGGGGAAGG + Intergenic
1039693194 8:39882981-39883003 GTGGGGATCCATAATGGGGATGG + Intergenic
1039816460 8:41099131-41099153 GTGGGATATCAGAATGGGGAGGG - Intergenic
1039988632 8:42468749-42468771 GTGGGGTGGCAGAGTGTGGCTGG + Intronic
1040011015 8:42661295-42661317 GGGAGGAGGGAGAATGGGGGTGG - Intergenic
1040602361 8:48897362-48897384 ATGGGGAGCAAGAAGGGGGATGG + Intergenic
1040607997 8:48954044-48954066 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1040648933 8:49428840-49428862 GTGGGGATCCATACTGGGGACGG - Intergenic
1040965081 8:53074580-53074602 GTGGGGATCCATACTGGGGATGG + Intergenic
1040971483 8:53141065-53141087 GTGGGGATCCATACTGGGGAAGG + Intergenic
1040999961 8:53440347-53440369 GTGGGGATCCATACTGGGGATGG + Intergenic
1041001884 8:53462096-53462118 GTGGGGATCCATACTGGGGATGG - Intergenic
1041011445 8:53547598-53547620 GAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1041166552 8:55098136-55098158 GGGGAGAGTAAGAATGGGGAAGG + Intergenic
1041918302 8:63157864-63157886 ATGGGGAGTCAGAAAGGGGATGG + Intergenic
1041924380 8:63221548-63221570 GGGGGGAGGGGGAAAGGGGAGGG - Intergenic
1042074867 8:64981282-64981304 GTAGTGAGGAAGAATGGGGAGGG + Intergenic
1042224375 8:66504125-66504147 GTGGGGAGGGAGAATGGGGAGGG - Intronic
1042238696 8:66640780-66640802 GTGGGGAGCTGGAAAGGGGATGG - Intronic
1042486453 8:69351523-69351545 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
1042508762 8:69589709-69589731 GTGGGAAGGCACAAGGGAGAGGG + Intronic
1042919589 8:73908528-73908550 GTGGGGATTCATACTGGGGACGG - Intergenic
1043011834 8:74890708-74890730 GAGGGGAGGGAAAGTGGGGAGGG - Intergenic
1043257031 8:78150090-78150112 GTGGGGATCCATAATGGGGATGG - Intergenic
1043333250 8:79142832-79142854 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
1043526656 8:81104936-81104958 GTGGGGAGTGAGACTGGAGATGG - Intronic
1044489340 8:92793577-92793599 CTGGGGAGCCAGACTAGGGATGG + Intergenic
1044837783 8:96313051-96313073 TTTGGGAGGTAGAAAGGGGAAGG + Intronic
1045344912 8:101285174-101285196 GTGGGGAGGTGGCACGGGGAAGG - Intergenic
1045345772 8:101292246-101292268 GTGGAGAGGCCACATGGGGAGGG - Intergenic
1045503230 8:102759047-102759069 GAGGGGAGGCCAAAGGGGGAGGG + Intergenic
1045581304 8:103483286-103483308 GTGGGGATGGGGAATGGGAAGGG + Intergenic
1045858529 8:106791072-106791094 GTGGGGATCCATACTGGGGATGG - Intergenic
1046065096 8:109186877-109186899 CAGGAGAGGCAGAATGGAGAGGG - Intergenic
1046174683 8:110560050-110560072 ATGGGGAGCCAGAAGGTGGAGGG + Intergenic
1046206173 8:111000695-111000717 GTGGGGTGGAGGAAGGGGGAGGG - Intergenic
1046277442 8:111982237-111982259 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1046582522 8:116110870-116110892 ATGGGGAGCTAGAAAGGGGATGG - Intergenic
1047203695 8:122786700-122786722 GGGGGGAGGCAGAAGGGGAATGG - Intronic
1047416207 8:124666710-124666732 GGGTGGAGGGAGAATGAGGAGGG + Intronic
1047586521 8:126279690-126279712 ATGGGGAGCCAGAAGGGAGATGG - Intergenic
1047931173 8:129729452-129729474 GTGGGGTGGGAGAAGGGGGGAGG - Intergenic
1048616084 8:136076887-136076909 GAGGGGAGGTGGAAAGGGGATGG + Intergenic
1048976332 8:139674916-139674938 GAGGGGATCCAGAGTGGGGAAGG - Intronic
1049163242 8:141111105-141111127 GTGGGTATGCAGAATAGGGTGGG + Intergenic
1049265770 8:141667105-141667127 CTGGGGAGGCAGGATGGGAGTGG + Intergenic
1049315824 8:141966818-141966840 GTGGGGATGGAGGAAGGGGATGG + Intergenic
1049447849 8:142639651-142639673 GTGGAGCAGCAGACTGGGGATGG + Intergenic
1049451542 8:142664706-142664728 GAAGGGAGGCAGAAGGGGGACGG - Exonic
1050266865 9:3900126-3900148 GTGGGGAGGTGGAAATGGGAAGG + Intronic
1050472671 9:6008360-6008382 GTGAGGGGGGAGAAAGGGGAGGG + Intergenic
1050497324 9:6258169-6258191 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1050772807 9:9224308-9224330 ATGGGGAGGGAGAAAGGGAAAGG + Intronic
1051295671 9:15593014-15593036 GTGGGGTGGGGGAGTGGGGAGGG - Intronic
1051846743 9:21459599-21459621 GTGGGGTGGGGGAATGGGGGAGG + Intergenic
1051887167 9:21905266-21905288 GTGGTGAGCCAGAAGGGGAATGG + Intronic
1051926099 9:22328635-22328657 GTGGGGTGGGGGAATGGGGGAGG - Intergenic
1051935252 9:22437055-22437077 GTGGGGATCCATACTGGGGACGG - Intergenic
1052081790 9:24214934-24214956 GTGGGGAGGGGGAAGGGGGGAGG + Intergenic
1052212945 9:25929436-25929458 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
1052261533 9:26522195-26522217 GTGGGGTGGGGGAATGGGGGAGG - Intergenic
1052506874 9:29366505-29366527 GTGGGGTGGGAGGGTGGGGAGGG + Intergenic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1052778402 9:32755813-32755835 GCGGGGAGCCAGAAGGGAGATGG + Intergenic
1052793653 9:32902287-32902309 GTGGGGAGCTAGAAGGGGGATGG - Intergenic
1052850807 9:33377363-33377385 GTGTGGAGGCTGAATTGGAAGGG - Intergenic
1053161971 9:35819451-35819473 GTGGGGATGGAGGATGGGGTTGG - Intronic
1053428714 9:38027835-38027857 CTGGGGAGGCAGAAGGGACAGGG + Intronic
1053525511 9:38826230-38826252 GAGGGGAGCCAGAGGGGGGATGG - Intergenic
1053670807 9:40359337-40359359 GTGGGGGAGCAGGATGGAGATGG - Intergenic
1053908958 9:42876026-42876048 GTGGGGTGGAGGAAGGGGGAAGG - Intergenic
1054197740 9:62050657-62050679 GAGGGGAGCCAGAGGGGGGATGG - Intergenic
1054513806 9:66016964-66016986 GTGGGGGAGCAGGATGGAGATGG + Intergenic
1054640614 9:67537715-67537737 GAGGGGAGCCAGAGGGGGGATGG + Intergenic
1054943281 9:70767538-70767560 TTAGGCAGGCACAATGGGGATGG + Intronic
1055121382 9:72664694-72664716 GTGGGGAGCTGGAAAGGGGATGG - Intronic
1055259389 9:74414943-74414965 GTGGAGTGGCAGAATTGGGGAGG + Intergenic
1055356509 9:75443059-75443081 TTGGGGAGCCAGAAAGGAGATGG + Intergenic
1055385645 9:75759368-75759390 GTGGGGTGGGGGGATGGGGAGGG - Intergenic
1055393811 9:75851960-75851982 GTTGGGGGGAAGAAAGGGGAGGG - Intergenic
1055654108 9:78436560-78436582 GTGGGGAGGAAGATTGAGGAAGG + Intergenic
1055708467 9:79033671-79033693 GTGGGGAGCTAGAGAGGGGATGG + Intergenic
1055844673 9:80546842-80546864 GTGGAAAGGCAGAATAGGAATGG + Intergenic
1055869337 9:80855336-80855358 ATGGGGAGCCGGAAAGGGGATGG + Intergenic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056392810 9:86154763-86154785 GTGGGGATCCATACTGGGGATGG + Intergenic
1056459369 9:86794776-86794798 GTGGGGAGAAAGAATGAGGAGGG + Intergenic
1056835095 9:89948282-89948304 GGGGGGAGGGAGGAGGGGGAAGG + Intergenic
1056871905 9:90289626-90289648 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1056937402 9:90926799-90926821 GTGGGTAGGCAGGATTGGGATGG + Intergenic
1057117709 9:92541401-92541423 GTGGGGAGGGGGAAGGGGGGTGG - Intronic
1057226804 9:93296909-93296931 CGAGGGAGGTAGAATGGGGAGGG - Intronic
1057231547 9:93324535-93324557 ATGGGGAGGCTGGAGGGGGATGG - Intronic
1057236542 9:93366082-93366104 ATGGGGAGGCTGGAGGGGGATGG + Intergenic
1057288562 9:93782560-93782582 GTGGGGCGGAGGAATGGGGGAGG - Intergenic
1057387144 9:94614200-94614222 GGAGGGAGGGAGAAGGGGGAGGG + Intronic
1057397049 9:94689658-94689680 GTGGGAAGGCGGGAGGGGGAAGG - Intergenic
1057697438 9:97335320-97335342 GTGGGGTGGGGGAATGGGGGAGG - Intronic
1058030011 9:100185707-100185729 TTGGGGACTCAGAAAGGGGAAGG - Intronic
1058235816 9:102487842-102487864 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1058236598 9:102498123-102498145 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1058550900 9:106113795-106113817 GTGGTGTGGGAAAATGGGGAAGG - Intergenic
1058652291 9:107187928-107187950 GTGGGGAGAGAAAATTGGGAGGG + Intergenic
1058820735 9:108727456-108727478 GTGGGGAGGATGATTGGTGAAGG - Intergenic
1059132883 9:111772995-111773017 GTTGTCAGGCAGAATGGGCAGGG + Intronic
1059324159 9:113493520-113493542 GTGGGGAGGCAGGATGCTGGGGG - Intronic
1059451434 9:114373375-114373397 GTGGGGAGGGAGAAAGGCAAAGG + Intronic
1059456168 9:114401664-114401686 GTGGGGAAGCAGGACAGGGAAGG - Intergenic
1059476427 9:114551500-114551522 CTTGGGAGGCTGAAGGGGGAGGG - Intergenic
1059594922 9:115709226-115709248 GTGGGGTGGGGGAATGGGGGAGG + Intergenic
1059612039 9:115908895-115908917 ATGGAGAGGCAGATTGGAGAGGG + Intergenic
1059952226 9:119477705-119477727 ATGCGGAGCCAGAAGGGGGATGG + Intergenic
1060045429 9:120336711-120336733 GTGGGGAGTCAGAAAGATGAGGG + Intergenic
1060206597 9:121686112-121686134 GTGGGGATCCAGCATGGGGTTGG + Intronic
1060234604 9:121853525-121853547 GTGGGGATGCAGAGTGGACAGGG + Intronic
1060521788 9:124298213-124298235 GTGGGGAGGCGCGAGGGGGAAGG - Intronic
1060766295 9:126296899-126296921 GTGGGCGGGAAGGATGGGGAAGG - Intergenic
1060800879 9:126545340-126545362 GTTGGGGGGCAAAGTGGGGAGGG - Intergenic
1060861539 9:126958857-126958879 GTGGGAAGGCAGAATGGCACAGG - Intronic
1060953684 9:127622158-127622180 GGGGGAGGGCAGAATGGGGAGGG + Intronic
1061204137 9:129153241-129153263 GTGGGGAGGAAGAAGGAGGCAGG + Intergenic
1061264441 9:129497153-129497175 GAGGGGAGGCAGCAGGGTGATGG + Intergenic
1061275567 9:129568098-129568120 TTGGAGAGGAAGAGTGGGGAGGG - Intergenic
1061318768 9:129814712-129814734 GCAGAGAGGCAGAGTGGGGAAGG + Intronic
1061499717 9:130994861-130994883 GATGGGAGGCAGGATGGAGAGGG - Intergenic
1061629806 9:131864990-131865012 TTGGGGATGCAGTATGGGGCAGG - Intronic
1062101486 9:134730837-134730859 GTGGCCAGGCAGGATGGGGCTGG + Intronic
1062158928 9:135069244-135069266 GTGGGGAGACAGAGCAGGGAGGG + Intergenic
1062407293 9:136403080-136403102 GGTGGGGGGCAGAAAGGGGAGGG + Intronic
1062469617 9:136696842-136696864 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469627 9:136696860-136696882 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469659 9:136696922-136696944 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469682 9:136696967-136696989 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469692 9:136696985-136697007 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1203608542 Un_KI270748v1:76009-76031 GTGGAGAGGGAGAAAGGAGAGGG + Intergenic
1185608510 X:1380603-1380625 GAGGGGAGGATGAGTGGGGAGGG + Intronic
1185618187 X:1435990-1436012 CTGGGGAGGCGCACTGGGGAGGG - Intronic
1186036474 X:5428882-5428904 ATGGGGAGCCGGAAAGGGGATGG + Intergenic
1186190458 X:7062696-7062718 GTGGGGAGGGAAGCTGGGGAGGG + Intronic
1186286230 X:8046718-8046740 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
1186632263 X:11362504-11362526 GTGGGGTGGCGGAAGGGGGGAGG + Intronic
1186647254 X:11520303-11520325 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1186677191 X:11831132-11831154 GTGGGGAGCCAGATTGGGACAGG + Intergenic
1187078499 X:15960973-15960995 GTGGCAAGGGAGAATGGGGTTGG + Intergenic
1187097280 X:16161906-16161928 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187138524 X:16571154-16571176 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187336060 X:18382937-18382959 GTGGGAAGCCACAATGGGAAAGG + Intergenic
1187416413 X:19097084-19097106 GAGGGGAGGCAGAGAGGGGCTGG - Intronic
1187593175 X:20741298-20741320 GTGGGGAGGTAATATAGGGAAGG + Intergenic
1187769883 X:22683146-22683168 GTGGGGTGGGGGAAGGGGGAAGG + Intergenic
1187856944 X:23646044-23646066 GTGGGGTGGGGGAATGGGGGAGG - Intergenic
1188336932 X:28947552-28947574 GTGGGGTGGGAGGATGGGGGAGG + Intronic
1188495750 X:30781431-30781453 GGGGAGAGGCATCATGGGGAAGG - Intergenic
1188732953 X:33674554-33674576 CTTGGGAGGAAGAGTGGGGATGG - Intergenic
1189129696 X:38485398-38485420 GGGGAGAGGCAGATTGGGGAAGG + Intronic
1189135175 X:38541620-38541642 GTGGGGTGGGGGGATGGGGAGGG + Intronic
1189333227 X:40155445-40155467 GTGGGGAAGCAGGAAGGGGGTGG + Intronic
1189837332 X:45039210-45039232 ATGGGGAGGCAGAGGGGGGATGG - Intronic
1189935363 X:46062506-46062528 CTGGGGAGCAGGAATGGGGAAGG - Intergenic
1190094392 X:47467152-47467174 GAGGAGAGGGAGAATGTGGAAGG - Intronic
1190259235 X:48787690-48787712 GTGGGGAGGCAGATATGGGCGGG - Intronic
1190403809 X:50066011-50066033 GTGGGGAGGGGGGAGGGGGAAGG + Intronic
1190541435 X:51482133-51482155 GTGGGGATCCATACTGGGGACGG - Intergenic
1190910168 X:54764401-54764423 GTGGGGAGGGGGAAGGGGGGAGG - Intronic
1190930225 X:54942242-54942264 GTGGGGTGGAGGAATGGGGGAGG + Intronic
1191102049 X:56740965-56740987 GTGGTGGGGGAGAGTGGGGATGG - Intergenic
1191145181 X:57157990-57158012 GTGGGGTGGGAGAGAGGGGAAGG - Intergenic
1191205961 X:57834499-57834521 GTGGGGATCCATACTGGGGATGG + Intergenic
1191602413 X:63023001-63023023 GTGGGGTGGTGGAATGGGGGAGG + Intergenic
1191657319 X:63612507-63612529 GTGGGGTGGGGGAGTGGGGAGGG + Intergenic
1191658383 X:63624381-63624403 GTGGGGTGGGGGAGTGGGGAGGG + Intergenic
1191756499 X:64598222-64598244 GTGGGGTGGGGGGATGGGGAGGG + Intergenic
1191896420 X:65998098-65998120 TTGGGGAGGCAGTATGGGAATGG + Intergenic
1191932373 X:66388305-66388327 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
1191973504 X:66843804-66843826 GTGGGGTGGAAGGAGGGGGAAGG + Intergenic
1191974902 X:66861309-66861331 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1192058029 X:67793116-67793138 CTGGGGAGGGAGCATGAGGAAGG + Intergenic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192142810 X:68659837-68659859 GTGAGGAGTCAGGATGGGGCAGG + Intronic
1192343263 X:70281276-70281298 GGGGGGATGCAGAAAGGGAAAGG - Intronic
1192389120 X:70706307-70706329 GTGGGGTGGGAGGAGGGGGAGGG + Intronic
1192482788 X:71499680-71499702 GTGGGGATCCATACTGGGGACGG + Intronic
1192552673 X:72066594-72066616 GTGGTGAGGCAGAAAGGACAAGG + Intergenic
1192715196 X:73633222-73633244 GTGGGGGGGCAGTGGGGGGAGGG - Intronic
1192724434 X:73733206-73733228 GGGGGTAGGGAGAAAGGGGAGGG - Intergenic
1192903377 X:75523300-75523322 GGGAGGAGGCAGAAAGGGGAGGG - Intronic
1192906931 X:75561412-75561434 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1192925415 X:75750211-75750233 ATGGGGATGGAGGATGGGGAGGG - Intergenic
1193008697 X:76650471-76650493 GTGGGGTGGGGGAGTGGGGAAGG - Intergenic
1193031327 X:76901294-76901316 GTGGGGTGGGAGGAGGGGGAGGG + Intergenic
1193207082 X:78761687-78761709 GTGGGGTGGGAGGAGGGGGAAGG + Intergenic
1193416378 X:81229529-81229551 TTGGGGAGCCAGAAGGGAGATGG + Intronic
1193656256 X:84201637-84201659 ATGGGAAGGCAGAAGTGGGAGGG - Intergenic
1193712970 X:84901297-84901319 ATGGGGTGGCAGGATGGGGGAGG - Intergenic
1193846540 X:86479030-86479052 GTTGGGGAGCAGAAGGGGGATGG + Intronic
1193873972 X:86837247-86837269 GTTGGGAGTGTGAATGGGGAAGG + Intergenic
1194337227 X:92663052-92663074 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1194979173 X:100423028-100423050 GTGGGGAGCTAGAAAGGGAATGG + Intergenic
1195098568 X:101530333-101530355 GTGGGGTTGGAGGATGGGGAAGG + Intronic
1195410718 X:104566064-104566086 GAGGGGAGGCAGATTGAGAAAGG - Intergenic
1195439543 X:104885265-104885287 GTGGGGATCCATACTGGGGATGG - Intronic
1195807040 X:108785727-108785749 GTGGGAAGGCAGGGTGGGAAAGG - Intergenic
1196096697 X:111808352-111808374 GTGGGGAGGAAAGATTGGGAAGG - Intronic
1196127378 X:112114283-112114305 GTGGGGATCCATACTGGGGACGG + Intergenic
1196242066 X:113353424-113353446 TGGGGGAGCCAGAAGGGGGATGG - Intergenic
1196632100 X:117953403-117953425 GTGGGGTGGGGGAAGGGGGAAGG + Intronic
1196661969 X:118279407-118279429 GTGGGGATCCATACTGGGGATGG + Intergenic
1196748154 X:119090061-119090083 GTGGGGAAACTGACTGGGGAAGG + Intronic
1197059511 X:122160719-122160741 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1197513379 X:127397525-127397547 GTGGGGATCCATACTGGGGATGG - Intergenic
1197516570 X:127438962-127438984 GTGGGGTGGCGGAACGGGGGAGG + Intergenic
1198166788 X:134065428-134065450 TTGGAGAGGCAGTGTGGGGAGGG - Intergenic
1198705250 X:139441676-139441698 GTGGGGTGGCGGGAGGGGGAAGG + Intergenic
1198883409 X:141306528-141306550 ATGGGGAGCCAGAAAGGAGATGG - Intergenic
1199029684 X:142982065-142982087 GGGGACAGGAAGAATGGGGAGGG - Intergenic
1199044432 X:143152636-143152658 GTCTGGGGGCAGAATGGGGGTGG - Intergenic
1199214688 X:145251032-145251054 GTTGAGAGGCAGCATGGGGTGGG + Intronic
1199324462 X:146481132-146481154 GTTGGGTGGGAGAATGGGGGTGG - Intergenic
1199899603 X:152160020-152160042 GAGGGGAGACAGAAAAGGGAAGG - Intergenic
1199966786 X:152826817-152826839 GTGGGGAGGCAGAAGGGGTGAGG - Intergenic
1200371714 X:155733017-155733039 GTGGGGAGAGAGAAGGGGAATGG + Intergenic
1200710125 Y:6475873-6475895 ATGGGGAGCCAGAATGGAGATGG + Intergenic
1200776197 Y:7172301-7172323 GTGGGGATCCATACTGGGGATGG - Intergenic
1200781036 Y:7215868-7215890 TTTGGGAGGCAGAGTGGGGGCGG + Intergenic
1200801050 Y:7387358-7387380 GTGGGGATCCATACTGGGGATGG + Intergenic
1200815487 Y:7527202-7527224 GTGGGGTGGGAGGATGGGGGGGG + Intergenic
1200883074 Y:8240962-8240984 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1200940573 Y:8775978-8776000 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1200959286 Y:8982380-8982402 GTGGGGATCCATACTGGGGATGG - Intergenic
1201023990 Y:9688835-9688857 ATGGGGAGCCAGAATGGAGATGG - Intergenic
1201146321 Y:11067183-11067205 GGAGGGAGGGAGAAGGGGGAGGG + Intergenic
1201312078 Y:12606206-12606228 GTGGGGATCCATACTGGGGATGG + Intergenic
1201339822 Y:12922726-12922748 ATAGGGAGCCAGAAAGGGGATGG + Intergenic
1201340344 Y:12926352-12926374 GTGGGGAGCCAGAAGGGCGATGG + Intergenic
1201429669 Y:13891463-13891485 GTGGGGATCCATACTGGGGATGG - Intergenic
1201438577 Y:13985432-13985454 GTGGGGAGGGAGGAAGGGGTGGG - Intergenic
1201445996 Y:14057276-14057298 GTGGGGAGGGAGGAAGGGGTGGG + Intergenic
1201487554 Y:14508833-14508855 GTGGGGATCCATACTGGGGATGG - Intergenic
1201555710 Y:15263236-15263258 GTGGGGATCCATACTGGGGATGG - Intergenic
1201604693 Y:15771965-15771987 GTGGGGAACCATATTGGGGATGG - Intergenic
1201631231 Y:16073769-16073791 GTGGGGATTCATACTGGGGATGG - Intergenic
1201740901 Y:17323939-17323961 GTGGGGTGGGGGAGTGGGGAGGG + Intergenic
1201744017 Y:17351432-17351454 GTAGGGATGCATACTGGGGATGG + Intergenic
1201745285 Y:17365484-17365506 GTGGGGTGGCAGGAGGGGGGAGG + Intergenic
1201984681 Y:19952892-19952914 GTGGGGTGGCAGGATGGGGGAGG + Intergenic
1202055690 Y:20827295-20827317 GTGGGGTGGGGGGATGGGGAGGG + Intergenic
1202074727 Y:21026597-21026619 GTGGGGATCCATACTGGGGATGG + Intergenic
1202183592 Y:22160047-22160069 ATGGGGAGCCAGAATGGAGATGG + Intergenic
1202200009 Y:22336240-22336262 ATGGGGAGCCAGAAGGGAGATGG - Intronic
1202207767 Y:22426354-22426376 ATGGGGAGCCAGAATGGAGATGG - Intergenic
1202233324 Y:22678768-22678790 ATGGGGAGCCAGAAGGGAGACGG - Intergenic
1202242857 Y:22788663-22788685 GTGGGGATCCATACTGGGGATGG - Intergenic
1202272084 Y:23082415-23082437 GTGGGGATCCATACTGGGGATGG + Intergenic
1202293942 Y:23338267-23338289 GTGGGGATCCATACTGGGGATGG - Intergenic
1202309832 Y:23517390-23517412 ATGGGGAGCCAGAAGGGAGACGG + Intergenic
1202395844 Y:24422413-24422435 GTGGGGATCCATACTGGGGATGG - Intergenic
1202425081 Y:24716159-24716181 GTGGGGATCCATACTGGGGATGG + Intergenic
1202445708 Y:24953926-24953948 GTGGGGATCCATACTGGGGATGG - Intergenic
1202474941 Y:25247679-25247701 GTGGGGATCCATACTGGGGATGG + Intergenic
1202560969 Y:26153203-26153225 ATGGGGAGCCAGAAGGGAGACGG - Intergenic