ID: 1144892425

View in Genome Browser
Species Human (GRCh38)
Location 17:18501563-18501585
Sequence CAGCTGGTACAGTTTGCGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144892425_1144892427 -6 Left 1144892425 17:18501563-18501585 CCATGCGCAAACTGTACCAGCTG No data
Right 1144892427 17:18501580-18501602 CAGCTGCTCCGCCCACACCACGG No data
1144892425_1144892436 28 Left 1144892425 17:18501563-18501585 CCATGCGCAAACTGTACCAGCTG No data
Right 1144892436 17:18501614-18501636 GCCCCCACTCAGGCACTCTCAGG No data
1144892425_1144892434 18 Left 1144892425 17:18501563-18501585 CCATGCGCAAACTGTACCAGCTG No data
Right 1144892434 17:18501604-18501626 CTCCTTGGACGCCCCCACTCAGG No data
1144892425_1144892429 3 Left 1144892425 17:18501563-18501585 CCATGCGCAAACTGTACCAGCTG No data
Right 1144892429 17:18501589-18501611 CGCCCACACCACGGCCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144892425 Original CRISPR CAGCTGGTACAGTTTGCGCA TGG (reversed) Intergenic
No off target data available for this crispr