ID: 1144892429

View in Genome Browser
Species Human (GRCh38)
Location 17:18501589-18501611
Sequence CGCCCACACCACGGCCTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144892419_1144892429 14 Left 1144892419 17:18501552-18501574 CCCCCCACTGCCCATGCGCAAAC No data
Right 1144892429 17:18501589-18501611 CGCCCACACCACGGCCTCCTTGG No data
1144892422_1144892429 11 Left 1144892422 17:18501555-18501577 CCCACTGCCCATGCGCAAACTGT No data
Right 1144892429 17:18501589-18501611 CGCCCACACCACGGCCTCCTTGG No data
1144892425_1144892429 3 Left 1144892425 17:18501563-18501585 CCATGCGCAAACTGTACCAGCTG No data
Right 1144892429 17:18501589-18501611 CGCCCACACCACGGCCTCCTTGG No data
1144892424_1144892429 4 Left 1144892424 17:18501562-18501584 CCCATGCGCAAACTGTACCAGCT No data
Right 1144892429 17:18501589-18501611 CGCCCACACCACGGCCTCCTTGG No data
1144892423_1144892429 10 Left 1144892423 17:18501556-18501578 CCACTGCCCATGCGCAAACTGTA No data
Right 1144892429 17:18501589-18501611 CGCCCACACCACGGCCTCCTTGG No data
1144892421_1144892429 12 Left 1144892421 17:18501554-18501576 CCCCACTGCCCATGCGCAAACTG No data
Right 1144892429 17:18501589-18501611 CGCCCACACCACGGCCTCCTTGG No data
1144892418_1144892429 21 Left 1144892418 17:18501545-18501567 CCAACGTCCCCCCACTGCCCATG No data
Right 1144892429 17:18501589-18501611 CGCCCACACCACGGCCTCCTTGG No data
1144892420_1144892429 13 Left 1144892420 17:18501553-18501575 CCCCCACTGCCCATGCGCAAACT No data
Right 1144892429 17:18501589-18501611 CGCCCACACCACGGCCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144892429 Original CRISPR CGCCCACACCACGGCCTCCT TGG Intergenic
No off target data available for this crispr